Application of macrophage-derived exosomes in the preparation of anti-peritoneal fibrosis drugs

Abstract

The present invention belongs to the field of biomedicine, and discloses the application of macrophage-derived exosomes in the preparation of anti-peritoneal fibrosis drugs. The present invention first discovered the application of macrophage-derived exosomes-miR-204-5p in the preparation of anti-peritoneal fibrosis drugs. The present invention provides a new idea for extending the available time of human peritoneum through miR-204-5p and ensuring long-term PD treatment efficacy. At the same time, the present invention is also a beneficial attempt to explore the pharmacological mechanism of miR-204-5p in improving peritoneal fibrosis, and also provides a new direction for the study of the potential pharmacological effects of exosomes.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of macrophage-derived exosomes-miR-204-5p in the preparation of anti-peritoneal fibrosis drugs. Background Art

[0002] Peritoneal fibrosis (PF) is the main reason that restricts the long-term clinical application and development of peritoneal dialysis (PD). When the human peritoneum is exposed to non-biocompatible peritoneal dialysis fluid for a long time, the peritoneal tissue and structure are damaged, causing peritoneal inflammation and angiogenesis, leading to PF. Peritoneal mesothelial cells (PMCs) are a single layer of cells covering the surface of the peritoneum. Their main function is to maintain the integrity of the peritoneal structure, participate in peritoneal defense, and transport solutes and water across the peritoneum. Under the influence of the non-biocompatible microenvironment of the peritoneal cavity, PMCs are damaged and secrete a variety of pro-fibrotic factors such as extracellular matrix and TGF-β1, becoming an important initiator of PF.

[0003] At present, Western medicine lacks effective methods and drugs for the prevention and treatment of PF. It mainly explores improving the biocompatibility of dialysate, inhibiting various fibrogenic molecular pathways, protecting PMCs, gene therapy, etc., and conducts basic research on the possible anti-PF mechanisms of some drugs such as RAS blockers, active vitamin D, fluvastatin, mycophenolate mofetil, rapamycin, tamoxifen, exogenous BMP-7, pioglitazone, and dexamethasone, but the results are not ideal.

[0004] In 2003, the New England Journal of Medicine published an article that revealed for the first time that peritoneal dialysis fluid can cause PMCs in dialysis patients to transform into mesenchymal cells, which is manifested by loosening of PMCs intercellular connections, disappearance of end-base polarity, cytoskeletal remodeling, enhanced cell migration and invasiveness, and mesothelial-derived myofibroblasts inducing extracellular matrix deposition in the submesothelial region and producing a large number of fibrogenic factors, proving that mesothelial-mesenchymal phenotypic transformation (MMT) is an important mechanism for the occurrence of PF. As research deepens, more and more evidence shows the role and reversibility of PMCs MMT in the early course of PF. Therefore, it is necessary to find more targeted methods to prevent and treat PMCs MMT, prolong the available time of human peritoneum, and ensure the efficacy of long-term dialysis treatment.

[0005] As a newly discovered intercellular crosstalk medium, exosomes carry a variety of proteins, RNAs, and lipids. By transmitting intercellular information, they participate in processes such as cell proliferation and apoptosis, immune inflammatory response, and cell phenotypic transformation. MicroRNAs (miRNAs) play the role of communicators in intercellular crosstalk. miRNAs are a class of endogenous non-coding RNAs with a length of about 19-25nt, which are widely involved in post-transcriptional regulatory activities of genes. miRNAs are evolutionarily conservative and have high temporal and tissue specificity in quantity, sequence, structure, expression, and function. These characteristics enable miRNAs to act as regulatory factors for messenger RNA (mRNA)-encoded proteins and play an important role in the interaction between different cells. Recent studies have found that the lipid bilayer structure of exosomes can provide good protection for the biological information of the miRNAs carried. Crosstalk between different cells is very likely to be completed efficiently and stably through exosomes carrying miRNAs without interference from various enzymes. Exosomes carrying miRNAs are fully capable of stably carrying biological information, passing through the circulatory system, accurately starting from the source cells and acting on the target cells. It is precisely because of their small size, easy penetration of biological membranes, and low immunogenicity that exosomes can become ideal carriers of therapeutic technologies.

