Infinitely proliferating myoblast cell line and its uses
Through CDK4 and hTERT lentiviral vector transduction and PGK promoter overexpression, single-cell clones with high stability were selected to obtain infinitely proliferated human myoblast cell lines, which solved the problem of insufficient survival and secretion ability of cell lines under harsh metabolic conditions in the prior art, and achieved encapsulated cell therapy for secreting therapeutic proteins in long-acting.
Patent Information
- Application Number
- CN202080057528.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-08-14
- Filing Date
- 2020-08-12
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2040-08-12
AI Technical Summary
The prior art is difficult to develop an infinitely proliferating human myoblast cell line that is safe, implantable and has long-acting and high secretion under harsh metabolic conditions for secreting therapeutic proteins in encapsulated cell therapy.
Infinitely proliferating human myoblasts, such as CCOS1901 and CCOS1902 cell lines were obtained by transducing human myoblasts using CDK4 and hTERT lentiviral vectors and overexpressing the PGK promoter under hypoxia conditions, single-cell clones with improved stability and high secretion.
Long-term survival and efficient secretion of therapeutic proteins such as GM-CSF under harsh metabolic conditions are achieved, which are suitable for encapsulated cell therapy, especially anticancer immunotherapy, and are independent of antibiotic selection.
Smart Images

Figure GDA0005455828220000351 
Figure GDA0005455828220000371 
Figure GDA0005455828220000381
Abstract
Description
Technical Field
[0001] The present invention relates generally to the field of encapsulation and, in particular, to the development of immortalized cell lines and methods for generating immortalized cell lines for use as encapsulated cell implants to release therapeutic proteins or adjuvants. Background Art
[0002] Cell encapsulation technology allows for the long-term and / or local administration of macromolecules in a variety of fields. It is based on the implantation of one or more biocompatible capsules containing genetically modified cells into a subject to produce the therapeutic protein of interest. This type of capsule is typically composed of a semipermeable membrane that provides mechanical protection and isolates the modified cells, thereby preventing contact between the transplanted cells and immune host cells and resulting in a prolonged survival of the encapsulated cells. In addition, the semipermeable membrane allows nutrients and oxygen to flow into the transplanted cells and allows the protein of interest to flow out to the host, thereby achieving continuous and prolonged production.
[0003] Ex vivo gene therapy using removable encapsulated cell implants has been developed as an effective strategy for local and / or long-term delivery of therapeutic proteins. In particular, it has been considered that modulating the activity of a patient's immune system is a novel approach for treating various conditions, and in particular, therapeutic regimens using genetically engineered encapsulated cells have been developed, such as long-term administration of monoclonal antibodies for passive immunity against neurodegenerative diseases and local delivery of cytokines as adjuvants for anti-cancer vaccines (Lathuilière et al., 2015, International Journal of Molecular Sciences, Vol. 16, pp. 10578-10600).
[0004] Recently, a technology for active anti-cancer immunity has been developed that uses encapsulated cells that secrete granulocyte-macrophage colony-stimulating factor (GM-CSF) and achieves standardized release of GM-CSF by genetically modified allogeneic cells (MVX-1 cells). GM-CSF has immunoprotective and immunoenhancing activities that are useful for tumor regression. Patients are immunized in healthy skin away from tumor deposits by combining irradiated autologous tumor cells with two capsules containing MVX-1 cells, thereby producing >20ng / 24h of huGM-CSF. This allows for the production of GM-CSF and exposes the immune system to tumor-associated antigens (TAAs) expressed by autologous tumor cells at the injection site. Local expression of GM-CSF recruits and activates antigen-presenting cells (APCs), which induce both antibody-dependent cell-mediated cytotoxicity (ADCC) and cytotoxic T lymphocyte responses at the injection site and systemically (WO 2017 / 064571), as presented in Mach et al., 2015, Annals of Oncology, Vol. 26(Suppl. 8), pp. 1-4, doi:10.1093 / annonc / mdv513.
[0005] If, with a view to the treatment of facioscapulohumeral muscular dystrophy (WO 2019 / 152820), a human primary myoblast cell line has been immortalized by retroviral transduction of CD4 and hTERT according to Stadler et al., 2011, Skeletal Muscle, Vol. 1, No. 12, p. 94, the resulting immortalized cells are selected with antibiotics, which are very inconvenient for use as a potential source of immunogenicity in therapy.
[0006] Other attempts to immortalize primary human myoblasts using overexpression of hTERT, the CDK4R24C mutant, and cyclin D1 did not generate myoblasts with myogenic potential or could not be scaled up for clinical application (Min-wen Jason et al., 2019, Cell Proliferation, Vol. 52, No. 3).
[0007] To optimize the human application of encapsulation technology, it is crucial to generate human cell lines that are implantable, safe, and usable as platforms for the in vivo secretion of recombinant proteins of interest. Therefore, there is a need to develop newly developed and effective cell lines that are particularly suitable for encapsulation technologies that balance safety and long-term efficacy. Summary of the Invention
[0008] The present invention is based on the unexpected discovery of a method for preparing and selecting immortalized human myoblasts, which allows obtaining immortalized human myoblasts with excellent survival characteristics in cell encapsulation devices, specifically the ability to differentiate under harsh metabolic conditions while maintaining high secretion levels of recombinant proteins.
[0009] In particular, the method for immortalizing human myoblasts according to the present invention comprises transducing human myoblasts isolated from muscle tissue from a donor (e.g., a healthy donor or an autologous donor) with at least one lentiviral vector encoding a CDK4 protein (such as the pCLX type or pRRLSIN or other suitable lentiviral vectors, such as those described in Giry-Laterrière, 2011, Methods in Mol. Biology, Vol. 737, pp. 183-209) and at least one lentiviral vector encoding an hTERT protein (such as the pCLX type or pRRLSIN or other suitable lentiviral vectors, such as those described in Giry-Laterrière, 2011 (supra)), and selecting at least one immortalized single clone having improved in vitro proliferation and stability properties (such as prolonged survival) upon encapsulation compared to the parental cell line using single cell cloning technology (without the use of selective antibiotics). In particular, selected immortalized human myoblast cell lines obtained by the methods of the present invention (such as, for example, the cell line deposited under number CCOS1902) advantageously exhibit long-term survival and proliferation capabilities in biocompatible capsules and maintain myoblast characteristics (such as, for example, high levels of MHC) for a long time.
[0010] In addition, another aspect of the present invention is based on the unexpected discovery that the immortalized human myoblast cell line of the present invention can be easily genetically engineered to express a protein of interest, particularly useful in the field of encapsulation therapy technology, and provides a method for preparing genetically modified immortalized human myoblasts, wherein the method comprises transducing the immortalized human myoblasts according to the present invention with at least one lentiviral vector (e.g., pCLX or pRRLSIN type) encoding a protein of interest under the control of a promoter that is overactivated under hypoxic conditions, particularly a PGK (phosphoglycerate kinase) promoter, particularly a human PGK promoter. Under the control of this promoter, under hypoxic conditions, the secretion of proteins by the genetically modified immortalized human myoblasts according to the present invention is advantageously increased by 2-3 times, which makes these cells more interesting for use in cell encapsulation techniques in which cells are subjected to hypoxic conditions. In particular, the genetically modified immortalized human myoblast cell line secreting GM-CSF obtained by the method of the present invention (such as, for example, the cell line deposited under the number CCOS 1901) advantageously exhibits long-term survival and proliferation capabilities in implantable devices, and maintains the myoblast characteristics of high-level GM-CSF secretion for a long time, which are very useful for cancer cell therapy.
[0011] One object of the present invention is to provide immortalized human cell lines that can be used in cell encapsulation technology.
[0012] It would be useful to provide immortalized human cell lines that are not tumorigenic and that exhibit prolonged survival even under hypoxic conditions.
[0013] It would be useful to provide immortalized human cell lines for spontaneous transplantation that could be used without restriction to immunoprivileged sites.
[0014] It would be useful to provide immortalized human cell lines with optimized properties without the need for resort to antibiotic selection of the cell lines.
[0015] It would be useful to provide immortalized human cell lines that can be genetically engineered to secrete high levels of a protein of interest.
[0016] It would be useful to provide genetically engineered immortalized human cells that are capable of maintaining high-level expression of a gene for a protein of interest without silencing over time.
[0017] It would be useful to provide genetically engineered immortalized human cells that are capable of maintaining high levels of secretion of a protein of interest within an encapsulated device.
[0018] It would be useful to provide genetically engineered immortalized human cells that can be frozen and thawed after loading into an encapsulation device and maintain high levels of secretion of a protein of interest.
[0019] The object of the present invention has been achieved by providing the immortalized human myoblast cell line of the present invention, its use and the method for obtaining the immortalized human myoblast cell line of the present invention.
[0020] The object of the present invention has also been achieved by providing the genetically engineered immortalized human myoblasts of the present invention, uses thereof and the method for obtaining the genetically engineered immortalized human myoblasts of the present invention.
[0021] According to a first aspect of the present invention, a method for establishing an immortalized human myoblast cell line is disclosed, comprising the following steps:
[0022] a) providing at least one primary human myoblast expressing the surface marker CD56 and optionally at least one other surface marker selected from CD82 and CD146;
[0023] b) transducing the at least one primary human myoblast with a lentiviral vector encoding a cyclin-dependent kinase 4 (CDK4) gene and a lentiviral vector encoding the catalytic subunit of human telomerase (hTERT) gene to obtain immortal proliferation of the primary human myoblast;
[0024] c) culturing cells from the at least one immortalized primary human myoblast obtained in step b) in a myoblast growth medium and isolating each obtained cell from the growth medium, each obtained cell exhibiting at least one myoblast phenotypic marker in a separate culture medium;
[0025] d) culturing each of the separated cells obtained in step c) in separate culture and expansion media;
[0026] e) selecting at least one cell line having improved stability or expression characteristics from the parental cells by single cell cloning in all individual culture and expansion media of step d);
[0027] f) controlling the myogenic potential of at least one selected cell line;
[0028] g) selecting individual clones based on their ability to survive in the encapsulation device;
[0029] h) optionally repeating steps d) to g) in sequence to further improve the selected cell line.
[0030] According to another aspect of the present invention, there is provided an immortalized human myoblast cell line or its progeny derived from primary human myoblasts, or a composition comprising immortalized human myoblasts, wherein the cells express CDK4 and hTERT and retain myoblast characteristics, and wherein the cells do not express antibiotic resistance genes.
[0031] According to another aspect of the present invention, an immortalized human myoblast cell line or its progeny or composition is provided, wherein the immortalized human myoblast cell line is deposited with CCOS under accession number 1902 (deposited on June 20, 2019).
[0032] According to another aspect of the present invention, an immortalized human myoblast cell line or its progeny derived from primary human myoblasts or a composition comprising immortalized human myoblasts is provided. The immortalized human myoblast cell line can be obtained by the method according to the present invention.
[0033] According to another aspect of the present invention, a method for preparing genetically engineered immortalized human myoblasts that express a therapeutic protein under hypoxic conditions is provided.
[0034] According to another aspect of the present invention, there is provided a genetically engineered immortalized human myoblast cell line or its progeny or composition according to the present invention.
[0035] According to another aspect of the present invention, a genetically immortalized human myoblast cell line or its progeny or composition is provided, which genetically immortalized human myoblast cell line secretes GM-CSF and is deposited with CCOS under accession number 1901 (deposited on June 20, 2019).
[0036] According to another aspect of the present invention, there is provided a genetically engineered immortalized human myoblast cell line or its progeny or composition, wherein the genetically engineered immortalized human myoblast cell line is obtainable by the method according to the present invention.
[0037] According to another aspect of the present invention, there is provided the genetically engineered immortalized human myoblasts of the present invention for use in encapsulated cell therapy.
[0038] According to another aspect of the present invention, a pharmaceutical composition is provided, comprising at least one genetically engineered immortalized human myoblast according to the present invention and a pharmaceutically acceptable carrier, diluent or excipient thereof.
[0039] According to another aspect, the present invention provides genetically engineered immortalized human myoblasts of the invention for use in preventing and / or treating a disorder or disease, in particular cancer, an inflammatory disorder, an infectious disease, in particular a viral infection or a neurodegenerative disorder.
[0040] According to another aspect, the present invention provides the use of the genetically engineered immortalized human myoblasts of the present invention for the preparation of a pharmaceutical composition or an implantable encapsulated cell device for preventing and / or treating a disorder or disease, in particular cancer, an inflammatory disorder, an infectious disease, in particular a viral infection or a neurodegenerative disorder.
[0041] According to another aspect, the present invention provides an implantable biocompatible device or kit comprising at least one immortalized human myoblast according to the present invention in a cell culture medium.
[0042] According to another aspect, the present invention provides a method for preventing or treating an associated disorder or disease in a subject, in particular cancer, an inflammatory disorder, an infectious disease, in particular a viral infection or a neurodegenerative disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of the genetically engineered immortalized human myoblasts of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] Figure 1represents the proliferation capacity expressed as the number of cell population doublings (N) versus the number of months (M) after transduction of the immortalized human myoblasts of the invention (I), i.e. before step d) of the method of the invention, compared to primary myoblasts (P), as measured by cell counting at each passage as described in Example 1.
[0044] Figure 2 represents the proliferation capacity expressed as the number of cell population doublings (N) versus the number of weeks (W) after sorting clones from an immortalized human myoblast population of 9 selected clones (I) as described in Example 1 .
[0045] Figure 3 Shown are the myogenic characteristics retained by the clones obtained by the method of the invention after immortalization and sorting (after step d)) compared to the immortalized population, as measured by maintaining their ability to express myogenic markers over time (A) compared to the immortalized cell population before sorting (I), quantified by flow cytometry, and by maintaining their ability to fuse and differentiate into myotubes (B) compared to primary cells (P3) and immortalized cell populations subjected to 10 and 24 passages, respectively (P10) and (P24), quantified by immunohistochemistry, as described in Example 1.
[0046] Figure 4 Shown are the GM-CSF secretion rates achieved by genetically modified immortalized human myoblasts of the invention (clone 2) immediately after transduction (A), weeks after transduction (W) for clone 2 (B), and at different weeks after transduction (C) for the various clones following the sorting step (iv) of the method, as described in Example 3.
[0047] Figure 5 Shown is the proliferation capacity expressed as the number of cell population doublings (N) versus the number of weeks (W) after sorting clones from a population of 10 selected clones of genetically modified immortalized human myoblasts, as described in Example 3.
[0048] Figure 6 Shown are the myogenic characteristics retained by the clones obtained by the method of the invention after sorting (after step iv)), as measured by their ability to maintain the expression of myogenic markers over time, quantified by flow cytometry (A), and their ability to maintain fusion and differentiation into myotubes, compared to the parental population (MOI = 10 and 100), quantified by immunohistochemistry (B), as described in Example 2.
[0049] Figure 7Shown are the GM-CSF secretion rates achieved by various encapsulated selected clones compared to control encapsulated cells (MVX-1) at different weeks after in vivo transplantation as measured by ELISA, as described in Example 3.
[0050] Figure 8 Shown are the stability of two selected clones, 61.27 and 62.14, over time in terms of: in vitro proliferation rate as non-encapsulated cells (A), expressed as the number of cell population doublings (N) versus weeks (W) after sorting clones from a genetically modified immortalized human myoblast population; in vitro secretion rate as non-encapsulated cells versus weeks (W) after sorting (B) and in vitro secretion rate as encapsulated cells versus weeks (W) after encapsulation (C); in vivo secretion rate as encapsulated cells in mice, as measured by quantification of GM-CSF in serum (D) and in tissue surrounding the capsule (E) compared before implantation, compared to control encapsulated cells (MVX-1), as described in Example 3.
[0051] FIG9 is a diagram of an implantable encapsulation device having encapsulated cells of the present invention used in an experiment. a: is a schematic diagram of an implantable capsule according to one embodiment of the present invention. b: is a schematic diagram of an implantable capsule according to one embodiment of the present invention. Figure 9a Sectional view of line II-II; c: is similar to Figure 9b d: is a cross-sectional view of the capsule, wherein the internal matrix is removed; d: is a cell receiving portion 2 of the implantable encapsulation device containing immortalized myoblasts 24 according to the present invention Figure 9c Detailed view of circle IV in e: Figure 9b Detailed view of the circle V.
[0052] Figure 10 Shown is the rate of GM-CSF secretion achieved by cryoencapsulated genetically modified immortalized human myoblasts (M) of the present invention, as measured by ELISA, versus time (in hours) after thawing, these cells being formulated in 5% (A) and 10% (B and C) glycerol as freezing medium and incubated with freezing medium for different times and compared to control encapsulated cells (MVX-1), as described in Example 3.
[0053] Figure 11The ability of immortalized myoblasts obtained in Example 1 from clone 2 transduced with lentiviral vectors encoding the heavy and light chains of rituximab to produce biologically active monoclonal antibodies was supported as described in Example 4. A: IgG secreted by the genetically modified cells of the invention and commercial rituximab behaved identically when incubated with fluorescently labeled anti-CD20 antibody; B and C: Myoblast-produced IgG was equally effective in a degranulation assay testing the induction of a cytotoxic response (IFN-γ (B) or overexpression of CD107a (C)) following exposure of a B cell line to rituximab or myoblast-produced anti-CD20.
[0054] Figure 12 The release of huGM-CSF from two different capsules and two cell types was compared, as described in Example 5. A: In vitro GM-CSF release in the capsule supernatant of the following groups: Group A: capsules containing genetically modified immortalized human myoblasts that secrete the same therapeutic protein GM-CSF according to one embodiment of the present invention (shown in FIG9 ), Group B: K562 human erythroleukemia cells expressing human GM-CSF, a control cell line, loaded into the same capsule according to one embodiment of the present invention (shown in FIG9 ), and Group C: conventional capsules containing the same control cell line, K562 human erythroleukemia cells expressing human GM-CSF; B: GM-CSF release from explanted capsules that were implanted subcutaneously in mice for one week (each group is the same as in FIGA ); C: GM-CSF levels in the serum of mice that had been implanted with capsules for one week (each group is the same as in FIGA ); D: Amount of GM-CSF detected in the subcutaneous tissue surrounding the implanted capsules after one week (each group is the same as in FIGA ).
[0055] Figure 13 Represents the bioactivity of monoclonal antibodies produced by immortalized myoblasts according to the present invention (myoblasts were transduced for expression of monoclonal human IgG against human CTLA4: C2) in a CTLA-4 blocking reporter gene assay and compared with an ipilimumab biosimilar (Yervoy) as a positive control (C1). TM , Bristol-Myers Squibb Company Bristol- Myers Squibb SA )) were compared as described in Example 3.
[0056] Figure 14 Representative immunohistochemistry of Alzheimer's disease brain sections using anti-β-amyloid monoclonal antibodies produced in immortalized myoblasts, as described in Example 4.