[0006] Numerous studies have shown that inflammation plays an important role in fibrotic diseases of various organs and tissues. In peritoneal tissue, inflammation, as an initiating factor, induces and aggravates the MMT process of PMCs. Macrophages are the most important inflammatory effector cells in the peritoneal cavity and are also one of the cells in close contact with PMCs in the peritoneal tissue cell network system. Summary of the invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide the application of macrophage-derived exosomes in the preparation of anti-peritoneal fibrosis drugs in view of the deficiencies in the prior art.

[0008] Invention idea: In the co-culture model of rat PMCs and macrophages, the present invention observed that exosomes mediated the communication between macrophages and mesothelial cells, improving their mesenchymal phenotype transformation. Rat peritoneal macrophage-derived exosomes were extracted, and differentially expressed miR-204-5p was screened; and in vitro and in vivo experimental studies found that miR-204-5p targeted regulation of Foxc1 inhibited PMCsMMT, inhibited the production of inflammatory factors during PD, and improved PF.

[0009] In order to solve the above technical problems, the present invention discloses the use of macrophage-derived exosomes-miR-204-5p in the preparation of anti-peritoneal fibrosis drugs.

[0010] Wherein, the macrophage-derived exosome-miR-204-5p is derived from the supernatant obtained from macrophage culture.

[0011] Wherein, the culture is to culture the macrophages in RPMI-1640 medium containing fetal bovine serum.

[0012] Wherein, the culture temperature is 37°C.

[0013] Wherein, the content of fetal bovine serum in the culture medium is 10% w / w.

[0014] After the macrophages are cultured, they are centrifuged at 2-6°C, 800-1200g for 5-15min to obtain a supernatant; preferably, after the macrophages are cultured, they are centrifuged at 4°C, 1000g for 10min to obtain a supernatant.

[0015] Wherein, the preparation method of macrophage-derived exosome-miR-204-5p is to filter the supernatant obtained from macrophage culture, take the filtrate; centrifuge the obtained filtrate, take the supernatant; centrifuge the obtained supernatant, take the precipitate; the obtained precipitate is macrophage-derived exosome-miR-204-5p. Preferably, the preparation method of macrophage-derived exosome-miR-204-5p is to filter the supernatant obtained from macrophage culture through a 0.22 μm filter, take the filtrate; centrifuge the obtained filtrate at 0-4°C 10000g for 30 minutes, take the supernatant; centrifuge the obtained supernatant at 100000g for 70 minutes, take the precipitate; the obtained precipitate is macrophage-derived exosome-miR-204-5p. Further preferably, the preparation method of the macrophage-derived exosome-miR-204-5p is to filter the supernatant obtained from the macrophage culture through a 0.22 μm filter to obtain the filtrate; the obtained filtrate is centrifuged at 4°C 10000g for 30 min, and the supernatant is obtained; the obtained supernatant is centrifuged at 100000g for 70 min, and the precipitate is obtained; the obtained precipitate is the macrophage-derived exosome-miR-204-5p.

[0016] Pre-cooled fetal bovine serum was added to the obtained precipitate and the mixture was centrifuged at 100,000 g for 70 minutes to wash the precipitate. The precipitate obtained after centrifugation was macrophage-derived exosomes-miR-204-5p.

[0017] Among them, the macrophage-derived exosome-miR-204-5p targetedly regulates Foxc1 to inhibit the transformation of peritoneal mesothelial cells (PMCs) to mesenchymal phenotype (MMT), inhibit the production of inflammatory factors during peritoneal dialysis, and improve peritoneal fibrosis (PF).

[0018] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0019] (1) The present invention explores the mechanism of exosomal miRNAs in cell communication and makes it possible for miR-204-5p carried by exosomes to become a biomarker for judging and predicting PF, thus providing an alternative therapeutic target for intervening in inflammation-induced PF in clinic.

[0020] (2) The present invention is the first to discover the use of macrophage-derived exosomes-miR-204-5p in the preparation of anti-peritoneal fibrosis drugs. The present invention provides a new idea for extending the available time of human peritoneum through miR-204-5p to ensure long-term PD treatment efficacy. At the same time, the present invention is also a beneficial attempt to explore the pharmacological mechanism of miR-204-5p in improving peritoneal fibrosis, and also provides a new direction for the study of the potential pharmacological effects of exosomes.

[0021] (3) Based on the hot topic of exosomes carrying miRNAs to regulate target genes and mediate intercellular communication, this invention is the first to carry out research on intercellular signal transduction in the field of PD, clarifying the mechanism of inflammatory damage-induced PF from a new perspective, avoiding the limitations of studying a single cell in the complex environment of the abdominal cavity, and exploring a new PF intervention approach targeting macrophage-mesothelial cell communication.

[0022] (4) This invention will elucidate the mechanism of inflammatory damage-induced PMCs MMT from a new perspective, reveal a new gene regulatory pathway of crosstalk between macrophages and mesothelial cells, avoid the limitations of studying a single cell in the complex environment of the peritoneal cavity, and provide new targets and strategies for the prevention and treatment of peritoneal fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0024] Figure 1 LPS-stimulated macrophages induce MMT in PMCs. (A) CD68 marker identification of primary rat peritoneal macrophages; (B) Vimentin and PCK marker identification of primary rat PMCs; (C) Co-culture model of macrophages and PMCs; (D) WB detection of changes in PMCs MMT.

[0025] Figure 2 Macrophage-derived exosomes mediate the MMT effect of PMCs. (A) WB identification of the expression of exosome marker proteins; (B) Electron microscopy observation of exosome structure; (C) Nanoparticle size tracking analysis of exosomes; (D) PMCs uptake of PKH67-labeled macrophage-derived exosomes; (E) WB detection of the effect of exosomes on the expression of MMT-related proteins in PMCs.

[0026] Figure 3 The expression of miRNAs in macrophage-derived exosomes under LPS stimulation. (A) Heat map of differential miRNAs in exosomes; (B) KEGG enrichment analysis; (C-D) PCR verification of differential miRNAs.

[0027] Figure 4 miR-204-5p targeted inhibition of Foxc1 gene expression. (A) PCR detection of miR-204-5p expression in PMCs; (BC) luciferase reporter gene; (D) PCR detection of Foxc1 expression in PMCs; (E) PCR detection of miR-204-5p expression in PMCs; (F) PCR detection of Foxc1 expression in PMCs.

[0028] Figure 5 Foxc1 regulates β-catenin signaling and participates in PMCs MMT. (A) WB detection of Foxc1 expression; (B) WB detection of changes in PMCs MMT; (C) WB detection of changes in β-catenin signaling pathway; (D) WB detection of changes in Foxc1 / β-catenin signaling pathway.

[0029] Figure 6 The effect of miR-204-5p on peritoneal fibrosis in rats. (A) Schematic diagram of animal intervention model; (B) PCR detection of miR-204-5p expression in peritoneal tissue; (C) Masson and HE staining of peritoneal tissue and expression of Collagen I; (D) ELISA detection of serum TNF-α, IL-1β and TGF-β1 expression; (E) WB detection of changes in Foxc1 / β-catenin signaling pathway in peritoneal tissue. DETAILED DESCRIPTION

[0030] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0031] The "%" mentioned in the following examples, unless otherwise specified, are all mass percentages.

[0032] The "w / v" in the following examples refers to g / mL unless otherwise specified.

[0033] Example 1

[0034] 1 Experimental Materials

[0035] 1.1 Rat selection

[0036] SD rats (Qinglongshan Animal Breeding Co., Ltd., Nanjing, China)