[0057] Figure 15Representative dot blots of pure or diluted (1:5, 1:25) culture supernatants of transduced immortalized myoblasts using two different primary antibodies, AQ806 and AI334, for detection of COVID-19 spike protein, as described in Example 6. DETAILED DESCRIPTION
[0058] As used herein, "treatment" ("treatment" and "treating" and the like) generally refers to obtaining a desired pharmacological and physiological effect. The effect can be prophylactic in terms of preventing or partially preventing a disease, its symptoms or conditions, and / or can be therapeutic in terms of partially or completely curing a disease, condition, symptom or adverse reaction caused by the disease. The term "treatment" as used herein encompasses any treatment of a disease in a mammal, especially a human, and includes: (a) preventing the disease from occurring in a subject who may be susceptible to the disease but has not yet been diagnosed as having the disease, such as a preventive early asymptomatic intervention; (b) inhibiting the disease, i.e., preventing its development; or alleviating the disease, i.e., causing regression of the disease and / or its symptoms or conditions, such as improvement or repair of damage. In particular, the methods, uses, formulations and compositions according to the present invention can be used for encapsulated cell therapy.
[0059] As used herein, the term "subject" refers to a mammal. For example, mammals contemplated by the present invention include humans, primates, livestock (such as cattle, sheep, pigs, horses), laboratory rodents, other pets, and the like.
[0060] As used herein, the term "effective amount" refers to the amount of at least one compound of the present invention or a pharmaceutical formulation thereof that causes a biological or pharmaceutical response in the tissue, system, animal or human being being sought. In one embodiment, an effective amount is a "therapeutically effective amount" for alleviating the symptoms of the disease or condition being treated. In another embodiment, an effective amount is a "prophylactically effective amount" for preventing the symptoms of the disease or condition being prevented. The term also includes in this article an amount of the compound of the present invention that is sufficient to slow the progression of the disease, particularly to slow or inhibit the progression of the condition and thereby cause the response being sought (i.e., an "effective amount").
[0061] The term "efficacy" of treatment according to the present invention can be measured based on changes in the course of the disease in response to the uses or methods according to the present invention. For example, the efficacy of cancer treatment can be measured by a reduction in tumor size or by an extension of overall survival (OS) or progression-free survival (PFS), or by achieving stable disease (SD), or a decrease in serum tumor markers such as prostate-specific antigen (PSA), cancer antigen 125 (CA125), carcinoembryonic antigen (CEA), or reduced metabolic activity, reduced genetic abnormalities such as circulating tumor deoxyribonucleic acid (ctDNA).
[0062] The term "myogenic potential" refers to the ability of cells to form myotubes. This ability can be tested by standard techniques such as those described herein or by flow cytometry, Western blotting.
[0063] The term "human myoblast phenotypic marker" refers to phenotypic characteristics of human myoblasts, such as CD56+, CD146+, CD82+. These can be assessed by fluorescence activated cell sorting (FACS) or by immunohistochemistry or Western blotting. According to a specific aspect, the at least one myoblast phenotypic marker is selected from CD56+, CD146+ and CD82+.
[0064] The term "cell growth medium" refers to a medium suitable for culturing myoblasts, such as a medium supplemented with at least one growth factor such as epidermal growth factor, creatine, uridine, dexamethasone, fetal bovine serum, fetuin, bovine serum albumin, insulin or pyruvate. According to a specific embodiment, the expansion medium may refer to a cell growth medium as defined above.
[0065] The term "pharmaceutical formulation" refers to a preparation that is in a form that achieves the intended effective biological activity of the active ingredient and that contains no additional components that are toxic to a subject to which the formulation would be administered.
[0066] Method for preparing immortalized human myoblasts according to the present invention
[0067] According to one aspect, the present invention provides a method for establishing an immortalized human myoblast cell line, the method comprising the steps of:
[0068] a) providing at least one primary human myoblast expressing the surface marker CD56 and optionally at least one other surface marker selected from CD82 and CD146;
[0069] b) transducing the at least one primary human myoblast with a lentiviral vector encoding a cyclin-dependent kinase 4 (CDK4) gene and a lentiviral vector encoding the catalytic subunit of human telomerase (hTERT) gene to obtain immortal proliferation of the primary human myoblast;
[0070] c) culturing cells from the at least one immortalized primary human myoblast obtained in step b) in a myoblast growth medium and isolating each obtained cell from the growth medium, each obtained cell exhibiting at least one myoblast phenotypic marker in a separate culture medium;
[0071] d) culturing each of the separated cells obtained in step c) in separate culture and expansion media;
[0072] e) selecting at least one cell line having improved stability or expression characteristics from the parental cells by single cell cloning in all individual culture and expansion media of step d);
[0073] f) controlling the myogenic potential of at least one selected cell line;
[0074] g) selecting individual clones based on their ability to survive in the encapsulation device;
[0075] h) optionally repeating steps d) to g) in sequence to further improve the selected cell line.
[0076] According to a specific aspect, step a) of the method of the invention can be performed using two separate lentiviral vectors or a single bicistronic vector, such as described in Reiser et al., 2000, Journal of Virology, 2000, Vol. 74, No. 22, pp. 10589-10599; Amendola et al., 2005, Nature Biotechnology, Vol. 23, pp. 108-116.
[0077] According to a specific aspect, the lentiviral vector used in step b) is a pCLX type vector, such as described in Salmon, 2013, Methods in Molecular Biology, vol. 945, pp. 417-448.
[0078] According to one specific aspect, the at least one primary human myoblast provided for transduction in step b) may be isolated from human muscle tissue by standard methods such as the enzymatic digestion method described in Laumonier et al., 2017, Journal of Visualized Experiments, Vol. 26, No. 125.
[0079] According to another specific aspect, the cells in step c) are grown until the non-immortalized cells die.
[0080] According to another specific aspect, the cell growth in step c) is performed for at least 1.5 months, the time required for non-immortalized cell death.
[0081] According to a specific embodiment, the selection of primary human myoblasts expressing the surface marker CD56 and optionally the additional surface markers CD82 and / or CD146 can be achieved by flow cytometry.
[0082] According to a specific aspect, the myoblasts selected in step c) of the method of the invention exhibit the myoblast phenotype markers CD56+, CD146+ and CD82+. It is also particularly surprising that the method of the invention allows the selection of a subpopulation of cells with this triple positivity, since it has been found that not all CD56-positive cells are also CD82-positive cells. According to another specific aspect, the method according to the invention advantageously comprises a selection / enrichment step based on the surface markers described herein.
[0083] According to a specific aspect, step d) is performed until the cells show stable proliferation and viability when maintained in culture for 4 weeks.
[0084] According to another aspect of the present invention, there is provided a method for preparing genetically engineered immortalized human myoblasts that express a therapeutic protein under hypoxic conditions, wherein the method comprises the following steps:
[0085] i) providing at least one immortalized primary human myoblast;
[0086] ii) transducing the at least one immortalized primary human myoblast with a lentiviral vector for expressing a target protein under the control of a phosphoglycerate kinase (PGK) promoter (e.g., human PGK);
[0087] iii) culturing each of the separated cells obtained in step ii) in separate culture and expansion media;
[0088] iv) selecting, such as by ELISA or Western blotting, at least one cell line having the highest secretion level of the target protein among all the individual culture and expansion cultures of step iii);
[0089] v) controlling the myogenic potential of at least one of the selected cell lines.
[0090] According to a specific aspect, the at least one cell line selected in step iv) is a cell line exhibiting a secretion level of the target protein of at least 1 pg / cell / day.
[0091] According to a specific aspect, the target protein is a human glycoprotein.
[0092] According to a specific aspect, the target protein is human GM-CSF.
[0093] According to a specific aspect, the target protein is a human monoclonal antibody.
[0094] According to a specific aspect, the target protein is selected from rituximab, ipilimumab and gantenerumab.
[0095] According to a specific aspect, the target protein is an antigen.
[0096] According to a specific aspect, the target protein is a viral antigen.
[0097] According to one specific aspect, the target protein is the COVID-19 spike protein or an antigenic fragment thereof.
[0098] According to a specific aspect, the method according to the invention uses in the growing step at least one growth factor chosen from fetuin, epidermal growth factor or insulin.
[0099] According to a particular aspect, the method according to the invention allows the cultivation of cells without the need to coat the culture plates.
[0100] According to another aspect, the present invention provides a method of treating a subject by immunotherapy, said method comprising administering to said subject in need thereof at least one genetically engineered immortalized human myoblast according to the present invention.
[0101] According to another aspect, the present invention provides a method for treating cancer in a subject, said method comprising administering in said subject at least one genetically engineered immortalized human myoblast according to the present invention.
[0102] According to another aspect, the present invention provides a method of vaccinating against a viral infection in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of the genetically engineered immortalized human myoblasts of the present invention, wherein the cells express a viral antigen.
[0103] Cells according to the invention
[0104] According to a specific aspect of the present invention, there is provided an immortalized human myoblast cell line or its progeny derived from primary human myoblasts, or a composition comprising immortalized human myoblasts, wherein the cells express CDK4 and hTERT in the absence of antibiotic resistance gene expression and retain myoblast characteristics, such as the ability to differentiate into myotubes.
[0105] According to another aspect of the invention, the immortalized human myoblast cell line according to the invention exhibits a proliferation rate corresponding to a doubling time of about 24 hours to about 72 hours over at least 6 months.
[0106] According to another aspect of the invention, the immortalized human myoblast cell line according to the invention exhibits a survival period of at least about 48 hours under hypoxic conditions in standard myoblast culture medium.
[0107] According to a particular aspect of the present invention, there are provided immortalized human myoblasts according to the present invention, which cells are capable of continuing to grow stably in myoblast culture medium for at least six months.
[0108] Immortalized human myoblasts according to the present invention have been demonstrated to have prolonged survival in encapsulated devices while maintaining high levels of secretion of proteins of interest and therefore provide a unique and highly advantageous platform for further development of new cell lines genetically engineered to secrete proteins of interest in various fields of application.
[0109] For example, genetically engineered immortalized human myoblasts are typically capable of secreting protein at a rate of about 1 pg / cell / day to about 15 pg / cell / day under standard myoblast culture conditions.
[0110] According to another aspect of the present invention, a genetically engineered immortalized human myoblast cell line or its progeny or a composition comprising genetically engineered immortalized human myoblasts is provided, wherein the cells express CDK4, hTERT and at least one therapeutic protein or antigen, retain myoblast characteristics and are capable of secreting the therapeutic protein or antigen.
[0111] For example, the genetically engineered immortalized human myoblasts according to the present invention express GM-CSF and are capable of secreting GM-CSF. Generally, according to one specific aspect, the genetically engineered immortalized human myoblasts according to the present invention are capable of secreting GM-CSF at a rate of about 1 pg / cell / day to about 5 pg / cell / day under standard myoblast culture conditions for about 6 months.
[0112] According to another aspect of the present invention, a genetically engineered immortalized human myoblast cell line is provided, which expresses human, humanized or chimeric monoclonal antibodies (e.g., anti-CD20 monoclonal antibodies rituximab, ipilimumab, gantezumab) or recombinant proteins (e.g., mouse or human hormones or growth factors) or antigens (e.g., viral antigens, such as the COVID-19 spike protein antigen).
[0113] The composition according to the invention
[0114] The present invention provides cells and pharmaceutical compositions thereof, as well as methods for treating a subject, preferably a mammalian subject, and most preferably a human patient, having a medical condition.
[0115] In another embodiment, the present invention provides a pharmaceutical composition comprising at least one cell of the present invention and a pharmaceutically acceptable carrier, diluent, or excipient thereof.
[0116] The immortalized cells of the present invention or their preparations can be administered as pharmaceutical preparations that can contain one or more agents according to the present invention in any form described herein. For use as encapsulated cells, the cells can be prepared as various types of suspensions or other fluid preparations in cell growth medium, preferably animal component-free medium.
[0117] In one embodiment, the cells can be suspended in a suitable fluid culture medium such as a growth or differentiation medium. The fluid culture medium may include a physiologically acceptable aqueous solution for the growth or maintenance of living cells. For example, the fluid culture medium may contain glucose, salts, minerals, buffers, amino acids, hormones, and growth factors that the cells require and use in vitro and / or in vivo. Fluid culture media suitable for encapsulating cells are described in, for example, PBS, HBSS, MyoCult, or cell growth medium as described herein.
[0118] In one embodiment, cells are encapsulated in hydrogels, such as polyethylene glycol (PEG), alginate or chitosan hydrogels. Encapsulation based on PEG is described in Lathui llère et al., 2014, " Biomaterials ", Vol. 35, pp. 780-790. Cells can be grown on support matrix such as polyvinyl alcohol (PVA), PEG, polyethylene, polyester, such as Li, 2000, " Tissue Engineering ", Vol. 6, No. 2, pp. 151-163; Li, 1999, " Tissue Engineering ", Vol. 5, No. 5, pp. 453-466 (Uludag, 2000, " Advanced Drug Delivery Reviews ", Vol. 42, No. 1-2, pp. 29-64.
[0119] In one embodiment, cells encapsulated in the device to be cryopreserved can be prepared in a formulation containing a cryoprotectant, such as described in Elliott et al., 2017, Cryobiology, Vol. 76, pp. 74-91.
[0120] Implantable device or kit comprising cells of the invention
[0121] The immortalized myoblasts of the present invention can be used for ECT and thus can be encapsulated in cell implants, such as in flat plates as described in Lathuillère et al., 2014 (supra) or WO 2014 / 173441, or in hollow fiber devices such as those described in Lathuillère et al., 2015 (supra), depending on the protein being secreted and the implantation site of the device. Alternatively, devices such as those described in Orive et al., 2019, Progress in Retina and Ophthalmology, Vol. 68, pp. 67-82 may also be used.
[0122] According to one specific aspect, an implantable device containing an effective amount of immortalized human myoblasts of the present invention is provided.
[0123] According to another specific aspect, a kit for cell-based therapy in a mammal and instructions for using the kit to prepare a cell-encapsulated implant are provided, the kit comprising an effective amount of the immortalized human myoblasts of the present invention.
[0124] According to another specific aspect, a kit for cell-based therapy in a mammal and instructions for use thereof are provided, wherein the kit comprises an implantable device containing an effective amount of the immortalized human myoblasts.
[0125] According to another embodiment, the kit of the present invention may further comprise antigenic material (eg, one or more antigens) that can be used for anti-cancer or anti-infective vaccination.
[0126] According to one embodiment, the cell compartment of the implantable device contains between 1.0×10 4 to 8×10 5 The immortalized human myoblasts according to the present invention (e.g., 1.0×10 4 5.0×10 4 1.0×10 5 3.0×10 5 5.0×10 5 or 8×10 5 or 10 6 Cells), depending on the application and the protein being secreted. One skilled in the art will recognize that the precise number of cells in each chamber may depend on both the growth rate of the encapsulated cells / cell lines and / or the volume of a single chamber used to construct the device.
[0127] According to a specific embodiment, with a view to use in personalized anti-tumor cellular immunotherapy as described in WO 2017 / 064571, immortalized human myoblasts secreting GM-CSF may be conditioned in an implantable capsule as described therein.
[0128] According to one embodiment, implantable devices containing at least one immortalized human myoblast according to the present invention can be cryopreserved, and these cryopreserved devices can be shipped under vapor phase liquid nitrogen (e.g., -190°C) and / or dry ice (e.g., -70°C) conditions using any method known in the art.
[0129] Prior to implantation, cryopreserved devices can be thawed prior to implantation using any method known in the art, typically in a 37°C water bath or dry bath.
[0130] According to a specific aspect, the viability and / or functional testing of cells can be carried out before encapsulation and / or before implantation after thawing to confirm that they are used for the suitability of, for example, transplanting. This can be achieved using a variety of methods known in the art. For example, vital dyes can be used, such as, for example, trypan blue or ethidium bromide or acridine orange or Live / Dead assay kit (Molecular Probes; Thermo Fisher Scientific, Waltham, MA) of Waltham, Massachusetts) by cell staining. In a preferred embodiment, the cell colony suitable for transplantation has at least about 50%, at least about 75%, at least about 95% or at least about 99% viability. In other embodiments, the morphometric characteristics of cells can be determined as a measure of the suitability of cells for implantation.
[0131] Mode of administration
[0132] The cells and preparations thereof according to the present invention can be administered by implanting a biocompatible implantable device containing an effective amount of immortalized human myoblasts of the present invention and allowing for the slow release of proteins secreted by the living cells inside the implant.
[0133] According to another aspect, the cells and preparations thereof according to the present invention can be administered in microcapsules or microspheres, such as described in Acarregui et al., 2013, Biomacromolecules, Vol. 14, No. 2, pp. 322-330, or in a hydrophobic or hydrophilic matrix, a biodegradable matrix or a mineral matrix.
[0134] According to another aspect, the cells and preparations thereof according to the present invention can be directly injected as a cell suspension.
[0135] According to one specific aspect, an implantable device suitable for use with the cells of the present invention may be as follows:
[0136] Disclosed herein is an implantable capsule comprising a cell receiving portion comprising a porous membrane surrounding a cell receiving chamber, wherein the cell receiving chamber is configured to receive immortalized cells in a liquid culture medium therein to secrete a therapeutic agent; the implantable capsule is characterized in that the capsule further comprises a cell support matrix inserted into the cell receiving chamber, wherein the cell support matrix is configured to arrange the immortalized cells in the cell receiving chamber.
[0137] In one embodiment, the cell support matrix comprises at least one yarn.
[0138] In an advantageous embodiment, the at least one yarn consists of or comprises a polyester material.
[0139] In an advantageous embodiment, the cell support matrix comprises a plurality of said yarns.
[0140] In an advantageous embodiment, the plurality of yarns ranges from 5 to 20 yarns, preferably from 5 to 15 yarns, for example about 10 yarns.
[0141] In an advantageous embodiment, the yarn extends within the cell receiving chamber over substantially the entire length of the chamber, or over at least 80% of the length of the cell receiving chamber.
[0142] In an advantageous embodiment, the cell-receiving compartment comprises polyester yarn.
[0143] In an advantageous embodiment, the cell receiving portion further comprises a membrane support mounted in the cell receiving chamber, the membrane support being configured to provide structural support to the porous membrane and consisting of or comprising a coil made of a biocompatible material, such as a stainless steel coil.
[0144] In an advantageous embodiment, the capsule further comprises an extractor portion coupled to the extractor end of the cell receiving portion, the extractor portion being configured to allow a surgical tool to pull the implantable capsule from the implantation site and comprising a retrieval wire.
[0145] In an advantageous embodiment, the retrieval thread is made of polypropylene thread.
[0146] In an advantageous embodiment, the extractor portion comprises an anchor tube (8) having a cavity therein, into which the anchor portion (15) of the retrieval wire (9) is inserted and bonded.
[0147] In an advantageous embodiment, the anchor tube consists of or comprises a polyurethane material.
[0148] In an advantageous embodiment, the extractor portion is coupled to the cell receiving portion by a coupling comprising a connector including a portion inserted into the extractor end of the porous membrane and a second portion inserted into the coupling end of the anchor tube.
[0149] In an advantageous embodiment, the connector is bonded to the anchor tube and the cell receiving portion by means of an adhesive, for example a light-curing urethane methacrylate type adhesive, in particular a light-curing adhesive.
[0150] In an advantageous embodiment, the capsule has an outer diameter in the range of 0.5 to 3 mm, preferably in the range of 0.8 to 1.5 mm, and has a length in the range of 5 to 25 mm, preferably in the range of 8 to 20 mm.
[0151] In an advantageous embodiment, the length to diameter ratio of the capsule is in the range of 5 to 20.