[0037] 1.2 Materials and reagents

[0038] Tween 20, chloroform, methanol, isopropanol, anhydrous ethanol, ammonium persulfate, glycerol, glacial acetic acid, phosphomolybdic acid, aniline blue, Sinopharm Chemical Reagent Company; hematoxylin, ponceau red, eosin stain, neutral gum, paraformaldehyde, propylene glycol, Solarbio Company; RIPA, Marker, filter paper, Bio-Rad Company; chemiluminescent substrate ECL, Thermo Scientific Company; PVDF membrane, Millipore Company; cell culture plates, centrifuge tubes, Corning Company; 30% (w / v) Acr-Bis, Bio-Sky Company; LPS, Sigma Company; RPMI-1640 medium, fetal bovine serum (10099-141), trypsin-EDTA (0.25% (w / v)), Gibco; β-Actin (C4) (sc-47778), CD68 (sc-20060), CD63 (sc-5275), TSG101 (sc-7964), CD9 (sc-13118), Foxc1 (sc-293455), SANTA CRUZ Biotechnology Company; Vimentin (5741), Pan-Keratin (4545), E-cadherin (14472), α-SMA (19245), β-catenin (8480), Calnexin (2679), Anti-rabbit IgG (7074), Anti-mouse IgG (Alexa Fluor 594Conjugate) (8890), Anti-rabbit IgG(Alexa Fluor 488Conjugate)(4412), Cell Signaling Technology; C-Myc (ab32072), Cyclin D1 (ab134175), Collagen I antibody (ab34710), Abcam; RNA-easy Isolation Reagent, HiScript II Q RT SuperMix for qPCR (R221-01), ChamQ SYBRqPCR Master Mix (331-02), miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (MR101-01), miRNA Universal SYBR qPCR Master Mix (MQ101), Novozymes; Lipofectamin 2000 Reagent, Life Science; ExoQuick-TCTM Exosome Isolation Reagent, SBI; Exosome RNA Extraction Kit, Thermo; miR-204-5p mimic, miR-204-5p inhibitor, mimic NC, miRNA inhibitor NC, si-Foxc1, Negative control, pEX-1, pEX-Foxc1, AgomirNC, Agomir-204-5p, GenePharma. .

[0039] 2. Experimental Methods

[0040] 2.1 Extraction and identification of rat peritoneal macrophages by peritoneal lavage: After starvation for 12 h, rats were killed by dislocation of the neck after inhalation anesthesia, and disinfected by immersion in 75% (v / v) ethanol for 5 min. 30 ml of pre-cooled PBS was injected intraperitoneally, and the abdomen was massaged on ice for 15 min. The intraperitoneal cell suspension was aseptically aspirated, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and 10 ml of RPMI-1640 medium containing 10% (v / v) FBS was added to resuspend the cells, and the cells were transferred to 37°C, 5% CO 2 After 6 hours in a cell culture incubator, fresh RPMI-1640 medium containing 10% FBS was replaced to obtain macrophages. The purity of the macrophage population was detected by CD68 immunofluorescence method.

[0041] 2.2 Extraction and identification of primary PMCs in rats by trypsin digestion: After starvation for 12 h, rats were killed by dislocation of the neck after inhalation anesthesia and disinfected by immersion in 75% ethanol for 5 min. The skin of the abdomen of the rats was prepared in the supine position, and the peritoneal tissue was aseptically removed after laparotomy and placed in a culture dish. After rinsing three times with PBS containing 1% (v / v) double antibody, the tissue was cut into pieces. 20 ml of 0.25% (w / v) trypsin-EDTA was added and placed at 37°C, 5% CO 2 Digest in the incubator for 30 min; add an equal volume of complete medium to terminate digestion, filter the digestion solution through a 100-mesh cell filter; centrifuge the filtrate at 1000 rpm for 5 min, discard the supernatant; add 10 ml of RPMI-1640 medium containing 10% FBS to resuspend the cells, and move to a 37°C, 5% CO 2 Cell culture incubator, fresh culture medium was replaced after 72 hours, and primary PMCs were obtained after cell fusion. Vimentin and PCK immunofluorescence were used to identify PMCs.

[0042] 2.3 Cell induction mode: LPS intervention group: LPS was dissolved in DMSO and added to RPMI-1640 medium with 10% FBS (macrophages prepared in step 2.1) at a concentration of 100 ng / ml, and intervened in rat peritoneal macrophages for 6 h to induce inflammatory macrophages; blank group: DMSO was added to RPMI-1640 medium with 10% FBS (macrophages prepared in step 2.1) at a concentration of 0.1% (v / v).

[0043] 2.4 Extract macrophage-derived exosomes by ultracentrifugation: After the macrophages extracted in step 2.1 were cultured in RPMI-1640 medium containing 10% exosome-free FBS at 37°C for 48 hours, they were centrifuged at 1000g for 10 minutes at 4°C to remove cell debris and dead cells, and the supernatant was obtained; the supernatant was then filtered through a 0.22 μm filter to obtain the filtrate; the filtrate was centrifuged at 10000g for 30 minutes at 4°C to obtain the supernatant; the supernatant was centrifuged at 100000g for 70 minutes to obtain the precipitate; the obtained precipitate was added with 20 ml of pre-cooled PBS and centrifuged at 100000g for 70 minutes to wash, and the precipitate after centrifugation was obtained, and the obtained precipitate was macrophage-derived exosomes-miR-204-5p.