[0152] 9 , an implantable capsule 1 according to one embodiment of the present invention comprises a cell receiving portion 2 and an extractor portion 3 connected together by a coupling 4. The cell receiving portion 2 comprises a generally cylindrical outer shape, the diameter of which may typically be in the range of 0.5 mm to 3 mm, and the length of which may typically be in the range of 5 mm to 20 mm, for example, about 10 mm. The ratio L / D of the length L to the diameter D is preferably in the range of 5 to 20, preferably in the range of 5 to 15. The capsule can be implanted into the patient's tissue by means of an implantation device, which is well known per se in the field of implants and does not require further description herein.
[0153] The cell receiving portion 2 includes a porous membrane 5 that is configured to allow the therapeutic agent produced by the cells 24 contained in the capsule to pass through the membrane to the surrounding tissue, and to allow fluids, electrolytes, and nutrients for the cells 24 to pass through the membrane from the surrounding tissue into the capsule. Thus, the porosity and type of the membrane may depend on the specific application and the type of cells contained in the capsule. In one example, the membrane is in the form of, for example, a polyethersulfone (PES) membrane having a porosity of approximately 0.65 μm and configured to allow target molecules to pass through the membrane. Examples of membranes that can be used in the present invention are detailed below:
[0154] One exemplary embodiment of the membrane comprises polyethersulfone, based on its biocompatible chemical composition, structural properties, and inherent membrane properties, such as excellent flow rate, downstream cleanliness, and low protein binding affinity. It can be extruded in various shapes and in small diameter tubing.
[0155] The cell-receiving part 2 can have the form of a flat plate as described in Lathuillère et al., 2014, Biomaterials, Vol. 35, pp. 780-790 or WO 2014 / 173441, or the form of a hollow fiber as described in Lathuillère et al., 2015 (supra), depending on the protein to be secreted and the implantation site of the device.
[0156] The cell receiving portion 2 may contain an effective amount of cells, such as, for example, between about 1.0×10 4 to 8×10 5 The cells according to the present invention (e.g., 1.0×10 4 , 5.0×10 4 , 1.0×10 5 , 3.0×10 5 , 5.0×10 5 or 8×10 5 or 106 Cells), depending on the application and the protein being secreted. One skilled in the art will recognize that the exact number of cells in the cell receiving portion may depend on both the growth rate of the encapsulated cells / cell line and / or the volume of the cell receiving portion.
[0157] A porous membrane 5 surrounds the cell-receiving chamber 13 and a membrane support 6 within the cell-receiving chamber 13. The membrane support serves to mechanically support the porous membrane, maintaining the stability of the volume within the cell-receiving chamber 13 and preventing membrane rupture. In the illustrated embodiment, the membrane support is in the form of a coil, particularly a stainless steel coil known per se, such as described in WO 2017 / 0645701. The membrane support 6 also serves to anchor the extractor portion 3 via the coupling 4.
[0158] In the illustrated embodiment, the coupling 4 includes a connector 10 having a portion 10a that is inserted into the membrane support 6, specifically within a cylinder surrounded by a stainless steel coil in this example. The diameter of the connector insertion portion 10a can be configured to fit tightly into the extractor end of the coil to maintain a stable connection between the two. The coupling 4 also includes a fixing portion 10b that engages the anchor 8 of the extractor part 3, whereby in the embodiment currently shown, the anchor 8 is in the form of a tube, preferably a polyurethane (PU) tube that fits on the second end 10b of the connector 10. Before the extractor end 12b of the cell receiving part and the coupling end 8a of the anchor 8 are respectively inserted into the connector 10, an adhesive 18a can be deposited on the connector. The adhesive can advantageously be in the form of a light-curing adhesive, for example a light-curing methacrylate urethane type adhesive (such as dymax 1187M SV).
[0159] The extractor portion 3 is used to provide a means for pulling the implant out of the patient's tissue at the end of use. In the illustrated embodiment, the extractor portion also includes a retrieval wire 9, which includes an anchor portion 15 fixed to the anchor tube 8 and a wire portion 16 extending beyond the anchor tube, the wire portion being configured to allow a surgical device to grasp the wire to pull the implantable capsule out. In the illustrated embodiment, the retrieval wire 9 is made of, for example, a polypropylene type (such as Prolene TM The retrieval thread is made of a biocompatible yarn or thread (such as a suture). In one embodiment, a length of thread extends within the hollow anchor tube 8 and includes knots 15a. The anchor portion 15 is held within the tube by an adhesive, such as a light-curable adhesive as described above. These knots increase the strength of the retrieval thread attached to the anchor tube. Thus, the retrieval thread is soft and very thin to reduce patient discomfort and allow for easy removal of the implant.
[0160] It is noted that the extractor portion 3 may have different shapes and configurations in order to allow the surgical device to grip onto the implant and pull it out of the patient's tissue.
[0161] In one variation, the retrieval line can be fixed directly to the connector 10 or formed integrally with the connector 10 in the absence of an anchor tube. In such variations, the connector can, for example, include a hole that allows the line to pass through the hole and allow the implanted capsule to be pulled out of the patient's tissue. A polyurethane tube or any other material with sufficient mechanical and biological properties advantageously provides a structure that supports the coupling of the retrieval line. It can also serve as a support for the forceps during manipulation (whether during assembly or during implantation).
[0162] The cell receiving portion 2 also includes a cell support matrix 7 inserted into the cell receiving chamber. In a preferred embodiment, the cell support matrix 7 includes one or more yarns 14 of biocompatible material, preferably multiple yarns extending longitudinally in the cell receiving chamber 13. In a preferred embodiment, the yarn extends from a position at or near the extractor end 12b to a position at or near the cell loading end 12a of the membrane 5. The yarn preferably extends over the entire length or most of the length of the cell receiving chamber 13. In a preferred embodiment, the yarn can advantageously be made of clinical grade polyester (PE), which is well known and has been approved for surgical implantation purposes. Such polyester yarns are commonly used for suturing tissues in patients. An example of a polyester yarn that can be used in a favorable embodiment of the present invention is, for example, 44 / 27-PET-5540-FTT-SS (Textile Development Associates, Inc). This material is a 40 denier 27 filament yarn made of textured polyester.
[0163] Found that cell support matrix 7 significantly improves the performance of the immortalized cells contained in the cell receiving chamber, has improved the activity of therapeutic agent release and the durability over time, especially for adherent cells.This type of adherent cells is the genetically engineered cell that can be used for cell therapy, such as the immortalized human myoblast, mouse myoblast, human retinal pigment epithelial cell, stem cell, stem cell-derived cell line of genetically engineered cell therapy.Thus find that these cells 24 tend to align with the fiber of yarn 14, thereby improved the density and the interval of the cell that is optimized for the release of therapeutic agent and the uptake of nutrients.Yarn also advantageously provides large total surface area for the cell that adheres thereto.
[0164] In an exemplary embodiment, immortalized human myoblasts secreting GM-CSF are loaded into the cell receiving portion 2 of the capsule of the present invention. These capsules can be used for personalized anti-tumor cellular immunotherapy.
[0165] The cells in a cell growth medium such as Ham's F12 or DMEM supplemented with growth factors or fetal bovine serum appropriate for the cell type are loaded into the cell receiving portion. In addition, for cells that will be frozen, a freezing medium / cryopreservative (such as glycerol) is also added to the cell growth medium.
[0166] In one exemplary embodiment, the cell receiving cavity 13 can receive, for example, five to twenty yarns 14 arranged in parallel within the cell receiving cavity and extending substantially the entire length of the cavity. Once the membrane support 6 and the cell support matrix 14 have been installed in the porous membrane 5, the yarns can be inserted into the cell receiving cavity 13 by pulling one end of the yarn through the cavity and installing the coupling 4 on the extractor end 12b of the cell receiving portion 2.
[0167] Note that the cell support matrix can be preassembled to the membrane support prior to inserting the preassembled coil and cell support matrix 7 into the tubular porous membrane 5, for example by inserting the cell support matrix and membrane support 6 through the interior of the coil.
[0168] Thus, the cell-support matrix 7, and in particular the yarn-formed cell-support matrix 14, has the highly beneficial effect of optimizing the orderly distribution of cells within the cell-receiving compartment, thereby increasing secretion yield and rate within a given volume. Furthermore, this configuration allows for easy variation in the length of the cell-receiving compartment by simply changing the yarn cut length to the corresponding length of the coils of the porous membrane tube and membrane support 6. Furthermore, the use of a well-characterized biocompatible implantable polyester does not adversely affect the safety of the device.
[0169] It was also observed that the presence of the cell-supporting matrix 7 allowed the contained cells to be frozen and thawed without affecting the viability of the cells. The presence of the matrix 7 improved the freezing and thawing characteristics of the capsule, which is particularly advantageous because it allows the capsule to be stored in a frozen state for extended periods of time so that it can be used for patient treatment when needed. Specifically, the improved distribution of cells (especially adherent cells) along the yarn appears to help maintain high viability during the freezing and thawing process.
[0170] Cells in liquid culture medium can be inserted into the cell receiving chamber 13 by means of a cell loading device 20 (only partially and schematically shown in the drawing) comprising an outlet nozzle 22 inserted in the cell loading end 12a of the porous membrane 5 .
[0171] The implantable capsule 1 can be provided with a cell-loading device in a preassembled arrangement. In this embodiment, the nozzle 22 of the cell-loading device can be attached to the cell-loading end 12a of the membrane, for example, by means of an adhesive 18c, such as the light-curable adhesive described above. The cell-loading device can include a conduit to allow cells in a liquid culture medium to be injected into the cell-receiving chamber of the capsule through the conduit, with air contained within the cell-receiving capsule being expelled through the porous membrane 5.
[0172] However, as described above, the capsule may be filled with immortalized cells and culture medium in a ready-to-use state, with the cell-receiving end 12 sealed by a stopper (not shown) and then frozen until required for treatment of the patient.
[0173] The implantable devices of the present invention can be implanted in a living subject at various sites, including beneath the skin (e.g., subcutaneously). Alternatively, the device can be implanted intrathecally, intracerebrally, intrabone-wise, intratumorally, intrapleurally, intraocularly, or intraperitoneally.
[0174] The dosage administered to an individual as a single dose or multiple doses will vary depending on a variety of factors including pharmacokinetic properties, patient condition and characteristics (sex, age, weight, health, size), extent of symptoms, concomitant therapy, frequency of treatment, and desired effect.
[0175] combination
[0176] According to the present invention, cells and pharmaceutical preparations thereof can be administered alone or in combination with co-agents useful for preventing and / or treating cancer, in particular cancer cell antigens and / or immune checkpoint inhibitors such as PD-1, PD-L1 or CTLA4 inhibitors, or in combination with co-agents useful for preventing and / or treating autoimmune disorders.
[0177] The present invention encompasses administration of the cells of the invention or preparations thereof, wherein the cells of the invention or preparations thereof are administered to a subject prior to, simultaneously with, or sequentially with other therapeutic regimens or co-agents.
[0178] The cells of the invention or preparations thereof according to the invention that are administered concurrently with the co-agent may be administered in the same or different compositions and by the same or different routes of administration.
[0179] According to one embodiment, a pharmaceutical preparation is provided, comprising at least one cell of the present invention in combination with at least one co-agent useful for preventing and / or treating cancer and at least one pharmaceutically acceptable carrier.
[0180] Subjects
[0181] According to another aspect, the cells, devices, kits and methods of the invention can be used to treat a subject in need of treatment with a therapeutic protein.
[0182] According to one specific aspect, the cells, devices, kits and methods of the invention can be used to treat cancer.
[0183] According to a specific aspect, the cancer is selected from non-Hodgkin's lymphoma, head and neck cancer, melanoma, lung cancer, bladder cancer, renal cell carcinoma, triple-negative breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, ovarian cancer, prostate cancer, sarcoma and chordoma.
[0184] According to another specific aspect, the cells, devices, kits and methods of the invention can be used for treatment by immunotherapy.
[0185] According to another specific aspect, the cells, devices, kits and methods of the invention can be used to treat inflammatory disorders.
[0186] According to another specific aspect, the cells, devices, kits and methods of the invention can be used to treat neurodegenerative disorders.
[0187] According to a specific aspect, the neurodegenerative disorder is selected from Alzheimer's disease and Parkinson's disease.
[0188] According to another specific aspect, the cells, devices, kits and methods of the present invention can be used to prevent and / or treat infectious diseases, especially viral infections.
[0189] According to one specific aspect, the viral infection is a COVID-19 viral infection.
[0190] According to another specific aspect, the immortalized cells and methods according to the present invention can be used for vaccination with tumor antigens (e.g., tumor or viral antigens) or for enhancing the capacity of a patient's own immune system to enhance the efficacy of an immune response against neoplastic cells or viral particles.
[0191] For example, cells that secrete the GM-CSF immunostimulatory cytokine can be effectively used as part of personalized anti-tumor cellular immunotherapy, as described in Gupta et al., 2010, Advances, Medical Discovery, vol. 50, pp. 52-60.
[0192] According to a specific aspect, the immortalized cells and methods according to the present invention can be used to produce other proteins (such as antibodies or antibody fragments) that modulate the intensity of the immune response, specifically blocking the CTLA-4 protein (immune checkpoint inhibitors) to treat cancer, especially melanoma.
[0193] For applications in the field of oncology, in the context of the present invention, the following proteins can be used for secretion by the encapsulated cells: Trastuzumab for breast cancer (HER2+) Pertuzumab Rituximab for lymphoma and CML (chronic myeloid leukemia) Blinatumomab for acute lymphoblastic leukemia (ALL) Obinutuzumab for chronic lymphocytic leukemia (CLL) Ofatumumab Cetuximab for colon and head and neck cancers Panitumumab for colon cancer Nexituzumab for lung cancer Bevacizumab for colon cancer or recurrent brain tumors Ramucirumab for gastric cancer Nivolumab for advanced cancers such as melanoma, lung cancer, head and neck cancer, bladder cancer, and kidney cancer Pembrolizumab Atezolizumab Durvalumab Avelumab Ipilimumab for melanoma and kidney cancer Daratumumab for multiple myeloma or elotuzumab Datuximab for neuroblastoma Olaratumab for soft tissue sarcomas and catumaxomab for refractory ovarian cancer
[0194] For applications in the field of inflammatory disorders, in the context of the present invention, the following proteins can be used for secretion by the encapsulated cells:
[0195] Adalimumab for inflammatory bowel disease, rheumatic polyarthritis, ankylosing spondylitis, rheumatic polyarthritis, and psoriasis Infliximab Golimumab Belimumab for systemic lupus erythematosus Tocilizumab for rheumatic polyarthritis or juvenile polyarthritis Salimumab Brolimumab for psoriasis Ixekizumab Secukinumab Guselkumab for psoriasis Ustekinumab for psoriasis and Crohn's disease Vedolizumab for ulcerative colitis and Crohn's disease Canakinumab for pyrin-associated periodic fever syndrome Daclizumab for multiple sclerosis or natalizumab Ogilvymab for multiple sclerosis Dupilumab for atopic dermatitis Mepolizumab for asthma reslizumab and benralizumab Ranibizumab for macular degeneration
[0196] For applications in other therapeutic areas, therapeutic proteins, in particular insulin or antibodies, such as those described in Kaplon et al., 2019, Monoclonal Antibodies, Vol. 11, No. 2, pp. 219-238.
[0197] For applications in the field of neurodegenerative disorders, in the context of the present invention, the following proteins can be used for secretion by the encapsulated cells: gantenerumab, adalimumab, clerazumab, gosuraneamab, ceranatumumab or zagtenemab for Alzheimer's disease, progressive supranuclear palsy or frontotemporal dementia; PRX002 / RG7935 (Prasinezumab), BIIB-054 (simpanetumab) or MEDI 1341 / TAK-341 (AstraZeneca, Takeda Pharmaceutical Company) for Parkinson's disease or multiple system atrophy.
[0198] According to a specific embodiment, in the field of vaccines, in the context of the present invention, the following proteins can be used for secretion by the encapsulated cells.
[0199] According to a specific embodiment, antigens and vaccine adjuvants may be secreted by genetically engineered immortalized human myoblasts according to the present invention, wherein said cells secreting the antigen and cells secreting the vaccine adjuvant, such as GM-CSF, are placed in different implantable biocompatible devices (administered in close proximity to each other) or those different secreting cells are loaded into the same implantable biocompatible device.
[0200] According to another specific embodiment, the immortalized human myoblasts according to the invention may be transduced for the expression of both at least one antigen and at least one vaccine adjuvant.
[0201] According to another specific embodiment, the immortalized human myoblasts according to the present invention can be transduced to express several antigens for the same pathological agent (e.g., spike protein and E protein from COVID-19), or the genetically engineered immortalized human myoblasts according to the present invention that secrete several antigens for the same pathological agent can be used simultaneously (e.g., in the same implantable device).
[0202] Methods and uses according to the invention
[0203] The present invention provides genetically engineered immortalized human myoblasts according to the invention for use in preventing and / or treating a disorder or disease, in particular cancer, an inflammatory disorder or a neurodegenerative disorder.
[0204] The present invention also provides the use of the genetically engineered immortalized human myoblasts according to the present invention for the preparation of a pharmaceutical preparation (e.g., an encapsulated cell preparation) which can be used to prevent and / or treat a disorder or disease, in particular cancer, an inflammatory disorder or a neurodegenerative disorder.
[0205] The present invention also provides a method for preventing or treating an associated disorder or disease in a subject, particularly cancer, an inflammatory disorder or a neurodegenerative disorder, comprising administering to a subject in need thereof a therapeutically effective amount of the genetically engineered immortalized human myoblasts of the present invention.
[0206] According to one aspect, the genetically engineered immortalized human myoblasts according to the present invention can be used to treat, for example, cancer.For example, the genetically engineered immortalized human myoblasts according to the present invention secrete GM-CSF.
[0207] In particular, genetically engineered immortalized human myoblasts according to the present invention can be used to treat cancer.
[0208] According to another aspect, the genetically engineered immortalized human myoblasts according to the present invention can be used to treat inflammatory disorders (eg, rheumatoid arthritis).For example, the genetically engineered immortalized human myoblasts according to the present invention secrete anti-TNFα antibodies.
[0209] References cited herein are hereby incorporated by reference in their entirety.Having described the present invention, the following examples are given by way of illustration and not limitation.
[0210] Example
[0211] The following studies were performed in accordance with the present invention to support the effectiveness of the cells and methods of the present invention.
[0212] The following abbreviations refer to the following definitions:
[0213] DAPI (4,6-diamidino-2-phenylindole); DMEM (Double's Modified Eagle's Medium); DPBS (Double's Phosphate-Buffered Saline); EDTA (Ethylenediaminetetraacetic acid); FBS (Fetal Bovine Serum); HBSS (Hank's Buffered Saline); MEF (Myocyte Enhancer Factor); PFA (Paraformaldehyde).