[0044] 2.5 Transmission electron microscopy: Use 100 μl 2% (w / v) PFA to resuspend the exosome precipitate, and draw 10 μl of the exosome solution and drop it on the copper mesh to precipitate; place the copper mesh in 50 μl 1% (w / v) glutaraldehyde solution for 5 min, and use 100 μl ddH 2 O for 2 min; place the copper mesh on a 50 μl uranyl oxalate droplet for 5 min; mix 9 parts of 2% (w / v) methyl cellulose + 1 part of 4% (w / v) uranyl acetate, and place the copper mesh on the droplet for 10 min on ice; dry in air for 10 min; observe its ultrastructure morphology and size under an electron microscope, and take electron microscope photos at 80 kV.

[0045] 2.6 Nanoparticle tracking analysis: The extracted exosome particles were dissolved in 200 μl PBS and ddHO. 2 O to clean the sample pool; turn on the instrument for preheating and wait for 30 minutes to stabilize the laser; calibrate with polystyrene microspheres, clean the sample pool with PBS, select a sample pool suitable for the exosome sample and measurement type, and inject the prepared sample into 1 / 3 of the sample pool; use software to measure, collect the scattered light signal of the exosomes, observe the image of the Brownian motion of the particles in the solution over a period of time, track and analyze the particles, calculate the hydrodynamic diameter and concentration of the exosomes through the Stockes-Einstein equation, and detect the particle size and concentration.

[0046] 2.7 High-throughput sequencing of exosomal miRNAs: Total exosomal RNA and protein isolation kits were used, and RNA quality control for sequencing was passed. Agilent 2100 bioanalyzer was used for high-throughput next-generation sequencing (BGISEQ-500, BGI; Shenzhen, China) to obtain the best exosomal miRNAs profile. We further analyzed the high-quality clean read sequences by comparing with NCBI GenBank data and miRBase21.0 to screen for differentially expressed miRNAs.

[0047] 2.8 PCR detection of differential miRNA in exosomes: Use miRNA 1st strand cDNA synthesis kit or HiScript III 1st strand cDNA synthesis kit. miScript miRNA real-time PCR was performed using ABI Prism 7500, with an initial activation step of 95°C for 15 minutes, followed by 40 3-step cycles. The expression of each transcript was normalized to that of β-actin or U6, and the ratio of the target transcript to the β-actin or U6 transcript was calculated by 2-ΔΔct. See Table 1 for primer sequences.

[0048] Table 1 Primer sequences

[0049]

[0050]

[0051]

[0052] 2.9 Cell transfection: PMCs were inoculated in 500 μl RPMI-1640 medium containing 10% (v / v) FBS without antibiotics and cultured for 24 h; 20 pmol of transfection material was diluted in 50 μl Opti-MEM and mixed; 1 μl Lipo2000 was diluted in 50 μl Opti-MEM and incubated at room temperature for 5 min; the above liquids were mixed and placed at room temperature for 20 min; 100 μl of the above liquids were added to each well of cells and gently mixed; after 6 h, fresh RPMI-1640 medium containing 10% (v / v) FBS was replaced and cultured for another 24 h. The transfection sequence is shown in Table 2.

[0053] Table 2 Transfection sequence

[0054]

[0055] 2.10 Luciferase reporter analysis: Foxc1 3'-UTR contains the putative binding site of miR-204-5p and was cloned into the pmirGLO vector; firefly luciferase was used as the main reporter gene and nephrolepis luciferase was used as the control reporter gene. The miR-204-5p binding site in Foxc1 and its mutant 3-UTR was cloned into the luciferase reporter plasmid (the sequence to be constructed into the vector FOXC1 WT: AACTTTTAAAATGTGCCTTTTCTCTCATTATAA AAAGGGAA ACTGTATTAATCTCATTCT; FOXC1 MUT:AACTTTTAAAATGTGCCTTTTCTCTCATTATAA TTTCCCTTACTGTATTAATCTCATTCT). MiR-204-5p mimics (see 2.9) were co-transfected into 293T cells with these reporter plasmids. Cells were collected 24 hours after transfection and luciferase activity was detected using a dual-luciferase reporter gene assay system. For each sample, firefly luciferase activity was normalized to Renilla luciferase activity. Data are presented as the mean SD of three independent experiments, expressed as the ratio of firefly luciferase activity: Renilla luciferase activity.