[0214] Example 1: Preparation of immortalized human myoblast cell line
[0215] The immortalized human myoblast cell line was prepared according to the method of the present invention as follows:
[0216] The following reagents were used:
[0217] Myoblast Growth Medium (GM):
[0218] Ham's F10 (GIBCO 41550021) supplemented with:
[0219] 15% FBS (GIBCO 10101145)
[0220] Bovine serum albumin (Sigma-Aldrich A4503; 0.5 mg / mL)
[0221] Fetuin (Desert Biological 302070; 0.5 mg / mL)
[0222] Epidermal growth factor (R&D Systems 236-GMP-200; 10 ng / mL)
[0223] Dexamethasone (PharmaServ 8016; 0.39 μg / mL)
[0224] Insulin (Sigma-Aldrich I9278; 0.04 mg / mL)
[0225] Creatine monohydrate (ParmaServ 8114; 149 μg / mL)
[0226] - Pyruvate (Gibco 11360039; 100 μg / mL)
[0227] Uridine (U3003; 50 μg / mL)
[0228] Gentamicin (Gibco 15710049; 5 μg / mL)
[0229] Myoblast Differentiation Medium (DM):
[0230] DMEM (GIBCO 61965026) supplemented with the following substances
[0231] Bovine serum albumin (Sigma-Aldrich A4503; 0.5 mg / mL)
[0232] Epidermal growth factor (R&D Systems 236-GMP-200; 10 ng / mL)
[0233] Insulin (Sigma-Aldrich I9278; 10 μg / mL)
[0234] Creatine monohydrate (ParmaServ 8114; 149 μg / mL)
[0235] - Pyruvate (Gibco 11360039; 100 μg / mL)
[0236] Uridine (U3003; 50 μg / mL)
[0237] Gentamicin (Gibco 15710049; 10 μg / mL)
[0238] Blocking solution:
[0239] DPBS (Sigma D8537) containing the following:
[0240] - Goat serum (Sigma G9023, 2%)
[0241] Tween 20 (AppliChem A1389, 0.2%)
[0242] HBSS (GIBCO 14175053)
[0243] PFA 4% (Santa Cruz sc-281692)
[0244] Triton X-100 (AppliChem A1388)
[0245] Liquid blocker (Arcus Biologicals NAN-012)
[0246] Mouse anti-MF20 antibody (Hybridoma Bank)
[0247] Rabbit anti-MEF2 antibody (Santa Cruz sc-313)
[0248] Goat anti-mouse Alexa 488 antibody (Life A11029)
[0249] Goat anti-rabbit Alexa 546 antibody (Life A11035)
[0250] DAPI Fluoromount-G (SouthernBiotech 0100-20).
[0251] 1.1 Human myoblast source
[0252] Human myoblasts were obtained from human muscle tissue obtained as small muscle fragments dissected from a 32-year-old female donor who had never smoked and had no significant medical history or chronic disease who had suffered a left knee trauma with anterior cruciate ligament injury, with informed consent. Eligibility criteria for tissue donation were defined according to the FDA guideline "Eligibility of Donors of Human Cells, Tissues, and Cell- and Tissue-Based Products (HCT / P)". The criteria were as follows:
[0253] -Age > 18
[0254] - Healthy subjects: no identified chronic conditions (including muscle diseases)
[0255] —Planned plastic surgery
[0256] — Negative screening test for the following infectious diseases: HIV 1 and 2, HBV, HCV, Treponema pallidum, HTLV 1 and 2, West Nile virus.
[0257] And the study protocol was approved by the Geneva Ethics Committee.
[0258] 1.2 Isolation and culture steps of primary myoblasts
[0259] Under sterile conditions in a cell culture hood, human muscle tissue was rinsed with DMEM. Fat and fibrotic tissue were removed using forceps and scissors. The tissue was placed in a culture dish containing 5 mL of 0.05% trypsin-EDTA and cut into millimeter fragments with scissors. The muscle fragments and trypsin were transferred to a sterile dissociation bottle. For a maximum of 3 g of tissue, the volume of 0.05% trypsin-EDTA was adjusted to 90 mL. The tissue was incubated at 37°C with stirring for 60 minutes. Digestion was terminated with 10% FBS. The muscle solution was then filtered through a 70 μm cell strainer and centrifuged at 1000 rpm for 5 minutes at room temperature (RT) to pellet the cells. After discarding the supernatant, the pellet was dissolved in DMEM and filtered through a 40 μm cell strainer. 200,000 cells were seeded in 3.5 mL of growth medium (GM) / 60 mm culture dish. The cells were incubated at 37°C and 5% CO2. Once the cells reached 75% confluence, the GM was removed and the cells were washed with HBSS. Apply a minimum volume of 0.05% trypsin EDTA to cover the cell surface and incubate at 37 ° C for 3 minutes. Use the same volume of GM to stop the reaction. Collect cells and centrifuge at room temperature for 5 minutes at 1000 rpm. Discard the supernatant, wash the cells with GM, and centrifuge again. For cell staining, the cells are resuspended in 200 μ L of GM and the following antibodies are added: 3 μ L of anti-CD56-AlexaFluor488, 0.5 μ L of anti-CD82-PE, 3 μ L of anti-CD146-PECy7. After incubation at 4 ° C for 30 minutes, wash the cells and use MoFlo Astrios EQ (Beckman Coulter) to be sorted by flow cytometry. Myoblasts are defined as CD56+CD146+CD82+.
[0260] 1.3 Immortalization of myoblasts using lentiviral vectors encoding CDK4 and hTERT (steps b) and c)
[0261] The immortal proliferation of the myoblasts obtained above was achieved by transduction of two genes: the cyclin-dependent kinase 4 (CDK4) and the catalytic subunit of human telomerase (hTERT) as previously proposed (Zhu et al., 2007, Cell Aging, Vol. 6, pp. 515-523). Under the expression of the human phosphoglycerate kinase (hPGK) promoter, the transgene was cloned into the third generation pCLX lentiviral vector backbone as described in Salmon, 2013, Methods in Molecular Biology, Vol. 945, pp. 417-448. The specific viral infectivity was titrated on HeLa target cells and expressed as transduction units per mL (TU / mL) (Barde et al., 2010, Modern Neuroscience Compendium, Chapter 4, Unit 4.21, doi:10.1002 / 0471142301.ns0421s53).
[0262] On day 0, primary human myoblasts were seeded in 24-well plates at 20,000 to 30,000 cells / well in 500 μL of GM. On day 1, cells were infected with lentivirus. To achieve immortalization, a multiplicity of infection (MOI, viral copies / cell) of 3 was applied to the cells for each vector (such as pCLX-PGK-hTERT and pCLX-PGK-CDK4 as described herein). On day 2, 500 μL of fresh GM was added to each well. On day 3, the cells were passaged in new culture dishes.
[0263] Cells were maintained in culture at 37°C, 5% CO2, and proliferation was quantified using an automated cell counter (Countess, ThermoFischer). The population doublings for each passage were defined as log N / log 2, where N is the number of cells harvested at confluence divided by the number of cells initially seeded. Although primary myoblasts ceased to proliferate after 45 days, cells transduced with lentivirus continued to grow stably for up to six months, as shown in Figure 2. Figure 1 Visible in.
[0264] This demonstrates that transduction of primary myoblasts with lentiviral vectors encoding CDK4 and hTERT can effectively immortalize the cells.
[0265] 1.4 Myoblast Growth and Cloning (Steps d) and e)
[0266] Once the cells reached 75% confluence, the cells were separated, washed and stained with anti-CD56-AlexaFluor488, anti-CD82-PE and anti-CD146-PECy7, as previously described in Laumonier et al., 2017 (supra). After incubation at 4 ° C for 30 minutes, the cells were washed and sorted by flow cytometry using MoFlo Astrios EQ (Beckman Coulter) in 96-well plates with one cell per well. Myoblasts are defined as CD56+CD146+CD82+. Individual clones were then cultured in growth medium, expanded and sorted by sorting from an immortalized myoblast population (I) using single cell cloning in 96-well plates at 1 cell / well. A total of 33 clones were isolated, and automated cell counting was used at each passage to quantify the proliferation rates of nine selected clones (1-3, 5-6, 13, 17, and 20-21) that maintained qualitative morphological characteristics and were shown to remain stable over time, as shown in Table 1. Figure 2 Visible in.
[0267] 1.5 Control of the potential of myoblasts to differentiate into myotubes (step f)
[0268] To assess the myogenic potential of the myoblast clones obtained by the method of the present invention after immortalization and sorting (after step d)), their ability to maintain expression of myogenic markers over time (triple positivity for CD56, CD82, and CD146) was quantified by flow cytometry, and their ability to maintain fusion and differentiation into myotubes was quantified as follows. Cells were seeded into GM in 35 mm culture dishes. When the cells reached 100% confluence, the GM was removed, the cells were washed with HBSS, and differentiation medium was added. After 72 hours, the cells were washed twice with DPBS and fixed with 4% PFA at 4°C for 15 minutes. After washing three times with DPBS, circles were drawn around the cells with a waterproof pen. Blocking solution was applied for 30 minutes at room temperature. Primary antibodies were incubated overnight at 4°C (mouse anti-MF20 was diluted 1 / 1000 in blocking solution, and rabbit anti-MEF was diluted 1 / 300 in blocking solution). After washing 3 times with DPBS and incubating with blocking solution for 5 minutes, secondary antibodies were incubated at room temperature for 1 hour (goat anti-mouse Alexa 488 diluted 1 / 1000 in blocking solution, goat anti-rabbit Alexa 546 diluted 1 / 1000 in blocking solution). After washing 3 times with DPBS, coverslips were mounted with DAPI Fluoromount-G. To quantify the percentage of differentiation and fusion index, seven images of each condition were randomly acquired at 20X on a fluorescence microscope. The number of MEF-positive nuclei and DAPI-positive nuclei was quantified.
[0269] like Figure 3As can be seen in Figure 2, immortalized myoblasts obtained by the methods of the present invention maintain expression of myoblast phenotypic markers, such as myogenic markers (CD56, CD82, and CD146), and the ability to fuse and differentiate into myotubes. It can be seen that some clones exhibit stable myogenic marker expression, while others lose expression, indicating lower stability. Therefore, clones exhibiting the best stability were used for further experiments. Specifically, clone 61.27, deposited under CCOS1901 (derived from clone 2, deposited under CCOS1902, described above), was used for encapsulation studies.
[0270] The immortalized myoblast cell lines obtained were characterized as follows in order to check their suitability for the encapsulation technique:
[0271] Myoblast encapsulation ability
[0272] The ability of the immortalized myoblasts obtained to be encapsulated was determined as follows: GM was removed and 75% confluent cells were washed with HBSS. A minimum volume of TrypLE (Thermo Fisher Scientific) was added to cover the cell surface and incubated at 37°C for 3 minutes. The cells were then gently separated from the culture dish surface. The reaction was terminated with the same volume of HBSS. Cells were collected and counted in duplicate using an automated cell counter (Countess II device, Thermo Fisher Scientific). Cells were centrifuged at 1'000rpm for 5 minutes at RT, and 800'000-1'000'000 cells were resuspended in 25 μL of GM. The 25 μL cell suspensions were loaded into capsules containing hollow fibers as described in Figure 9 and Example 5, which had an internal matrix of genetically engineered immortalized myoblasts for secreting GM-CSF. Immortalized human cells (MVX-1) of hematopoietic origin, genetically modified to produce GM-CSF, were used as a control. These immortalized human cells were loaded into capsules containing hollow fibers as described in Lathuiliere et al., 2015 (supra) and encapsulated in a device as described in WO 2017 / 064571. The vasculon (the capsule's loading tube) was cut and sealed using a UV-sensitive adhesive (Dymax). The capsules were then placed in 2 mL of GM in a 12-well plate for 24 hours prior to implantation.
[0273] Six clones (#1, #2, #6, #13, #17, and #21) were selected for evaluation based on their proliferation rate and differentiation capacity. These clones were encapsulated and maintained in culture for up to 1 month. The capsules were then fixed and processed for histological analysis. A qualitative assessment of survival was then performed, and based on the viable cell density inside the device (the presence of viable cells in the middle of the device and how the cells spread within the device), this analysis concluded that clones #2 and #13 had good survival characteristics. These clones were then selected for genetic engineering to express GM-CSF as detailed below.
[0274] Myoblast culture under hypoxic conditions
[0275] The behavior of the immortalized myoblasts obtained under hypoxic conditions was tested as follows: cells were plated and cultured under standard conditions for 24 hours to allow for cell adhesion. The culture dish was then placed in a hypoxic incubator at 37°C containing 1% oxygen for 24 hours. When recombinant protein was to be quantified in the culture medium, fresh culture medium pre-incubated in the hypoxic chamber for 24 hours was added to the cells for two hours prior to quantification.
[0276] Example 2: Alternative method for sorting immortalized human myoblasts in step d)
[0277] Alternatively, in the method for establishing an immortalized human myoblast cell line according to the present invention, the isolation of immortalized human myoblast clones in steps c) and d) may be performed on the encapsulated myoblast population according to steps c1) to c4).
[0278] The immortalized myoblast population obtained under 1.3 was encapsulated into the implantable device with the inner matrix as shown in FIG. 9 .
[0279] The device was implanted in the subcutaneous tissue of mice and kept for 3 weeks. After 3 weeks, the device was taken out and placed in culture medium. The capsule was sliced and its contents (cells and matrix) were spread in the culture medium in a culture dish. The cells were kept in culture for several weeks to amplify. The cells were then separated and dyed for FACS sorting of human myoblasts (defined as CD56+CD146+CD82+). A single human myoblast clone was isolated from the myoblast colony.
[0280] The myogenic potential (differentiation into myotubes) of three of these clones appeared unaffected. The proliferation rates of these clones were also monitored over several weeks and had doubling times of approximately 24 to approximately 72 hours for at least 6 months.
[0281] Example 3: Preparation of a genetically modified immortalized human myoblast cell line
[0282] The immortalized human myoblast cell line obtained by the method of the present invention can be used to prepare genetically modified cells for the production of a protein of interest, in particular for its secretion within the capsule.
[0283] 3.1 Transduction of myoblasts for secretion of recombinant GM-CSF (step ii)
[0284] To express human or mouse GM-CSF, human or mouse GM-CSF cDNA was cloned into the pCLX lentiviral vector under the expression of the human PGK promoter as described in Salmon, 2013 (supra).
[0285] The human PGK promoter contains hypoxia response elements, which are enhancers that upregulate gene expression under hypoxic conditions (Firth et al., 1994, Proceedings of the National Academy of Sciences of the United States of America, Vol. 91, pp. 6496-6500). To confirm this, primary myoblasts were transduced with lentiviral vectors encoding GFP (MOI = 5) under the expression of the phosphoglycerate kinase (PGK) or ubiquitin (UBI) promoter, and after 36 hours in 1% oxygen, the cells were fixed and fluorescence was quantified by flow cytometry. It was observed that in myoblasts, the PGK promoter drives stronger expression than UBI, and myoblasts upregulate GFP expression under hypoxic conditions when driven by the PGK promoter (as opposed to the UBI promoter).
[0286] For this reason, the PGK promoter was used in the genetic engineering of immortalized human myoblasts of the present invention because secretion of the target protein may be enhanced when the myoblasts are encapsulated. Therefore, clones #2 and #13 obtained in Example 1 were transduced with different concentrations of the above-mentioned lentivirus, and different MOIs (3-100) were applied to the cells.
[0287] The ability of genetically modified immortalized human myoblasts to secrete recombinant proteins was quantified as follows:
[0288] Cells were seeded in T75 cell culture flasks. Once 75% confluence was reached, the cells were washed with HBSS and 5 mL of fresh growth medium was added for 2 hours at 37°C. The culture medium was then collected for GM-CSF quantification and the cells were counted using an automated cell counter (Countess II device, Thermo Fisher Scientific). Different ELISA kits were used depending on the protein to be quantified (GM-CSF human ELISA kit #KHC2011, GM-CSF mouse ELISA kit #BMS612, IgG (total) human ELISA kit #BMS2091, Thermo Fisher Scientific). The protocol was applied according to the manufacturer's instructions. The results are reported in pg / cell / day. Figure 4 As shown in A, GM-CSF expression was obtained from the genetically immortalized human myoblasts of the present invention.
[0289] GM-CSF secretion from the cell population generated by the transduced immortalized clone #2 was monitored weekly for nine weeks and confirmed that transduction with the lentiviral vector efficiently generated a highly stable GM-CSF-secreting cell line. Figure 4 As shown in B.
[0290] 3.2 Isolation of clones secreting human GM-CSF (steps iii) and iv)
[0291] 125 individual clones were sorted from two GM-CSF expressing populations (clones #2.100 and #13.10) and GM-CSF expression was measured for each clone. For each population, GM-CSF secretion was monitored over several weeks for the 10 clones that secreted the highest levels of GM-CSF in the range of approximately 1 pg / cell / day to 4 pg / cell / day. Figure 4 C) and proliferation ( Figure 5 These data support that the secretion and proliferation rates of GM-CSF-secreting clones remain stable over time.
[0292] The stability of the isolated GM-CSF-secreting myoblast clones expressing myogenic markers (triple positivity for CD56, CD82, and CD146) and their ability to fuse and differentiate into myotubes over time were assessed as detailed above and as Figure 6 The shown is confirmed.
[0293] The obtained genetically modified immortalized myoblasts were characterized as follows in order to check their suitability for the encapsulation technique:
[0294] Myoblast encapsulation ability
[0295] The ability of the obtained immortalized myoblasts to be encapsulated was determined as described above, and six clones selected based on GM-CSF secretion levels, growth rate, and myogenic characteristics (i.e., myogenic marker expression and ability to differentiate into myotubes) were encapsulated and then tested in vivo (mouse subcutaneous tissue).
[0296] Implantation of the hollow fiber encapsulation device in mice
[0297] All experiments on mice were performed in accordance with Swiss regulations on the care and use of experimental animals. Animals were raised and maintained in a specific pathogen-free environment and were allowed to freely access water and food. Adult Rag2 / Il2rg double knockout mice (Shinkai, March 6, 1992, "Cell", Vol. 68, No. 5, pp. 855-867) were anesthetized with isoflurane and the capsules were implanted in the subcutaneous tissue using a trocar. The wounds were closed with surgical staples and the animals were allowed to recover in their home cages. Analgesia was provided by subcutaneous injection of 0.1 mg / kg buprenorphine 20 minutes before anesthesia and 2 mg / mL acetaminophen was provided in drinking water within three days. At the end of the experiment, mice were killed by lethal injection of sodium pentobarbital. The devices were dissected and fixed directly for histological analysis or placed back in culture medium for further quantitative recombinant protein expression. Histological processing was performed as previously described (Schwenter et al., 2011, "Cancer Gene Therapy", Vol. 18, pp. 553-562).
[0298] GM-CSF secretion levels were measured from the capsules before implantation and after explantation (at 1 and 3 weeks). GM-CSF was also measured in mouse serum. Histological analysis of the capsules was also performed after explantation to qualitatively measure cell survival. This experiment was performed using an encapsulation device with an internal matrix as described in Example 5 and Figure 9. Secretion levels were compared to those obtained by immortalized human cells of hematopoietic origin (MVX-1) that were genetically modified to produce GM-CSF, encapsulated in a device as described in WO 2017 / 064571, and currently used in current clinical trials NCT02193503 (Phase I) and NCT02999646 (Phase II HNSCC).
[0299] like Figure 7 As can be seen, all encapsulated clones presented much higher secretion levels than MVX-1 cells, thus confirming the advantageous effects of the immortalized cells of the present invention, especially for encapsulation therapy.