[0056] 2.11 Animal experiment: Agomir NC (5'-UUCUCCGAACGUGUCACGUTT-3', 5'-ACGUGACACGUUCGGAGAATT-3') 40OD was dissolved in 5ml DEPC water to prepare a 20μM solution; Agomir-204-5p (in vivo overexpression of miR-204-5p):

[0057] 5'-UUCCCUUUGUCAUCCUAUGCCU-3', 5'-GCAUAGGAUGACAAAGGGAAUU-3'40OD was dissolved in 5 ml DEPC water to prepare a 20 μM solution.

[0058] Twenty-four SPF male SD rats weighing 150-200g were fed normally for one week and then randomly divided into the following groups: ① Normal control group (NC) of 6 rats were intraperitoneally injected with an equal volume of normal saline qd; ② Model group (PD) of 6 rats were intraperitoneally injected with 4.25% glucose peritoneal dialysis solution qd; ③ Agomir NC negative control group (PD+NTC) of 6 rats were intraperitoneally injected with 4.25% glucose peritoneal dialysis solution qd, and from the third week, Agomir NC 40OD tiw was added for 4 weeks; ④ Agomir-204-5p group (PD+miR-204-5p) of 6 rats were intraperitoneally injected with 4.25% glucose peritoneal dialysis solution qd, and from the third week, Agomir-204-5p 40OD tiw was added for 4 weeks.

[0059] 2.12 Statistical analysis

[0060] The experimental data were used Descriptive statistical results were analyzed using Graphpad prism6.0 software. One-way ANOVA was used between groups, followed by Tukey's multiple comparison test. When p < 0.05, it was considered statistically significant.

[0061] 3 Results

[0062] 3.1 LPS stimulates macrophages to induce MMT in PMCs

[0063] Immunofluorescence was used to label primary rat peritoneal macrophages with CD68, and the positive rate was >98%. The cell morphology was monocyte-like ( Figure 1 A). After extracting rat PMCs, immunofluorescence staining results showed that Vimentin and PCK double positive cells were >95% ( Figure 1 B).

[0064] In order to observe the interaction between macrophages and peritoneal mesothelial cells, a 6-well 0.4 μm pore Transwell plate was used in a blank 6-well plate. Macrophages were seeded into the chamber. After DMSO or LPS intervention, the chamber was removed and placed in a 6-well plate with PMCs in the lower chamber. The exosome-free serum medium was replaced and co-cultured for 24 h ( Figure 1 C), the results showed that after LPS stimulation of rat peritoneal macrophages, the expression of Vimentin and α-SMA in PMCs was upregulated, and the expression of E-cadherin was downregulated ( Figure 1 D), indicating that PMCs underwent MMT.

[0065] 3.2 Macrophage-derived exosomes mediate PMCs MMT process

[0066] To preliminarily verify whether macrophage-derived exosomes, the main effector cells of inflammatory response and important participants in promoting the MMT process of PMCs, are the "connectors" of macrophage-mesothelial cell interactions, we identified peritoneal macrophage exosomes. Western blot identified the expression of exosome-specific surface markers such as CD9, CD63, and TSG101 ( Figure 2 A); transmission electron microscopy revealed that the extracted particles showed a typical "tray-like" exosome morphology ( Figure 2 B); Nanoparticle tracking analysis found that its particle size is 30-150nm ( Figure 2 C), indicating that the extracted particles are indeed macrophage-derived exosomes.

[0067] In order to verify that exosomes can be transported from macrophages to PMCs, the PKH67 green fluorescence labeling kit was used to label macrophage-derived exosomes. The labeled exosomes were co-cultured with PMCs at 37°C for 24 h, and the PMCs were fixed and imaged. The results showed that the fluorescence expression of macrophage exosomes was observed in PMCs ( Figure 2 D). This suggests that macrophage-derived exosomes can freely shuttle into PMCs, indicating that exosomes facilitate communication between macrophages and PMCs.