[0300] Then, clone #61.27 deposited as CCOS1901 (derived from clone 2 deposited as 1902 above) was selected based on its high secretion rate (approximately 3 pg / cell / day) and the highest serum levels of GM-CSF (indicating high-level delivery of GM-CSF by clone 61.27), and clone #62.14 was selected because GM-CSF delivery remained stable over time, indicating high cell viability. Figure 8 As described in , the proliferation rate of these two clones was monitored in vitro over a period of 6 months and the GM-CSF secretion rate as non-encapsulated and encapsulated cells was also monitored in vitro over several months. Figure 8 Shown are the stability of clones 61.27 and 62.14 over time in terms of: in vitro proliferation rate as non-encapsulated cells (A), expressed as the number of cell population doublings (N) versus weeks (W) after sorting clones from a genetically modified immortalized human myoblast population; in vitro secretion rate as non-encapsulated cells versus weeks (W) after sorting (B) and in vitro secretion rate as encapsulated cells versus weeks (W) after encapsulation (C); in vivo secretion rate as encapsulated cells in mice, as measured by quantification of GM-CSF in serum (D) and in tissue surrounding the capsule (E) compared before implantation, compared to control encapsulated cells (MVX-1), as described in Example 3.
[0301] Those clones were loaded into encapsulation devices as described in Example 5 and shown in Figure 9 and the secretion of GM-CSF compared to the encapsulated cells (MVX-1) as defined above was monitored in vitro over several months as described above.
[0302] Freezing and Thawing of Encapsulation Devices Preloaded with Human Myoblasts
[0303] The effect of different freezing conditions on GM-CSF expression levels after thawing was tested. The genetically modified immortalized GM-CSF-secreting myoblasts (clones 61.27 and 62.14 in freezing medium containing different concentrations of glycerol (used as a cryopreservative)) were loaded into capsules. Before freezing, the loaded capsules were suspended in freezing medium and incubated in freezing medium for different time periods. For freezing, the capsules were placed in silicone tubes pre-filled with freezing medium and transferred to cryovials. The cryovials were quickly transferred to CoolCell freezing containers (Biocision) and placed at -80°C overnight, and then transferred to liquid nitrogen for long-term storage.
[0304] To thaw, transfer the frozen capsules from the silicone tubes to pre-warmed GM in a 10 cm dish. After gentle agitation, remove the capsules from the silicone tubes and place them in a 12-well plate containing GM.
[0305] As from Figure 10 As can be seen in Figure 2, after freezing in glycerol, the GM-CSF-secreting myoblasts of the present invention performed much better than the control cell line (MVX1) ( Figure 10 C). Use 10% glycerol ( Figure 10 B and Figure 10 C) works well as a freezing medium and incubation times of 0 to 30 minutes for cells with the freezing medium before freezing.
[0306] Example 4: Diversity of Potential Genetically Modified Immortalized Human Myoblast Cell Lines Producing Therapeutic Proteins
[0307] Immortalized myoblasts according to the present invention are genetically engineered for the ability to express a therapeutic complex molecule of interest, such as an antibody.
[0308] Therapeutic macromolecules
[0309] Transduction of myoblasts for secretion of recombinant anti-human CD20 IgG (step ii)
[0310] To express anti-human CD20 IgG, the variable region of the rituximab heavy chain was inserted into the human IgG1 heavy chain backbone, and the variable region of the rituximab light chain was inserted into the human kappa light chain backbone. These two sequences were synthesized and cloned into the third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder) as described in SEQ ID NO: 6 and SEQ ID NO: 7. Cells were infected with the heavy and light chain vectors, using the same MOI for both transgenes, as described in Lathuilière, 2016, Methods in Molecular Biology, Vol. 1448, pp. 139-155.
[0311] As described in Example 2, the immortalized myoblasts obtained from clone 2 in Example 1 were transduced with lentiviral vectors encoding the heavy and light chains of rituximab, a commercial therapeutic anti-CD20 monoclonal antibody, using methods already described (Lathuiliere et al., 2016 (supra)) using different doses of lentivirus (MOI). IgG secretion was then quantified in the culture medium and the functionality of the secreted anti-CD20 IgG was confirmed by flow cytometry. In a competition assay, human PBMCs (peripheral blood mononuclear cells) were pre-incubated with different concentrations of myoblast-produced anti-CD20 IgG or commercial rituximab and then incubated with fluorescently labeled anti-CD20 antibody. These experiments support that the IgG produced in this assay acts exactly like rituximab, as Figure 11 As shown in A. In addition, Figure 11 B and Figure 11(C) Myoblast-produced IgG was equally effective in a degranulation assay testing the induction of a cytotoxic response (IFN-γ or overexpression of CD107a) following exposure of B cell lines to rituximab or myoblast-produced anti-CD20.
[0312] The obtained anti-CD20 IgG secreting myoblasts were then loaded into an implantable device as described in Example 5 and Figure 9 (two cell populations were tested, CD20.30 and CD20.100, 10 6 The cells were collected from the capsules (cells / device) and implanted into the subcutaneous tissue of mice. IgG secreted from the capsules was quantified in culture medium before implantation. Anti-CD20 IgG plasma levels were then quantified every two weeks from live animals.
[0313] Transduction of myoblasts for secretion of anti-CTLA4 IgG
[0314] To express anti-human CTLA4 IgG, the variable region of the ipilimumab heavy chain (WO 200 / 1014424) was inserted into the human IgG1 heavy chain backbone, and the variable region of the ipilimumab light chain (WO 2001 / 014424) was inserted into the human kappa light chain backbone. These two sequences were synthesized and cloned into the third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder) as described in SEQ ID NO: 2 and SEQ ID NO: 3. Cells were infected with the heavy and light chain vectors using the same MOI for both transgenes as described in Lathuilière, 2016, Methods in Molecular Biology, Vol. 1448, pp. 139-155.
[0315] As described in Example 2, immortalized myoblasts obtained from clone 2 in Example 1 were transduced with lentiviral vectors encoding the heavy and light chains of ipilimumab, a commercial therapeutic anti-CTLA4 monoclonal antibody, using methods already described (Lathuiliere et al., 2016 (supra)) at different lentiviral doses (MOI). IgG secretion was then quantified in the culture medium by ELISA, and the bioactivity of the secreted anti-CTLA4 IgG was confirmed in a CTLA-4 blocking bioassay, as described in Example 2. Figure 13 Shown: In this study, aAPC / Raji cells and CTLA-4 effector cells served as antigen-presenting cells and effector cells, respectively. CTLA-4 effector cells were Jurkat T cells expressing human CTLA-4 and a luciferase reporter gene, whose expression is regulated by the upstream NFAT-RE. aAPC / Raji cells were Raji cells expressing endogenous CD80 / CD86 and cell surface proteins capable of activating the TCR.
[0316] When positive control or secreted anti-CTLA4 is added, they can block the interaction between CTLA-4 and CD80 / CD86 and relieve immunosuppression, thereby activating T cells and activating NFAT-induced luciferase expression. The blocking activity of anti-CTLA-4 antibodies on luciferase activity was evaluated. Figure 13 As shown, myoblast-produced antibodies expressed by genetically engineered immortalized human myoblasts according to the present invention were compared with ipilimumab biosimilars as a positive control. This assay demonstrated that myoblast-produced anti-CTLA4 exhibited significant blocking activity against the interaction between CTLA-4 and CD80 / CD86. 50 Equivalent to positive control (Yervoy TM , Bristol-Myers Squibb Company Bristol-Myers Squibb SA )), i.e. 1.519 compared to the control of 1.573.
[0317] Myoblast transduction for secretion of anti-β-amyloid (gantenerumab)
[0318] To express anti-human β-amyloid IgG, the variable region of the gantezumab heavy chain (EP1960428) was inserted into the human IgG1 heavy chain backbone, and the variable region of the gantezumab light chain (EP1960428) was inserted into the human kappa light chain backbone. These two sequences were synthesized and cloned into the third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder) as described in SEQ ID NO: 3 and SEQ ID NO: 4. Cells were infected with the heavy and light chain vectors using the same MOI for both transgenes as described in Lathuilière, 2016 (supra).
[0319] The immortalized myoblasts obtained from clone 2 in Example 1 were then transduced with lentiviral vectors encoding the heavy and light chains of gantenerumab, a Phase III therapeutic anti-β-amyloid monoclonal antibody, prepared as described above, using methods already described (Lathuiliere et al., 2016 (supra)) at different doses of lentivirus (MOI), as described in Example 2. The secretion of IgG was then quantified in the culture medium by ELISA. The functionality of the antibodies was tested by performing immunohistochemistry on brain sections from human Alzheimer's disease cases. Briefly, the sections were dewaxed, antigen retrieval was performed in citrate buffer, and the sections were incubated with supernatant from the transduced human myoblasts at 4°C overnight. After washing in PBS, the secondary antibody was incubated for 2 hours at room temperature. The sections were washed and microscopic images were obtained. Positive staining was observed on the sections, indicating that the secreted antibodies were functional (arrows, Figure 14 ).
[0320] Foreign proteins
[0321] To test the ability of the immortalized human myoblasts of the present invention to be genetically engineered to produce proteins from different species, immortalized myoblast clones obtained in Example 1 were transduced with different doses (MOI) of a lentiviral vector encoding mouse GM-CSF (mu-GM-CSF) protein. Individual mu-GM-CSF-secreting clones were then isolated from the transduced population, and one clone was selected and encapsulated into an implantable device as described in Example 5 and FIG9 (10 6 cells / device). The delivery of muGM-CSF was quantified in vitro over several weeks.
[0322] The bioactivity of the secreted muGM-CSF was confirmed by in vivo experiments, in which a strong cellular immune response was detected around the subcutaneously implanted encapsulated device. The level of muGM-CSF secretion was measured before implantation and at different time points after explantation (after 1 day, 3 days, 5 days and 7 days). Some capsules were kept in vitro as a comparator during the experiment. A decrease in secretion levels was observed, which is consistent with previous findings, and the large immune infiltration generated by the bioactivity of GM-CSF affects the survival of the encapsulated cells. The influx of inflammatory cells can reduce the diffusion of oxygen and nutrients to the encapsulated cells.
[0323] All of these data support that the immortalized human myoblasts of the present invention exhibit excellent long-term viability even in an encapsulated environment, while maintaining myoblast characteristics for >100 days. Those immortalized human myoblasts can be genetically engineered to produce high levels of proteins of interest (such as antibodies, antibody fragments, growth factors, cytokines, etc.) in an encapsulated environment where they can proliferate. Finally, these cells, once encapsulated, can be directly frozen after loading and subsequently thawed, an important feature that is very convenient for future clinical applications.
[0324] Example 5: Comparison of the behavior of immortalized cells of the present invention in different devices
[0325] In the following experiment, two types of implantable capsules were compared: the capsules described in Figure 9 for Groups A and B versus the capsules described in WO 2017 / 064571 for Comparative Group C (conventional capsules).
[0326] Group A: Capsules loaded with cells of the present invention (immortalized human myoblast cell line expressing human GM-CSF (cell line deposited under the number CCOS1901))
[0327] Panel B: Capsules loaded with control cell line: K562 human erythroleukemia cells expressing human GM-CSF
[0328] Panel C: Capsules were loaded with the same control cell line: K562 human erythroleukemia cells expressing human GM-CSF.
[0329] Conventional capsules do not encapsulate any support matrix and are therefore not suitable for loading adherent cells, such as human myoblasts. To compare the efficacy of the two different capsules in producing huGM-CSF over time, the K562 human erythroleukemia cell line expressing human GM-CSF was used as an alternative cell line for producing the protein of interest. Groups B and C provide a direct comparison of the performance of the two capsules, as the two different capsules contain the same genetically engineered cell line expressing the same therapeutic protein of interest according to the present invention.
[0330] Approximately 800,000 cells were loaded into the capsules under sterile culture conditions. The capsules were maintained in culture medium at 37°C and 5% CO2. The delivery of human GM-CSF was quantified in the culture medium using ELISA (Kit #KHC2011, Thermo Fisher Scientific) and reported in ng / 24 hours. Figure 12 A).
[0331] The capsules were then implanted into the subcutaneous tissue of the mice for 1 week. After the animals were sacrificed, the capsules were removed from the animals and placed in culture medium to quantify human GM-CSF delivery ( Figure 12B). In addition, in mouse serum ( Figure 12 C) and the subcutaneous tissue surrounding the capsule ( Figure 12 D) GM-CSF was quantified.
[0332] These data support that the culture of the known genetically engineered K562 human erythroleukemia cell line expressing human GM-CSF in a matrix containing macrocapsules according to embodiments of the present invention represents an improvement over the capsules described in WO 2017 / 064571. However, the combination of the novel genetically engineered immortalized myoblasts according to the present invention in a matrix containing macrocapsules according to embodiments of the present invention was by far the most effective for achieving sustained and stable GM-CSF production both in vitro and in vivo.
[0333] Example 6: Diversity of Possible Genetically Modified Immortalized Human Myoblast Cell Lines Producing Antigens of Interest
[0334] The ability of immortalized myoblasts according to the present invention to be genetically engineered to express and secrete an antigen of interest, such as for vaccination purposes, has been determined as follows.
[0335] To express the COVID-19 spike protein trimer [NC_045512.2 (21563..25384)], the DNA sequence encoding the 1-1'208 residues of the COVID-19 spike protein (UNIPROT P0DTC2SPIKE_SARS2) was modified with the following: proline substitutions at positions 986 and 987, GSAS substitutions at furin cleavage sites 682-685, addition of the T4 fibrin trimerization domain, and codon optimization for expression in human cells (SEQ ID NO: 1). The modified sequence was then synthesized and cloned into the third generation pLV-hPGK-WPRE lentiviral vector (Vectorbuilder). Myoblasts were infected with various MOIs. Secretion of the spike protein in the culture medium was assessed by dot blot. Briefly, 3 mL of pure culture supernatant or diluted culture supernatant was loaded onto a nitrocellulose membrane, the membrane was blocked in PBS containing 3% milk powder, washed three times in PBS, and incubated with 1 mg / mL AI 334 (US 2010 / 0172917; Yuan et al., May 8, 2020, Science, vol. 368, no. 6491, pp. 630-633) or AQ 806 ( https: / / oap.unige.ch / journals / abrep / article / view / 186 ; https: / / oap.unige.ch / journals / abrep / article / view / 219; Wrap et al., May 28, 2020, Cell, Vol. 181, No. 5, pp. 1004-1015) antibodies were probed overnight (please visit the Geneva Antibody Facility https: / / www.unige.ch / medecine / antibodies / cov-resources / ). The membrane was then incubated with an HRP-conjugated secondary antibody and the membrane was uncovered. Analysis of the supernatant of the transduced immortalized myoblasts revealed the secretion of fibronectin ( Figure 15 ).
[0336] These data support that immortalized myoblasts according to the present invention can be successfully modified to express a variety of therapeutic proteins of interest. With respect to viral antigens, immortalized myoblasts according to the present invention that are genetically engineered to express those viral antigens can be advantageously used in vaccination strategies, particularly in combination with agents that enhance the immune response.
[0337]
[0338] TATATGCGCCTCTTATCAGACACAAACTAATTCACCCGGCTCCGCCTCCAGTGTAGCTTCTCAAAGC
[0339] ATTATAGCATATACAATGTCTCTTGGGGCCGAAAATTCCGTGGCCTATTCGAACAATTCAATCGCCA
[0340] TCCCAACCAACTTTACAATCAGCGTGACGACCGAAATTCTGCCTGTGAGCATGACGAAAACCAGCGT
[0341] AGACTGCACTATGTATATCTGTGGGGACTCCACTGAGTGCTCCAACCTTCTCCTGCAGTACGGGAGC
[0342] TTCTGTACCCAATTAAACCGTGCCCTTACAGGCATCGCTGTTGAGCAGGATAAGAATACCCAGGAAG
[0343] TTTTTGCCCAGGTTAAGCAGATATACAAAACACCGCCAATTAAAGACTTCGGAGGCTTCAACTTCTC
[0344] TCAGATACTGCCTGACCCTTCCAAGCCATCAAAACGGAGCTTCATTGAGGACCTCTTGTTCAACAAA
[0345] GTGACTCTGGCTGATGCTGGCTTCATTAAGCAGTACGGAGATTGCCTGGGGGATATTGCTGCCAGGG
[0346] ATCTCATCTGTGCCCAGAAGTTTAATGGCCTGACAGTCTTGCCTCCACTTCTGACAGACGAGATGAT
[0347] TGCACAGTACACAAGTGCCCTCCTCGCTGGCACCATAACATCCGGATGGACATTTGGTGCAGGTGCT
[0348] GCCCTCCAGATTCCCTTTGCAATGCAGATGGCGTATCGCTTTAACGGCATCGGTGTCACACAAAACG
[0349] TGTTGTATGAGAACCAAAAGCTCATCGCTAACCAGTTTAATTCTGCTATTGGGAAAATTCAGGACAG
[0350] CCTGTCATCGACCGCGTCTGCCCTTGGGAAGTTGCAGGACGTGGTGAATCAGAATGCTCAGGCCTTA
[0351] AATACTCTGGTGAAACAACTCTCTTCAAATTTCGGCGCAATCAGCTCTGTGTTAAACGACATCCTAA
[0352] GTAGGCTTGATCCGCCGGAGGCTGAAGTTCAAATTGATAGATTGATTACTGGCAGGCTCCAGTCTTT
[0353] ACAGACCTACGTTACACAGCAGCTGATCCGAGCGGCTGAGATTAGAGCTTCCGCCAATCTGGCCGCA
[0354] ACCAAGATGTCCGAATGTGTCCTGGGTCAGTCAAAGCGGGTCGACTTTTGTGGTAAAGGCTACCACC
[0355] TCATGTCATTTCCCCAGAGTGCACCTCACGGAGTAGTGTTCCTCCACGTCACCTACGTTCCAGCACA
[0356] GGAAAAGAATTTTACCACTGCACCGGCAATCTGTCACGACGGCAAGGCACACTTCCCCCGAGAGGGC
[0357] GTATTCGTGTCGAATGGAACTCATTGGTTCGTCACACAGCGAAACTTTTATGAGCCTCAGATCATTA
[0358] CCACCGATAATACATTTGTGTCCGGGAACTGCGACGTTGTCATTGGAATCGTCAACAACACTGTATA
[0359] CGATCCACTTCAGCCAGAACTGGATAGCTTTAAGGAAGAATTGGACAAATATTTCAAAAATCACACT
[0360] TCACCCGATGTGGACCTGGGGGACATTAGTGGGATCAATGCATCCGTGGTCAATATCCAAAAAGAGA
[0361] TTGACAGGCTCAACGAGGTGGCCAAAAATCTGAACGAAAGTCTTATCGATCTGCAAGAATTGGGAAA
[0362] ATATGAGCAGGGCAGCGGCTATATCCCAGAGGCCCCCCGCGACGGCCAGGCCTACGTACGCAAGGAT
[0363] GGCGAGTGGGTGCTGCTGAGCACCTTCCTGTGA
[0364] SEQ ID NO:2 - Lentiviral vector construct (pLV-hPGK-WPRE) encoding the light chain of ipilimumab
[0365] AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTA
[0366]
[0367]
[0368]
[0369] CCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGA
[0370] GCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGT
[0371] CGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTAC
[0372] GGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGA
[0373] TAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAG
[0374] TCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTC
[0375] ATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGT
[0376] GAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
[0377] ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTA
[0378] ACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT
[0379] SEQ ID NO: 3—Lentiviral vector construct encoding the heavy chain of Ipilimumab (pLV-hPGK-ipi-HC-WPRE)
[0380]
[0381]
[0382]
[0383]
[0384] GAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCT
[0385] CCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGT
[0386] GAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTC
[0387] CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGA
[0388] TTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT
[0389] SEQ ID NO:4—Lentiviral vector construct encoding the heavy chain of gantenerumab (pLV-hPGK-Gant HC-WPRE)
[0390]
[0391]
[0392]
[0393]
[0394] CTGGAGCTGCAAGCTT
[0395] SEQ ID NO:5—Lentiviral vector construct encoding the light chain of gantenerumab (pLV-hPGK-Gant LC-WPRE)
[0396]
[0397]
[0398]
[0399] TCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAA
[0400] CGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTT
[0401] TTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCC
[0402] GGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACT
[0403] GTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCG
[0404] CTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTC
[0405] AAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGC
[0406] TTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTC
[0407] CCGAAGAGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGA
[0408] GCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGT
[0409] CGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTAC
[0410] GGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGA
[0411] TAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAG
[0412] TCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTC
[0413] ATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGT
[0414] GAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
[0415] ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTA
[0416] ACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT
[0417] SEQ ID NO:6 - Lentiviral vector construct encoding the light chain of rituximab (pLV-hPGK-ritux-LC-WPRE)
[0418] AATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATT
[0419]
[0420]
[0421]
[0422] GCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTG
[0423] AGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTC
[0424] ACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT
[0425] SEQ ID NO:7—Lentiviral vector construct encoding the heavy chain of rituximab (pLV-hPGK-ritux-HC-WPRE)
[0426]
[0427]
[0428]
[0429] Sequence Listing <110> MysImmune Geneva University Hospital University of Geneva <120> Immortalized myoblast cell lines and uses thereof <130> P2022-0140 <150> EP19191867.1 <151> 2019-08-14 <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 3714 <212> DNA <213> Artificial sequence <220> <223> DNA sequence for expression of spike protein from immortalized myoblasts <400> 1 atgttcgttt tccttgttct gttgcctctc gttagtagcc aatgtgtcaa ccttactact 60 agaacccagc tccctccagc atataccaac agcttcaccc ggggcgtata ttatccggac 120 aaagtgtttc gctcaagtgt gctgcattct acgcaggacc tttttttgcc cttttttagt 180 aatgttaactt ggtttcatgc tatccatgtg tctggaacta acggaaccaa acggtttgac 240 aaccccgtcc tccctttcaa cgatggcgtg tatttcgcct ccacggaaaa gtcgaacatc 300 attcgcggct ggatctttgg tacaacactc gactcaaaga cgcagagcct gctaatcgtc 360 aataacgcta caaatgttgt gatcaaggtg tgtgaatttc agttctgcaa tgatcccttc 420 ctgggggtgt actaccataa aaataacaag agctggatgg agtccgaatt tagggtttac 480 agttccgcta acaactgcac attcgagtac gtaagccagc catttcttat ggatcttgag 540 ggcaagcaag gaaacttcaa gaatttaagg gagttcgtgt tcaaaaatat cgatggctat 600 tttaaaatat atagcaagca cactccaata aacttagtgc gagacctgcc ccagggattt 660 tcggctctag agcccctggt ggatctgcca attggaataa acataacccg ctttcaaaca 720 ctgctagccc tgcatagaag ttacctcacc cctggtgata gtagttccgg atggacagca 780 ggggccgccg catactatgt cggctacctg cagcctagga ccttcttact gaagtataac 840 gagaacggta caataaccga cgctgtggac tgcgctctgg accctctgtc cgagacgaag 900 tgtaccctaa agagctttac cgttgaaaaa ggcatttatc aaaccagcaa tttccgggtc 960 cagccaaccg agagcatcgt cagatttccc aacattacaa atctgtgtcc cttcggcgag 1020 gtgtttaacg ccacacgttt cgcctcagtg tacgcatgga accgtaaacg aatatctaac 1080 tgtgtcgcgg attattctgt cctctacaac tccgcctctt tctccacctt caagtgctac 1140 ggggtgtcac cgactaagct gaacgatctc tgctttacca acgtctacgc ggactccttc 1200 gtgatcagag gggatgaggt gagacaaatc gccccaggtc agactgggaa aatcgcagat 1260 tacaactaca aattgcctga tgatttcact gggtgcgtca tcgcgtggaa ctctaataac 1320 ctcgattcta aggtcgggg gaactacaat tatctgtacc gcctatttag gaagtcaaac 1380 ctgaaacctt tcgagcggga tatttcaacc gaaatctatc aagcggggtc aacaccttgt 1440 aatggtgtgg aggattttaa ctgctacttc cccctgcagt cttacggatt tcagccaacc 1500 aatggcgtgg gttaccaacc ttatcgggtg gtggttctaa gtttcgaact gttgcacgct 1560 cccgccacgg tatgcgggcc aaaaaagagc actaacttgg tgaagaataa gtgcgtgaat 1620 ttcaatttca atggcctcac tggaaccgga gtactgaccg aatccaataa gaagttcttg 1680 ccctttcagc agttcggaag agacattgcc gacacaaccg acgcggtgcg ggatcctcag 1740 actctggaga tattagacat tacaccatgt agctttggcg gggtgtctgt cattactccg 1800 ggcacgaata ctagcaatca ggtagccgtg ctgtaccaag acgtgaattg cacagaggtt 1860 cccgtcgcaa ttcacgctga ccagctgacc cccacgtgga gggtttacag cactggcagt 1920 aatgtcttcc agacgagagc cggttgtttg atcggagcgg aacatgtgaa taactcctac 1980 gagtgcgaca tcccatcgg agccggtata tgcgccctt atcagacaca actattca 2040 cccggctccg cctccagtgt agctctcaa agcattatag catatacaat gtctcttggg 2100 gccgaaaatt ccgtggccta ttcgaacaat tcaatcgcca tcccaccaa ctttacaatc 2160 agcgtgacga ccgaaattct gcctgtgagc atgacgaaaa ccagcgtaga ctgcactatg 2220 tatatctgtg gggactccac tgagtgctcc aaccttctcc tgcagtacgg gagcttctgt 2280 accattaa accgtgccct tacaggcatc gctgttgagc aggataagaa tacccaggaa 2340 gtttttgccc aggttaagca gatatacaa acaccgccaa ttaagactt cggaggcttc 2400 aacttctctc agatactgcc tgacctcc aagccatca aacggagctt cattgaggac 2460 ctcttgttca acaaagtgac tctggctgat gctggcttca ttaagcagta cggagattgc 2520 ctgggggata ttgctgccag ggatctcatc tgtgcccaga agtttaatgg cctgacagtc 2580 ttgcctccac ttctgacaga cgagatgatt gcacagtaca caagtgccct cctcgctggc 2640 accataacat ccggatggac atttggtgca ggtgctgccc tccagattcc ctttgcaatg 2700 cagatggcgt atcgctttaa cggcatcggt gtcacacaaa acgtgttgta tgagaaccaa 2760 aagctcatcg ctaaccagtt taattctgct attgggaaaa ttcaggacag cctgtcatcg 2820 accgcgtctg cccttgggaa gttgcaggac gtggtgaatc agaatgctca ggccttaaat 2880 actctggtga aaactctc ttcaaatttc ggcgcaatca gctctgtgtt aaacgacatc 2940 ctaagtaggc ttgatccgcc ggaggctgaa gttcaaattg atagattgat tactggcagg 3000 ctccagtctt tacagaccta cgttacacag cagctgatcc gagcggctga gattagagct 3060 tccgccaatc tggccgcaac caagatgtcc gaatgtgtcc tgggtcagtc aaagcgggtc 3120 gactttgtg gtaaaggcta ccacctcatg tcatttcccc agagtgcacc tcacggagta 3180 gtgttcctcc acgtcaccta cgttccagca caggaaaaga attttaccac tgcaccggca 3240 atctgtcacg acggcaaggc acacttcccc cgagagggcg tattcgtgtc gaatggaact 3300 cattggttcg tcacacagcg aaacttttat gagcctcaga tcattaccac cgataataca 3360 tttgtgtccg ggaactgcga cgttgtcatt ggaatcgtca acaacactgt atacgatcca 3420 cttcagccag aactggatag ctttaaggaa gaattggaca aatatttcaa aaatcacact 3480 tcacccgatg tggacctggg ggacattagt gggatcaatg catccgtggt caatatccaa 3540 aaagagattg acaggctcaa cgaggtggcc aaaaatctga acgaaagtct tatcgatctg 3600 caagaattgg gaaaatatga gcagggcagc ggctatatcc cagaggcccc ccgcgacggc 3660 caggcctacg tacgcaagga tggcgagtgg gtgctgctga gcaccttcct gtga 3714 <210> 2 <211> 7405 <212> DNA <213> Artificial sequence <220> <223> Lentiviral vector construct encoding the light chain of ipilimumab (pLV-hPGK-WPRE) <400> 2 60. aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 420. taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcggggggaga attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataatta aaacatatag tatgggcaag caggggagcta gaacgattcg cagttaatcc tggcctgtta gaaacatcag aaggctgtag aaaatactg ggacagctac aaccatccct tcagacagga 780 tcagagaac ttagatcatt atataca gtagcaaccc tctattgtgt gcatcaagg 840 frequently frequently frequently aaaaaagt 900 agaccaccg cacagcaagc ggccgctgat cttcagacct ggaggagg atatgaggga 960 attgaatt taggtagc 1020 acccaccaag gcaagagaa gagtggtgca gagaaaaa agagcagtgg gataggagc 1080 ttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcacagc atctgttgca accacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg atgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacag aattacaa 1440 ttacacaagc ttatacact ccttaattga agaatcgcaaaccagcaag aaagaatga 1500 acaagaatta ttggattag aataatgggc aagtttgtgg aattggtttta acatacaaa 1560 ttggctgtgg tatataaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agttttgct gtactttcta tagtgaatag agttaggcag ggattattcac cattatcgtt 1680 1740 1740 1740 tggagagaga gagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gctttaaaa gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata 1860 atagcaacag acaacac windows aaaaaaaaaaaat tcaaattttt 1920 actagtgatt atcggatcaa ctttgtatag aaagttggg gttgcgcctt ttccaggca 1980 gccctgggtt tgcgcaggga cgcggctgct ctggcgtgg ttccgggaa cgcagcggcg 2040 ccgaccctgg gtctcgcaca ttctcacgt ccgttcgcag cgtcacccgg atctcgccg 2100 ctacccttgt gggccccccg gcgacgctc ctgctccgcc cctaagtcgg gaagttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatgaaat acctattgcc tacggcagcc 2520 gctggattgt tattactcgc ggcccagccg gccatggccg agatcgtgct gacccagagc 2580 cccggcaccc tgagcctgag ccccggcgag agagccaccc tgagctgcag agccagccag 2640 agcgtgggca gcagctacct ggcctggtac cagcagaagc ccggccaggc ccccagactg 2700 ctgatctacg gcgccttcag cagagccacc ggcatccccg acagattcag cggcagcggc 2760 agcggcaccg acttcaccct gaccatcagc agactggagc ccgaggactt cgccgtgtac 2820 tactgccagc agtacggcag cagcccctgg accttcggcc agggcaccaa ggtggagatc 2880 aagagaaccg tggccgcccc cagcgtgttc atcttccccc ccagcgacga gcagctgaag 2940 agcggcaccg ccagcgtggt gtgcctgctg aacaacttct accccagaga ggccaaggtg 3000 cagtggaagg tggacaacgc cctgcagagc ggcaacagcc aggagagcgt gaccgagcag 3060 gacagcaagg acagcaccta cagcctgagc agcaccctga ccctgagcaa ggccgactac 3120 gagaagcaca aggtgtacgc ctgcgaggtg acccaccagg gcctgagcag ccccgtgacc 3180 aagagcttca acagaggcga gtgctgaacc cagctttctt gtacaaagtg gtgataatcg 3240 aattccgata atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac 3300 tatgttgctc cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt 3360 gcttcccgta tggctttcat tttctcctcc ttgtataaat cctggttgct gtctctttat 3420 gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca 3480 acccccactg gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc 3540 cccctcccta ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg 3600 gctcggctgt tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt ctgcggcggga cgtccttctg ctacgtccct 3720 tcggccctca atccagcgga ccttccttcc cgcggcctgc tgccggctct gcggcctctt 3780 ccgcgtcttc gccttcgccc tcagacgagt cggatctccc tttgggccgc ctccccgcat 3840 cgggaattcc cgcggttcgc tttaagacca atgacttaca aggcagctgt agatcttagc cactttttaa aagaaaaggg gggactggaa gggctaattc actcccaacg aagacaagat ctgctttttg cttgtactgg gtctctctgg ttagaccaga tctgagcctg ggagctctct ggctaactag ggacccact gcttaagcct caataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt aactagagat ccctcagacc cttttagtca 4140 gtgtggaaaa tctctagcag tagtagttca tgtcatctta ttattcagta tttataactt gcaaagaaat gaatcaga gagtgagagg aacttgttta ttgcagctta taatggttac aaataagca atagcatcac aaatttcaca aataagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggctctagct atcccgcccc 4380. 4440. taactccgcc catccccgcc ctaactccgc ccagttccgc ccccatggct gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga 4500. aggctgagg aggctttttt ggaggcctag ggacgtaccc aattcgccct aggctgagtc 4560 gtattacgcg cgctcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat gggacgcgcc 4740 ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact 4800 tgccagcgcc ctagcgcccg ctccttttcgc tttcttccct tccttctcg cccgttcgc 4860 cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg ggccatcgcc 4980. ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt 5040. gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt tataagggat 5100 tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taaaaaaat ttaacgcgaa 5160 ttttaacaaa atattaacgc ttacaattta ggtggcactt ttcgggggaaa tgtgcgcgga 5220 acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa 5280 5340 gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg 5400 ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg 5460 gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg 5520 agcactttta aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag 5580 caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca 5640 gaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg 5700 agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc 5760 gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg 5820 aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg 5880 ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac 5940 tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg 6000 tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg 6060 gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact 6120 atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa 6180 ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 6240 aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 6300 ttttcgttcc actgagcgtc agaccccgta gaaaagatca aggatcttc ttgagatcct 6360 ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 6420 tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 6480 cagataccaa atactgttct tctagtgtag ccgtagttag gccaccactt caagaactct 6540 gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 6600 gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 6660 tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 6720 ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaaga gagaaagcg 6780 gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 6840 ggaaacgcct ggtatcttta tagtcctgtc gggttcgcc acctctgact tgagcgtcga 6900 ttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggcctttt 6960 ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct 7020 gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga 7080 acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcccaat acgcaaaccg 7140 cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg 7200 aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag 7260 gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt 7320 cacacaggaa acagctatga ccatgattac gccaagcgcg caattaaccc tcactaaagg 7380 gaacaaaagc tggagctgca agctt 7405 <210> 3 <211> 8095 <212> DNA <213> Artificial sequence <220> <223> Lentiviral vector construct encoding the heavy chain of ipilimumab (pLV-hPGK-ipi-HC-WPRE) <400> 3 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga 120 tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac cctttagtc agtgtggaa atcttagca gtggccccg 420 aacagggact tgaagcgaa agggaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag agggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaaatcggtta aggccagggg gaagaaaaaataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag aaaatactg ggacagctac aaccatccct tcagacagga 780 tcagagaac ttagatcatt atataca gtagcaaccc tctattgtgt gcatcaagg 840 frequently frequently frequently aaaaaagt 900 agaccaccg cacagcaagc ggccgctgat cttcagacct ggaggagg atatgaggga 960 attgaatt taggtagc 1020 acccaccaag gcaagagaa gagtggtgca gagaaaaa agagcagtgg gataggagc 1080 ttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaca atttgctgag 1200 ggctattgag gcgcacagc atctgttgca accacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaaccattt gcaccactgc tgtgccttgg atgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacag aattacaa 1440 ttacacaagc ttatacact ccttaattga agaatcgcaaaccagcaag aaagaatga 1500 acaagaatta ttggattag aataatgggc aagtttgtgg aattggtttta acatacaaa 1560 ttggctgtgg tatataaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agttttgct gtactttcta tagtgaatag agttaggcag ggattattcac cattatcgtt 1680 1740 1740 1740 tggagagaga gagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgcag gggaagaat agtagcata 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca gccctgggtt tgcgcaggga cgcggctgct ctggggcgtgg ttccgggaaa cgcagcggcg ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatggagt ttgggctgag ctgggttttc 2520 ctcgttgctc tttttagagg tgtccagtgt caggtgcagc tggtggagag cggcggcggc 2580 gtggtgcagc ccggcagaag cctgagactg agctgcgccg ccagcggctt caccttcagc 2640 agctacacca tgcactgggt gagacaggcc cccggcaagg gcctggagtg ggtgaccttc 2700 atcagctacg acggcaacaa caagtactac gccgacagcg tgaagggcag attcaccatc 2760 agcagagaca acagcaagaa caccctgtac ctgcagatga acagcctgag agccgaggac 2820 accgccatct actactgcgc cagaaccggc tggctgggcc ccttcgacta ctggggccag 2880 ggcaccctgg tgaccgtgag cagcgccagc accaagggcc ccagcgtgtt ccccctggcc 2940 cccagcagca agagcaccag cggcggcacc gccgccctgg gctgcctggt gaaggactac 3000 ttccccgagc ccgtgaccgt gagctggaac agcggcgccc tgaccagcgg cgtgcacacc 3060 ttccccgccg tgctgcagag cagcggcctg tacagcctga gcagcgtggt gaccgtgccc 3120 agcagcagcc tgggcaccca gacctacatc tgcaacgtga accacaagcc cagcaacacc 3180 aaggtggaca agagagtgga gcccaagagc tgcgacaaga cccacacctg ccccccctgc 3240 cccgccccccg agctgctggg cggccccagc gtgttcctgt tccccccccaa gcccaaggac 3300 accctgatga tcagcagaac ccccgaggtg acctgcgtgg tggtggacgt gagccacgag 3360 gaccccgagg tgaagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 3420 aagcccagag aggagcaga aacagcacc tacagagtgg tgagcgtgct gaccgtgctg 3480 caccaggact ggctgaacgg caaggagtac aagtgcaagg tgagcaacaa ggccctgccc 3540 gcccccatcg agaagaccat cagcaaggcc aagggccagc ccagagagcc ccaggtgtac 3600 accctgcccc ccagcagaga cgagctgacc aagaaccagg tgagcctgac ctgcctggtg 3660 aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 3720 aactacaaga ccaccccccc cgtgctggac agcgacggca gcttcttcct gtacagcaag 3780 ctgaccgtgg acaagagcag atggcagcag ggcaacgtgt tcagctgcag cgtgatgcac 3840 gaggccctgc acaaccacta cacccagaag agcctgagcc tgagccccgg caagtgaacc 3900 cagctttctt gtacaaagtg gtgataatcg