[0068] In order to clarify whether the MMT of PMCs induced by inflammatory macrophages is mediated by exosomes, macrophage-derived exosomes were used to directly intervene in PMCs. The results showed that compared with the exosomes in the blank group, LPS-stimulated macrophage-derived exosomes could cause upregulation of Vimentin and α-SMA expression and downregulation of E-cadherin expression in PMCs; and the expression was dose-dependent, among which 5μg of LPS-exo had the most significant effect ( Figure 2 EG); indicating that exosomes mediate the intercellular communication between inflammatory macrophages and PMCs and participate in the PMCs MMT process.

[0069] 3.3 LPS affects the expression of differential miRNAs in macrophage-derived exosomes

[0070] Small RNA-seq high-throughput sequencing was used to detect the exosome miRNAs derived from primary peritoneal macrophages in the blank group and LPS intervention group. It was found that compared with the blank group, 37 differential miRNAs such as miR-181b-5p, -100-5p, -122b, and -652-3p were significantly upregulated in the LPS model group, and 46 differential miRNAs such as miR-204-5p, -139-5p, -126a-3p, and -151-5p were downregulated ( Figure 3 A), KEGG analysis revealed that the above miRNAs were mainly enriched in tight junction, PI3K / AKT, Wnt, Hippo, MAPK and other signaling pathways ( Figure 3 B). On this basis, we used small sample cells to verify and qPCR to verify 10 miRNAs with a difference greater than 2-fold and reported to be associated with fibrosis. The results showed that LPS stimulation led to upregulation of miR-181b-5p and miR-122-5p in macrophage exosomes, and downregulation of miR-486 and miR-204-5p ( Figure 3 CD).

[0071] 3.4 MiR-204-5p targets Foxc1 and inhibits its expression in PMCs

[0072] Sequencing results showed that the difference of miR-204-5p between the two groups was 5 times. The expression of miR-204-5p in PMCs after exosome intervention was detected, and the results showed that after LPS-exo stimulation, the expression of miR-204-5p in macrophages was downregulated ( Figure 4 A).

[0073] In order to find its downstream target genes, bioinformatics analysis was used ( www.miRBase.org / www.targetscan.org) found that the 3'-UTR of the transcription factor forkhead box c1 (Foxc1) contains a potential binding site for miR-204-5p, and the two can bind to each other through sequence complementarity.

[0074] In order to verify the targeting relationship between miR-204-5p and Foxc1, we used miR-204-5p mimics and mutant Foxc1. Through luciferase reporter analysis, we found that after intervention with miR-204-5p mimics, the luciferase activity of the Foxc1 gene 3'-UTR wild-type group decreased, while the luciferase activity of the mutant group remained unchanged, suggesting that miR-204-5p can bind to Foxc13'-UTR and inhibit its expression ( Figure 4 BC). The expression of Foxc1 in PMCs was compared with that in the macrophage-derived exosomes after LPS administration. The results showed that compared with the blank group, LPS-stimulated macrophage-derived exosomes could increase the upregulation of Foxc1 in PMCs ( Figure 4 D).

[0075] To further verify the targeting of miR-204-5p to Foxc1 in PMCs, PMCs were transfected with miR-204-5p mimics and inhibitor ( Figure 4 E), the results showed that overexpression of miR-204-5p inhibited the expression of Foxc1, while inhibition of miR-204-5p increased the expression of Foxc1 ( Figure 4 F); This suggests that miR-204-5p can negatively regulate the Foxc1 gene in PMCs.

[0076] 3.5Foxc1 participates in PMCs MMT by regulating β-catenin signaling

[0077] Several studies have shown that Foxc1 can regulate the downstream signaling pathway of β-catenin by binding to β-catenin or other means. In order to explore the relationship between Foxc1 and PMCs MMT, Foxc1 gene overexpression plasmid and silencing siRNA were constructed and transfected into rat PMCs. Western blot analysis showed that after overexpression of Foxc1 gene, β-catenin expression in PMCs was upregulated, and its downstream Cyclin D1 and C-myc protein expression was upregulated; while after silencing Foxc1 gene, β-catenin and its downstream Cyclin D1 and C-myc protein expression were downregulated ( Figure 5 A, 5C); indicating that Foxc1 can regulate the β-catenin signaling pathway.