aattccgata atcaacctct ggattacaaa 3960 atttgtgaaa gattgactgg tattcttaac tatgttgctc cttttacgct atgtggatac 4020 gctgctttaa tgcctttgta tcatgctatt gcttcccgta tggctttcat tttctcctcc 4080 ttgtataaat cctggttgct gtctctttat gaggagttgt ggcccgttgt caggcaacgt 4140 ggcgtggtgt gcactgtgtt tgctgacgca accccccactg gttggggcat tgccaccacc 4200 tgtcagctcc tttccgggac tttcgctttc cccctcccta ttgccacggc ggaactcatc 4260 gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt tgggcactga caattccgtg 4320 gtgttgtcgg ggaagctgac gtcctttcca tggctgctcg cctgtgttgc cacctggatt 4380 ctgcgcggga cgtccttctg ctacgtccct tcggccctca atccagcgga ccttcttcc 4440 cgcggcctgc tgccggctct gcggcctctt ccgcgtcttc gccttcgccc tcagacgagt 4500 cggatctccc tttgggccgc ctccccgcat cgggaattcc cgcggttcgc tttaagacca 4560 atgacttaca aggcagctgt agatcttagc cactttttaa aagaaaaggg gggactggaa 4620 gggctaattc actcccaacg aagacaagat ctgctttttg cttgtactgg gtctctctgg 4680 ttagaccaga tctgagcctg ggagctctct ggctaactag ggacccact gcttaagcct caataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt 4800 aactagagat ccctcagacc cttttagtca gtgtggaaaa tctctagcag tagtagttca tgtcatctta ttattcagta tttataactt gcaaagaaat gaatcaga gagtgagagg aacttgttta ttgcagctta taatggttac aaataagca atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggctctagct atcccgcccc taactccgcc catcccgccc ctaactccgc 5100 ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg 5160 aggccgcctc ggcctctgag ctattccaga agtagtgagg aggctttttt ggaggcctag 5220 ggacgtaccc aattcgccct atagtgagtc gtattacgcg cgctcactgg ccgtcgtttt 5280 acaacgtcgt gactgggaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta ggcccgcacc gatcgccctt cccaacagtt 5400. gcgcagcctg aatggcgaat gggacgcgcc ctgtagcggc gcattaagcg cggcgggtgt 5460 ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc 5520 tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg 5580 gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta 5640 gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt 5700 ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat 5760 ctcggtctat tcttttgatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa 5820 tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgc ttacaattta 5880 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat 5940 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa 6000 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 6060 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 6120 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 6180 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg 6240 gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag 6300 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta 6360 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttactcttctg 6420 aaacgatcg gaggaccgaa ggagctaacc gcttttttgc aacacatggg ggatcatgta 6480 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac 6540 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt 6600 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca 6660 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag 6720 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta 6780 gttatctaca cgacggggag tcaggcaact atggatgaac gaatagaca gatcgctgag 6840 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt 6900 tagattgatt taaaacttca ttttaattt aaaaggatct aggtgaagat cctttttgat 6960 aatctcatga ccaaaatccc ttaacgtgag tttcgttcc actgagcgtc agaccccgta 7020 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 7080 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 7140 tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag 7200 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 7260 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 7320 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 7380 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 7440 agcgccacgc ttcccgaaga gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 7500 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 7560 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 7620 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 7680 gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt 7740 gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag 7800 gaagcggaag agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa 7860 tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat 7920 gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg 7980 ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac 8040 gccaagcgcg caattaaccc tcactaaagg gaacaaaagc tggagctgca agctt 8095 <210> 4 <211> 8119 <212> DNA <213> Artificial sequence <220> <223> Lentiviral vector construct encoding gantuzumab heavy chain (pLV-hPGK-Gant HC-WPRE) <400> 4 60. aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 420. taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcggggggaga attagatcgc gatgggaaaa aattcggtta aggccagggg gaaagaaaaa atataatta aaacatatag tatgggcaag caggggagcta gaacgattcg cagttaatcc tggcctgtta gaaacatcag aaggctgtag aaaatactg ggacagctac aaccatccct tcagacagga 780 tcagagaac ttagatcatt atataca gtagcaaccc tctattgtgt gcatcaagg 840 frequently frequently frequently aaaaaagt 900 agaccaccg cacagcaagc ggccgctgat cttcagacct ggaggagg atatgaggga 960 attgaatt taggtagc 1020 acccaccaag gcaagagaa gagtggtgca gagaaaaa agagcagtgg gataggagc 1080 ttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcacagc atctgttgca accacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg atgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacag aattacaa 1440 ttacacaagc ttatacact ccttaattga agaatcgcaaaccagcaag aaagaatga 1500 acaagaatta ttggattag aataatgggc aagtttgtgg aattggtttta acatacaaa 1560 ttggctgtgg tatataaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agttttgct gtactttcta tagtgaatag agttaggcag ggattattcac cattatcgtt 1680 1740 1740 1740 tggagagaga gagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gctttaaaa gaaaaggggg gattgggggg tacagtgcag gggaaagaat agtagacata 1860 atagcaacag acaacac windows aaaaaaaaaaaat tcaaattttt 1920 actagtgatt atcggatcaa ctttgtatag aaagttggg gttgcgcctt ttccaggca 1980 gccctgggtt tgcgcaggga cgcggctgct ctggcgtgg ttccgggaa cgcagcggcg 2040 ccgaccctgg gtctcgcaca ttctcacgt ccgttcgcag cgtcacccgg atctcgccg 2100 ctacccttgt gggccccccg gcgacgctc ctgctccgcc cctaagtcgg gaagttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 2280 gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatggagt ttgggctgag ctgggttttc 2520 ctcgttgctc tttttagagg tgtccagtgt caggtggagc tggtggagag cggcggcggc 2580 ctggtgcagc ccggcggcag cctgagactg agctgcgccg ccagcggctt caccttcagc 2640 agctacgcca tgagctgggt gagacaggcc cccggcaagg gcctggagtg ggtgagcgcc 2700 atcaacgcca gcggcaccag aacctactac gccgacagcg tgaagggcag attcaccatc 2760 agcagagaca acagcaagaa caccctgtac ctgcagatga acagcctgag agccgaggac 2820 accgccgtgt actactgcgc cagaggcaag ggcaacaccc acaagcccta cggctacgtg 2880 agatacttcg acgtgtgggg ccagggcacc ctggtgaccg tgagcagcgc cagcaccaag 2940 ggccccagcg tgttccccct ggcccccagc agcaagagca ccagcggcgg caccgccgcc 3000 ctgggctgcc tggtgaagga ctacttcccc gagcccgtga ccgtgagctg gaacagcggc 3060 gccctgacca gcggcgtgca caccttcccc gccgtgctgc agagcagcgg cctgtacagc 3120 ctgagcagcg tggtgaccgt gcccagcagc agcctgggca cccagaccta catctgcaac 3180 gtgaaccaca agcccagcaa caccaaggtg gacaagagag tggagcccaa gagctgcgac 3240 aagacccaca cctgcccccc ctgccccgcc cccgagctgc tgggcggccc cagcgtgttc 3300 ctgttccccc ccaagcccaa ggacaccctg atgatcagca gaacccccga ggtgacctgc 3360 gtggtggtgg acgtgagcca cgaggacccc gaggtgaagt tcaactggta cgtggacggc 3420 gtggaggtgc acaacgccaa gaccaagccc agagaggagc agtacaacag cacctacaga 3480 gtggtgagcg tgctgaccgt gctgcaccag gactggctga acggcaagga gtacaagtgc 3540 aaggtgagca acaaggccct gcccgccccc atcgagaaga ccatcagcaa ggccaagggc 3600 cagcccagag agccccaggt gtacaccctg ccccccagca gagacgagct gaccaagaac 3660 caggtgagcc tgacctgcct ggtgaagggc ttctacccca gcgacatcgc cgtggagtgg 3720 gagagcaacg gccagcccga gaacaactac aagaccaccc cccccgtgct ggacagcgac 3780 ggcagcttct tcctgtacag caagctgacc gtggacaaga gcagatggca gcagggcaac 3840 gtgttcagct gcagcgtgat gcacgaggcc ctgcacaacc actacaccca gaagagcctg 3900 agcctgagcc ccggcaagtg aacccagctt tcttgtacaa agtggtgata atcgaattcc 3960 gataatcaac ctctggatta caaaatttgt gaaagattga ctggtattct taactatgtt 4020 gctcctttta cgctatgtgg atacgctgct ttaatgcctt tgtatcatgc tattgcttcc 4080 cgtatggctt tcattttctc ctccttgtat aaatcctggt tgctgtctct ttatgaggag 4140 ttgtggcccg ttgtcaggca acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc 4200 actggttggg gcattgccac cacctgtcag ctcctttccg ggactttcgc tttccccctc 4260 cctattgcca cggcggaact catcgccgcc tgccttgccc gctgctggac aggggctcgg 4320 ctgttgggca ctgacaattc cgtggtgttg tcggggaagc tgacgtcctt tccatggctg 4380 ctcgcctgtg ttgccacctg gattctgcgc gggacgtcct tctgctacgt cccttcggcc 4440 ctcaatccag cggaccttcc ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcgt 4500 cttcgccttc gccctcagac gagtcggatc tccctttggg ccgcctcccc gcatcgggaa 4560 ttcccgcggt tcgctttaag accaatgact tacaaggcag ctgtagatct tagccacttt 4620 ttaaaagaaa aggggggact ggaagggcta attcactccc aacgaagaca agatctgctt 4680 tttgcttgta ctgggtctct ctggttagac cagatctgag cctgggagct ctctggctaa 4740 ctagggaacc cactgcttaa gcctcaataa agcttgcctt gagtgcttca agtagtgtgt 4800 gcccgtctgt tgtgtgactc tggtaactag agatccctca gaccctttta gtcagtgtgg 4860 aaaatctcta gcagtagtag ttcatgtcat cttattattc agtatttata acttgcaaag 4920 aaatgaatat cagagagtga gaggaacttg tttattgcag cttataatgg ttacaaataa 4980 agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt 5040 ttgtccaaac tcatcaatgt atcttatcat gtctggctct agctatcccg cccctaactc 5100 cgcccatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa 5160 ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt 5220 gaggaggctt ttttggaggc ctagggacgt acccaattcg ccctatagtg agtcgtatta 5280 cgcgcgctca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca 5340 acttaatcgc cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg 5400 caccgatcgc ccttcccaac agttgcgcag cctgaatggc gaatgggacg cgccctgtag 5460 cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag 5520 cgccctagcg cccgctcctt tcgctttctt cccttcctt ctcgccacgt tcgccggctt 5580 tccccgtcaa gctctaaatc ggggggctccc tttagggttc cgatttagtg ctttacggca 5640 cctcgacccc aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata 5700 gacggtttt cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca 5760 aactggaaca acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc 5820 gatttcggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa 5880 caaaatatta acgcttacaa tttaggtggc acttttcggg gaaatgtgcg cggaacccct 5940 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 6000 taaatgcttc aataatattg aaaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 6060 cttatccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 6120 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 6180 6240 tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 6300 ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 6360 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 6420 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 6480 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 6540 gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 6600 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 6660 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 6720 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 6780 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 6840 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 6900 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 6960 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 7020 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 7080 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 7140 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 7200 ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 7260 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 7320 tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 7380 tgaacgggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 7440 tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagagagaaa ggcggacagg 7500 tatccggtaa gcggcaggt cggaacagga gagcgcacga gggagcttcc agggggaaac 7560 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 7620 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 7680 ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 7740 gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 7800 gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc 7860 cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg 7920 ggcagtgagc gcaacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta 7980 cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca 8040 ggaaacagct atgaccatga ttacgccaag cgcgcaatta accctcacta aagggaacaa 8100 aagctggagc tgcaagctt 8119 <210> 5 <211> 7405 <212> DNA <213> Artificial sequence <220> <223> Lentiviral vector construct encoding the gantuzumab light chain (pLV-hPGK-Gant LC-WPRE) <400> 5 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga 120 tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac cctttagtc agtgtggaa atcttagca gtggccccg 420 aacagggact tgaagcgaa agggaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag agggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaaaatcggtta aggccagggg gaagaaaaaataaatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag aaaatactg ggacagctac aaccatccct tcagacagga 780 tcagagaac ttagatcatt atataca gtagcaaccc tctattgtgt gcatcaagg 840 frequently frequently frequently aaaaaagt 900 agaccaccg cacagcaagc ggccgctgat cttcagacct ggaggagg atatgaggga 960 attgaatt taggtagc 1020 acccaccaag gcaagagaa gagtggtgca gagaaaaa agagcagtgg gataggagc 1080 ttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcacagc atctgttgca accacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg atgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacag aattacaa 1440 ttacacaagc ttatacact ccttaattga agaatcgcaaaccagcaag aaagaatga 1500 acaagaatta ttggattag aataatgggc aagtttgtgg aattggtttta acatacaaa 1560 ttggctgtgg tatataaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agttttgct gtactttcta tagtgaatag agttaggcag ggattattcac cattatcgtt 1680 1740 1740 1740 tggagagaga gagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgcag gggaagaat agtagcata 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca gccctgggtt tgcgcaggga cgcggctgct ctggggcgtgg ttccgggaaa cgcagcggcg ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatgaat acctattgcc tacggcagcc gctggattgt tattactcgc ggcccagccg gccatggccg acatcgtgct gacccagagc 2580 cccgccaccc tgagcctgag ccccggcgag agagccaccc tgagctgcag agccagccag 2640 agcgtgagca gcagctacct ggcctggtac cagcagagc ccggccaggc ccccagactg ctgatctacg gcgccagcag cagagccacc ggcgtgcccg ccagattcag cggcagcggc 2760 agcggcaccg acttcaccct gaccatcagc agcctggagc ccgaggactt cgccacctac tactgcctgc agatctaca catgcccatc accttcggcc agggcacca ggtggagatc aagagaaccg tggccgcccc cagcgtgttc atcttccccc ccagcgacga gcagctgaag agcggcaccg ccagcgtggt gtgcctgctg aacaacttct accccagaga ggccaaggtg cagtggaagg tggacaacgc cctgcagagc ggcaacagcc aggagagcgt gaccgagcag 3060 gacagcaagg acagcaccta cagcctgagc agcaccctga ccctgagcaa ggccgactac 3180. gagaagcaca aggtgtacgc ctgcgaggtg acccaccagg gcctgagcag ccccgtgacc aagagcttca acagaggcga gtgctgaacc cagctttctt gtacaaagtg gtgataatcg aattccgata atcaacctct ggattacaaa atttgtgaaa gattgactgg tattcttaac 3300 tatgttgctc cttttacgct atgtggatac gctgctttaa tgcctttgta tcatgctatt 3360 gcttcccgta tggctttcat tttctctcc ttgtataaat cctggttgct gtctctttat 3420 gaggagttgt ggcccgttgt caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca 3480 accccactg gttggggcat tgccaccacc tgtcagctcc tttccgggac tttcgctttc 3540 cccctcccta ttgccacggc ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg 3600 gctcggctgt tgggcactga caattccgtg gtgttgtcgg ggaagctgac gtcctttcca 3660 tggctgctcg cctgtgttgc cacctggatt ctgcgcggga cgtccttctg ctacgtccct 3720 tcggccctca atccagcgga ccttcttcc cgcggcctgc tgccggctct gcggcctctt 3780 ccgcgtcttc gccttgccc tcagacgagt cggatctccc tttgggccgc ctccccgcat 3840 cgggaattcc cgcggttcgc tttaagacca atgacttaca aggcagctgt agatcttagc 3900 cactttttaa aagaaaaggg gggactggaa gggctaattc actcccaacg aagacaagat 3960 ctgctttttg cttgtactgg gtctctctgg ttagaccaga tctgagcctg ggagctctct ggctaactag ggacccact gcttaagcct caataagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt aactagagat ccctcagacc cttttagtca 4140 gtgtggaaaa tctctagcag tagtagttca tgtcatctta ttattcagta tttataactt gcaaagaaat gaatcaga gagtgagagg aacttgttta ttgcagctta taatggttac aaataagca atagcatcac aaatttcaca aataagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggctctagct atcccgcccc 4380. 4440. taactccgcc catccccgcc ctaactccgc ccagttccgc ccccatggct gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga 4500. aggctgagg aggctttttt ggaggcctag ggacgtaccc aattcgccct aggctgagtc 4560 gtattacgcg cgctcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat gggacgcgcc 4740 ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga ccgctacact 4800 tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg ccacgttcgc 4860 cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat ttagtgcttt 4920 acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg ggccatcgcc 4980 ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata gtggactctt 5040 gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt tataagggat 5100 tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa 5160 ttttaacaaa atattaacgc ttacaattta ggtggcactt ttcggggaaa tgtgcgcgga 5220 acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa 5280 ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt 5340 gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg 5400 ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg 5460 gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg 5520 agcactttta aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag 5580 caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca 5640 gaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg 5700 agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc 5760 gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg 5820 aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg 5880 ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac 5940 tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg 6000 tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg 6060 gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact 6120 atggatgaac gaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa 6180 ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 6240 aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 6300 tttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 6360 ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 6420 tgtttgccgg atcaagagct accaactctt ttccgaagg taactggctt cagcagagcg 6480 cagataccaa atactgttct tctagtgtag ccgtagttag gccaccactt caagaactct 6540 gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 6600 gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 6660 tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 6720 ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaaga gagaaagcg 6780 gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 6840 ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 6900 tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 6960 ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct 7020 gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga 7080 acgaccgagc gcagcgagtc agtgagcgag gaagcggaag agcgcccaat acgcaaaccg 7140 cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt tcccgactgg 7200 aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta ggcaccccag 7260 gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt 7320 cacacaggaa acagctatga ccatgattac gccaagcgcg caattaaccc tcactaaagg 7380 gaacaaaagc tggagctgca agctt 7405 <210> 6 <211> 7398 <212> DNA <213> Artificial sequence <220> <223> Lentiviral vector construct encoding the light chain of rituximab (pLV-hPGK-ritux-LC-WPRE) <400> 6 atgtagtctt atgcaatact cttgtagtct tgcaacatgg taacgatgag ttagcaacat 60 gccttacaag gagagaaaaa gcaccgtgca tgccgattgg tggagtag gtggtacgat 120 cgtgccttat taggaaggca acagacgggt ctgacatgga ttggacgaac cactgaattg 180 ccgcattgca gagatattgt atttaagtgc ctagctcgat acataacgg gtctctctgg 240 ttagaccaga tctgagcctg ggagctctct ggctaactag ggaacccact gcttaagcct 300 aataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt 360 aactagagat ccctcagacc cttttagtca gtgtggaaaa tctctagcag tggcgcccga 420 acagggactt gaaagcgaaa gggaaaccag aggagctctc tcgacgcagg actcggcttg 480 ctgaagcgcg cacggcaaga ggcgaggggc ggcgactggt gagtacgcca aaaattttga 540 600 ttagatcgcg atgggaaaaa attcggttaa ggccaggggg aaagaaaaa tataaattaa 660 aacatatagt atgggcaagc aggagctag aacgattcgc agttaatcct ggcctgttag 720 aaaacatcaga aggctgtaga caatactgg gandacctaca accatccctt cagacaggat 780 splitter taggaact tatatacag tagcaaccct ctattgtgtg catchaagga 840 window agaaaaaaaaagta 900 agaccaccgc acagcaagcg gccgctgatc ttcagacctg gaggaggaga tatgagggac 960 aattggagaa gtgaattata taaatataa gtagtaaaa ttgaaccatt aggagtagca 1020 cccaccaagg aagagag agtggtgcag aggaaaaaa gagcagtgggg ataggagct 1080 ttgttccttg gttcttggg agcagcagga agcactatgg gcgcagcgtc atgacgctg 1140 acggtacagg ccagacaatt attgtctggt atagtgcagc agcagaacaa ttgctgagg 1200 gctattgagg cgcacagca tctgttgcaa ctcacagtct ggggcatca gcagctccag 1260 gcaagaatcc tggctgtgga aagataccta aaggatcac agctcctggg gatttggggt 1320 tgctctggaa aactcatttg caccactgct gtgccttgga atgctagttg gagtaataa 1380 tctctggaac agatttga tcacacgacc tggatgt gggacagaga aattaacaat 1440 tacacaagct tatacactc cttaattgaa gaatcgcaaa accagcaaga aaagaatgaa 1500 caagaattat tggaattaga taaatgggca agtttgtgga attggtttaa cataacaaat 1560 tggctgtggt atataaaatt attcataatg atagtaggag gcttggtagg tttaagaata 1620 gttttgctg tactttctat agtgaataga gttaggcagg gatattcacc attatcgttt 1680 cagacccacc tcccaacccc gaggggaccc gacaggccg aaggaataga agaagaaggt 1740 ggagagagag acagagacag atccattcga ttagtgaacg gatctcgacg gtatcgctag 1800 cttttaaaag aaaagggggg attggggggt acagtgcagg ggaaagaata gtagacataa 1860 tagcaacaga catacaaact aaagaattac aaaaacaaat tacaaaaatt caaaatttta 1920 ctagtgatta tcggatcaac tttgtataga aaagttgggg ttgcgccttt tccaaggcag 1980 ccctgggttt gcgcagggac gcggctgctc tgggcgtggt tccgggaaac gcagcggcgc 2040 cgaccctggg tctcgcacat tcttcacgtc cgtcgcagc gtcacccgga tcttcgcgc 2100 tacccttgtg ggccccccgg cgacgcttc tgctccgccc ctaagtcggg aaggttcctt 2160 gcggttcgcg gcgtgccgga cgtgacaaac ggaagccgca cgtctcacta gtaccctcgc 2220 agacggacag cgccagggag caatggcagc gcgccgaccg cgatgggctg tggccaatag 2280 cggctgctca gcagggcgcg ccgagagcag cggccggggaa ggggcggtgc gggaggcggg 2340 gtgtggggcg gtagtgtggg ccctgttcct gcccgcgcgg tgttccgcat tctgcaagcc 2400 tccggagcgc acgtcggcag tcggctccct cgttgaccga atcaccgacc tctctcccca 2460 ggcaagtttg tacaaaaaag caggctgcca ccatgaaata cctattgcct acggcagccg 2520 ctggattgtt attactcgcg gcccagccgg ccatggccca gatcgtgctg agccagtctc 2580 ctgccatcct gagtgctagc cctggcgaga aagtgaccat gacctgtaga gccagcagca 2640 gcgtgtccta catccactgg ttccagcaga agcctggcag cagccctaag ccttggatct 2700 acgccacaag caatctggcc agcggcgtgc cagtcagatt ttctggctct ggcagcggca 2760 ccagctacag cctgacaatc tctagagtgg aagccgagga cgccgccacc tactattgtc 2820 agcagtggac cagcaatcct cctaccttg gcggaggcac caagctggaa atcaagagaa 2880 ccgtcgccgc tcctagcgtg ttcatcttcc caccttccga cgagcagctg aagtctggca 2940 cagcctctgt cgtgtgcctg ctgaacaact tctaccccag agaagccaag gtgcagtgga 3000 aggtggacaa cgccctgcag agcggcaata gccaagagag cgtgaccgag caggacagca 3060 aggactctac ctacagcctg agcagcaccc tgacactgag caaggccgac tacgagaagc 3120 acaaagtgta cgcctgcgaa gtgacccacc agggcctttc tagccctgtg accaagagct 3180 tcaaccgggg cgagtgttga acccagcttt cttgtacaaa gtggtgataa tcgaattccg 3240 ataatcaacc tctggattac aaaatttgtg aaagattgac tggtattctt aactatgttg 3300 ctccttttac gctatgtgga tacgctgctt taatgccttt gtatcatgct attgcttccc 3360 gtatggcttt cattttctcc tccttgtata aatcctggtt gctgtctctt tatgaggagt 3420 tgtggcccgt tgtcaggcaa cgtggcgtgg tgtgcactgt gtttgctgac gcaaccccca 3480 ctggttgggg cattgccacc acctgtcagc tcctttccgg gactttcgct ttccccctcc 3540 ctattgccac ggcggaactc atcgccgcct gccttgcccg ctgctggaca ggggctcggc 3600 tgttgggcac tgacaattcc gtggtgttgt cggggaagct gacgtccttt ccatggctgc 3660 tcgcctgtgt tgccacctgg attctgcgcg ggacgtcctt ctgctacgtc ccttcggccc 3720 tcaatccagc ggaccttcct tcccgcggcc tgctgccggc tctgcggcct cttccgcgtc 3780 ttcgccttcg ccctcagacg agtcggatct ccctttgggc cgcctccccg catcgggaat 3840 tcccgcggtt cgctttaaga ccaatgactt acaaggcagc tgtagatctt agccactttt 3900 taaaagaaaa ggggggactg gaagggctaa ttcactccca acgaagacaa gatctgcttt 3960 ttgcttgtac tgggtctctc tggttagacc agatctgagc ctgggagctc tctggctaac 4020 tagggaaccc actgcttaag cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg 4080 cccgtctgtt gtgtgactct ggtaactaga gatccctcag acccttttag tcagtgtgga 4140 aaatctctag cagtagtagt tcatgtcatc ttattattca gtatttataa cttgcaaaga 4200 aatgaatatc agagagtgag aggaacttgt ttattgcagc ttataatggt tacaaataaa 4260 gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt 4320 tgtccaaact catcaatgta tcttatcatg tctggctcta gctatcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat 4440 tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc tagggacgta cccaattcgc cctatagtga gtcgtattac 4560 gcgcgctcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtatagcga agaggcccgc 4680. accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgggacgc gccctgtagc 4740 ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc 4800 gccctagcgc ccgctcctttt cgctttctttc ccttccttc tcgccacgtt cgccggcttt 4860 ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag 4980. acggtttttc gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa 5040 actggaacaa cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg 5100 atttcggcct attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattttaac 5160 aaaatattaa cgcttacaat ttaggtggca cttttcgggg aaatgtgcgc ggaaccccta 5220 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat 5280 5340 ttatccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga 5400 aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca 5460 acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt 5520 ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa gagcaactcg 5580 gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc 5640 atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata 5700 acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttttt 5760 tgcacaacat ggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag 5820 ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca acgttgcgca 5880 aactattaac tggcgaacta cttactctag cttcccggca acaattaata gactggatgg 5940 aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg 6000 ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca ctggggccag 6060 atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg 6120 aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag 6180 accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 6240 tctaggtgaa gatcctttt gataatctca tgaccaaaat cccttaacgt gagttttcgt 6300 tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc 6360 tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc 6420 cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac 6480 caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac 6540 cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt 6600 cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct 6660 gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat 6720 acctacagcg tgagctatga gaaagcgcca cgcttcccga agagagaaag gcggacaggt 6780 atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg 6840 cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt 6900 gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt 6960 tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc cctgattctg 7020 tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg 7080 agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc 7140 ccgcgcgttg gccgattcat taatgcagct ggcacgacag gtttcccgac tggaaagcgg 7200 gcagtgagcg caacgcaatt aatgtgagtt agctcactca ttaggcaccc caggctttac 7260 actttatgct tccggctcgt atgttgtgtg gaattgtgag cggataacaa tttcacacag 7320 gaaacagcta tgaccatgat tacgccaagc gcgcaattaa ccctcactaa agggaacaaa 7380 agctggagct gcaagctt 7398 <210> 7 <211> 8104 <212> DNA <213> Artificial sequence <220> <223> Lentiviral vector construct encoding the heavy chain of rituximab (pLV-hPGK-ritux-HC-WPRE) <400> 7 aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 60 tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga 120 tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 180 gccgcattgc agagatattg tatttaagtg cctagctcga tacataaacg ggtctctctg 240 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 300 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 360 taactagaga tccctcagac cctttagtc agtgtggaa atcttagca gtggcgcccg 420 aacagggact tgaagcgaa agggaacca gaggagctct ctcgacgcag gactcggctt 480 gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 540 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 600 attagatcgc gatgggaaa aattcggtta aggccagggg gaagaaaaaataatta 660 aaacatatag tatgggcaag cagggagcta gaacgattcg cagttaatcc tggcctgtta 720 gaaacatcag aaggctgtag aaaatactg ggacagctac aaccatccct tcagacagga 780 tcagagaac ttagatcatt atataca gtagcaaccc tctattgtgt gcatcaagg 840 frequently frequently frequently aaaaaagt 900 agaccaccg cacagcaagc ggccgctgat cttcagacct ggaggagg atatgaggga 960 attgaatt taggtagc 1020 acccaccaag gcaagagaa gagtggtgca gagaaaaa agagcagtgg gataggagc 1080 ttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt caatgacgct 1140 gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag 1200 ggctattgag gcgcacagc atctgttgca accacagtc tggggcatca agcagctcca 1260 ggcaagaatc ctggctgtgg aagatacct aaaggatcaa cagctcctgg ggatttgggg 1320 ttgctctgga aaactcattt gcaccactgc tgtgccttgg atgctagtt ggagtaataa 1380 atctctggaa cagatttgga atcacacgac ctggatggag tgggacag aattacaa 1440 ttacacaagc ttatacact ccttaattga agaatcgcaaaccagcaag aaagaatga 1500 acaagaatta ttggattag aataatgggc aagtttgtgg aattggtttta acatacaaa 1560 ttggctgtgg tatataaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620 agttttgct gtactttcta tagtgaatag agttaggcag ggattattcac cattatcgtt 1680 1740 1740 1740 tggagagaga gagagaca gatccattcg attagtgaac ggatctcgac ggtatcgcta 1800 gcttttaaaa gaaaaggggg gattgggggg tacagtgcag gggaagaat agtagcata 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920. 1920 actagtgatt atcggatcaa ctttgtatag aaaagttggg gttgcgcctt ttccaaggca gccctgggtt tgcgcaggga cgcggctgct ctggggcgtgg ttccgggaaa cgcagcggcg ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 2160 tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 2220 cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 2340 ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 2400 ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 2460 aggcaagttt gtacaaaaaa gcaggctgcc accatggagt ttgggctgag ctgggttttc 2520 ctcgttgctc tttttagagg tgtccagtgt caggttcagc tgcagcagcc tggcgccgaa 2580 cttgtgaaac ctggcgcctc tgtgaagatg agctgcaagg ccagcggcta caccttcacc 2640 agctacaaca tgcactgggt caagcagacc cctggcagag gcctggaatg gatcggagcc 2700 atctatcccg gcaacggcga cacctcctac aaccagaagt tcaagggcaa agccacactg 2760 accgccgaca agagcagcag cacagcctac atgcagctgt ccagcctgac cagcgaagat 2820 agcgccgtgt actactgcgc cagaagcacc tattacggcg gcgactggta cttcaacgtg 2880 tggggagctg gcaccaccgt gacagtgtct gccgcctcta caaagggccc tagcgttttc 2940 ccactggctc ccagcagcaa gagcacatct ggtggaacag ccgctctggg ctgcctggtc 3000 aaggattact ttcccgagcc tgtgaccgtg tcctggaatt ctggcgctct gacaagcggc 3060 gtgcacacct ttccagcagt gctgcaaagc agcggcctgt actctctgag cagcgtggtc 3120 acagtgccta gctctagcct gggcacccag acctacatct gcaatgtgaa ccacaagcct 3180 agcaacacca aggtggacaa gaaggtggaa cccaagagct gcgacaagac ccacacctgt 3240 cctccatgtc ctgctccaga actgctcggc ggaccttccg tgttcctgtt tcctccaaag 3300 cctaaggaca ccctgatgat cagcagaacc cctgaagtga cctgcgtggt ggtggatgtg 3360 tcccacgagg atcccgaagt gaagttcaat tggtacgtgg acggcgtgga agtgcacaac 3420 gccaagacca agcctagaga ggaacagtac aacagcacct acagagtggt gtccgtgctg 3480 accgtgctgc accaggattg gctgaacggc aaagagtaca agtgcaaggt gtccaacaag 3540 gccctgcctg ctcctatcga gaaaaccatc agcaaggcca agggccagcc tagggaaccc 3600 caggtttaca cactgcctcc aagcagggac gagctgacca agaatcaggt gtccctgacc 3660 tgtctcgtga agggcttcta cccctccgat atcgccgtgg aatgggagag caatggccag 3720 cctgagaaca actacaagac aacccctcct gtgctggact ccgacggctc attcttcctg 3780 tacagcaagc tgacagtgga caagtccaga tggcagcagg gcaacgtgtt ctcctgcagc 3840 gtgatgcacg aggccctgca caaccactac acccagaaaa gcctgtctct gagccccggc 3900 aaatagaccc agctttcttg tacaaagtgg tgataatcga attccgataa tcaacctctg 3960 gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta 4020 tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt 4080 ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc 4140 aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt 4200 gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg 4260 gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac 4320 aattccgtgg tgttgtcggg gaagctgacg tcctttccat ggctgctcgc ctgtgttgcc 4380 acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac 4440 cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct 4500 cagacgagtc ggatctccct ttgggccgcc tccccgcatc gggaattccc gcggttcgct 4560 ttaagaccaa tgacttacaa ggcagctgta gatcttagcc actttttaaa agaaaagggg 4620 ggactggaag ggctaattca ctcccaacga agacaagatc tgctttttgc ttgtactggg 4680 tctctctggt tagaccagat ctgagcctgg gagctctctg gctaactagg gaacccactg cttaagcctc aataaagctt gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt 4800 gactctggta actagagatc cctcagaccc ttttagtcag tgtggaaaat ctctagcagt agtagttcat gtcatcttat tattcagtat ttataacttg caaagaaatg aatatcagag rich acttgtttat tgcagcttat aatggttaca aataagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatgtctg gctctagcta tcccgcccct aactccgccc atccccgcccc 5100. taactccgcc cagttccgcc cattctccgc cccatggctg actattttt tttatttatg cagaggccga ggccgcctcg gcctctgagc tattccaga gtagtgagga ggctttttg gaggcctagg gacgtaccca attcgcccta tagtgagtcg tattacgcgc gctcactggc 5280. cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg ggacgcgccc tgtagcggcg cattaagcgc 5460 ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc 5520 tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct 5580 aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa 5640 acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc 5700 tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact 5760 caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt cggcctattg 5820 gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa tattaacgct 5880 tacaatttag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc 5940 taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa 6000 tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt 6060 gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct 6120 gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc 6180 cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta 6240 tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac 6300 tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc 6360 atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac 6420 ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg 6480 gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac 6540 gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc 6600 gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt 6660 gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga 6720 gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc 6780 cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag 6840 atcgctgaga tagtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgttctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 7320 ttggactcaa gacgatagtt accggataag gcgcagcggt cggggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgac tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaagag agaaaggcgg acaggtatcc ggtaagcggc agggtcgga caggagagcg cacgaggggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 7620 gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 7680 tggccttttg ctcacatgtt ctttcctgcg ttcccctg attctgtgga taaccgtatt 7740 accgccttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 7800 gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg 7860 attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 7920 gcaattaatg tgagttagct cactcattag gcaccccagg cttacactt tatgcttccg 7980 gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 8040 catgattacg ccaagcgcgc aattaaccct cactaaaggg aaaaagct ggagctgcaa 8100 gctt 8104
Claims
1. An immortalized human myoblast cell line or progeny or composition thereof, wherein the immortalized human myoblast cell line is deposited with CCOS under accession number 1902.
2. A method for preparing genetically engineered immortalized human myoblasts that express a therapeutic protein under hypoxic conditions, wherein the method comprises the following steps: i) providing at least one immortalized human myoblast cell according to claim 1; ii) transducing the at least one immortalized human myoblast with a lentiviral vector for expressing a target protein under the control of a phosphoglycerate kinase (PGK) promoter; iii) culturing each of the separated cells obtained in step ii) in separate culture and expansion media; iv) selecting at least one cell line having the highest secretion level of the target protein among all of the separate culture and expansion cultures of step iii); v) controlling the myogenic potential of at least one of the selected cell lines.
3. The method of claim 2, wherein the phosphoglycerate kinase (PGK) promoter is a human PGK promoter. The method according to claim 2 , wherein the target protein is human GM-CSF. The method of claim 2 , wherein the target protein is a human monoclonal antibody. The method according to claim 2 , wherein the target protein is selected from rituximab, ipilimumab, and gantenerumab. The method of claim 2 , wherein the target protein is an antigen.
8. The method of claim 2, wherein the target protein is a viral antigen.
9. The method of claim 7, wherein the target protein is the COVID-19 spike protein or an antigenic fragment thereof.
10. A genetically engineered immortalized human myoblast cell line, wherein the immortalized human myoblast cell line according to claim 1 is genetically engineered to express at least one therapeutic protein or antigen, retain myoblast characteristics and is capable of secreting the therapeutic protein or antigen.
11. A genetically engineered immortalized human myoblast cell line that secretes GM-CSF and deposited with CCOS under Accession No. 1901, or progeny or composition thereof.
12. A genetically engineered immortalized human myoblast cell line, or progeny or composition thereof, wherein the genetically engineered immortalized human myoblast cell line is obtainable by the method according to claim 2 or 7.
13. Use of the genetically engineered immortalized human myoblasts according to any one of claims 10 to 12 in the preparation of a medicament for encapsulated cell therapy.
14. A pharmaceutical composition comprising at least one immortalized human myoblast according to any one of claims 1 or 10-12 and a pharmaceutically acceptable carrier, diluent or excipient thereof.
15. Use of the genetically engineered immortalized human myoblasts according to any one of claims 10 to 12 in the preparation of encapsulated cells for preventing and / or treating a disorder or disease, wherein the disorder or disease is cancer, an inflammatory disorder or an infectious disease.
16. The use according to claim 15, wherein the cancer is selected from non-Hodgkin's lymphoma, head and neck cancer, melanoma, lung cancer, bladder cancer, renal cell carcinoma, triple-negative breast cancer, colorectal cancer, gastric cancer, pancreatic cancer, ovarian cancer, prostate cancer, sarcoma and chordoma.
17. The use according to claim 15, wherein the encapsulated cells are used to prevent and / or treat viral infection.
18. The use according to claim 17, wherein the prevention is vaccination with a viral antigen.
19. The use according to claim 15, wherein the encapsulated cells are used to prevent and / or treat viral infection, wherein the virus is coronavirus 19 (COVID-19).
20. The use according to claim 15, wherein the disorder or disease is a neurodegenerative disorder.
21. An implantable biocompatible device or kit comprising at least one immortalized human myoblast according to claim 10 or 11 in a cell culture medium.
22. The implantable biocompatible device or kit of claim 21, wherein the implantable biocompatible device or kit further comprises one or more antigens.
Citation Information
Patent Citations
Antibodies against amyloid beta 4 with glycosylated in the variable region
EP1960428A1
Binding molecules against SARS-coronavirus and uses thereof
US20100172917A1
Sleigh-knee.
US630633A
Human CTLA-4 antibodies and their uses
WO2001014424A2
Encapsulation device
WO2014173441A1