[0078] The effect of miR-204-5p / Foxc1 axis on MMT of PMCs was studied by transfection of miR-204-5p mimic and si-Foxc1. The results showed that miR-204-5p mimic and si-Foxc1 reversed the upregulation of Vimentin and α-SMA at the protein level, as well as the downregulation of E-cadherin induced by LPS-stimulated macrophage-derived exosomes ( Figure 5 B).

[0079] In order to clarify whether miR-204-5p regulates β-catenin in PMCs through Foxc1, si-Foxc1 was used to intervene in PMCs treated with miR-204-5p inhibitor, and pEX-Foxc1 was used to intervene in PMCs treated with miR-204-5p inhibitor. After 24 hours of intervention, it was found that si-Foxc1 could inhibit the up-regulated Foxc1 protein expression by miR-204-5p inhibitor, while pEX-Foxc1 could reverse the down-regulated Foxc1 protein expression by miR-204-5p mimic ( Figure 5 D). The above results suggest that the miR-204-5p / Foxc1 / β-catenin axis plays a key role in the pathological mechanism of MMT in PMCs.

[0080] 3.6 MiR-204-5p inhibits peritoneal fibrosis in PD rats by regulating the Foxc1 / β-catenin signaling pathway

[0081] In order to clarify the role of miR-204-5p in the treatment of PD-related PF in rats and its targeted regulation of the Foxc1 / β-catenin signaling pathway, we constructed micrON TM miR-204-5p agomir (miR-204 overexpression rat model in 2.11, i.e. PD+miR-204-5p) was used to simulate the overexpression of endogenous miR-204-5p in PF model rats induced by high glucose peritoneal dialysis fluid, and the changes in peritoneal tissue were observed. The q-PCR method was used to determine whether the miR-204-5p overexpression rat model was successful. The results showed that compared with the PD group, there was no significant difference in the expression of miR-204-5p after administration of the negative control, while the expression of miR-204-5p in the peritoneal tissue of the rats given the miR-204-5p agomir group was significantly increased, verifying that the endogenous miR-204-5p overexpression rat model was successfully constructed ( Figure 6 AB).

[0082] By observing the morphological structure of rat peritoneal tissue, it was found that after the administration of the PD model negative control, there was no significant difference in the peritoneal morphological structure between the PD group and the PD group, and both groups had fibrosis changes; while the peritoneal thickness and fibrous collagen deposition of the miR-204-5p overexpression rats were significantly reduced, the peritoneal structure was dense, the shedding of PMCs was improved, the expression of Collagen I was downregulated, and the infiltration of inflammatory cells was partially alleviated ( Figure 6 C). ELISA method was used to detect related inflammatory factors in rat serum. The results showed that miR-204-5p could inhibit the upregulation of inflammatory factors such as TNF-α, IL-1β, and TGF-β1 in rat serum induced by PD ( Figure 6 D). The above results suggest that miR-204-5p can improve PD-induced PF in rats and reduce the inflammatory response during PF. The expression of Foxc1 / β-catenin signaling pathway proteins in the peritoneal tissue of rats in the PD model group increased. After the PD rats were injected with Agomir negative control, there was no significant difference compared with the PD group rats; however, after administration of miR-204-5p Agomir, the upregulation of Foxc1 induced by PD, the increase in the expression of β-catenin and its downstream Cyclin D1 and C-myc proteins were inhibited ( Figure 6 EF). The above suggests that overexpression of miR-204-5p in rats can inhibit the upregulation of Foxc1 / β-catenin-related signaling proteins induced by PD, thereby improving PF and inflammation in rats.

[0083] The present invention provides a method and idea for the application of macrophage-derived exosomes in the preparation of anti-peritoneal fibrosis drugs. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the scope of protection of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. Application of miR-204-5p in the preparation of drugs for anti-peritoneal fibrosis and anti-inflammatory in peritoneal dialysis; miR-204-5p targetedly regulates Foxc1 to inhibit the transformation of peritoneal mesothelial cells to mesenchymal phenotype, inhibit the production of inflammatory factors during peritoneal dialysis, and improve peritoneal fibrosis.

Images