A primer set, a kit and application for rapid identification of individuals
By constructing an InDel gene chip typing system, primer sets and probes are used to amplify and type the InDel locus on human chromosomes, solving the problems of low throughput, high cost and slow speed in existing individual identification technologies, and achieving high-throughput, low-cost and rapid individual identification results.
Patent Information
- Application Number
- CN202210588834.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-26
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2042-05-26
AI Technical Summary
Existing technologies suffer from low throughput, high cost, and slow speed in individual identification. Furthermore, next-generation sequencing technology involves complex data analysis steps and has high requirements for the instrument's operating environment, making it unsuitable for rapid on-site testing.
A gene chip typing system for InDel was constructed using bio-gene chip technology. Specific primer sets and probes were used to amplify and type the InDel locus on human chromosomes, and the gene chip was used for individual identification.
It achieves high-throughput, low-cost, and rapid detection of individuals, with high data reliability, suitable for rapid on-site detection, and a cumulative individual recognition rate of 0.999 999 999 970 783, meeting the requirements for individual recognition.
Smart Images

Figure CN114959058B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a primer set, kit, and application for rapid individual identification. Background Technology
[0002] The patent (application number: 2022102199480) discloses the application of 66 InDel loci on human chromosomes in individual identification or paternity testing. The inventors independently screened 66 InDel loci from the dbSNP database and evaluated the population genetic parameters of 66-plex InDels (66 InDel loci) in 251 Han Chinese individuals, analyzing their forensic application value. The results show that the 66 InDel loci exhibit good genetic polymorphism in the Han Chinese population and can be independently applied to forensic individual identification and paternity testing research.
[0003] Sanger sequencing, renowned for its long read lengths, reliable data, and high accuracy, is considered the "gold standard" of sequencing technology. However, it suffers from low throughput, high cost, slow speed, and poor instrument portability. Next-generation sequencing (NGS) technology addresses these issues, enabling rapid sample detection. However, NGS involves complex data analysis steps and requires demanding instrument operating environments, making it unsuitable for rapid on-site testing. Gene chips, through complementary base pairing, hybridize PCR-amplified nucleotide sequences with probes. Besides high throughput, speed, and low cost, chips offer strong applicability, are compatible with mostly small instruments, and are highly portable. Genotyping results are simple; observation of the chip signal is sufficient to determine the outcome. The ease of operation facilitates widespread application. Given the InDel genetic marker identified in the patent (application number: 2022102199480), it is necessary to independently construct an InDel gene chip genotyping system using bio-gene chip technology for individual identification research.
[0004] In view of this, the present invention is hereby proposed. Summary of the Invention
[0005] The primary objective of this invention is to provide an application of the InDel locus on human chromosomes in individual identification.
[0006] A second objective of this invention is to provide a primer set for amplifying the aforementioned InDel locus.
[0007] A third objective of this invention is to provide a method for individual identification.
[0008] A fourth objective of this invention is to provide a set of probes.
[0009] The fifth objective of this invention is to provide a gene chip.
[0010] The sixth objective of this invention is to provide a reagent kit.
[0011] In a first aspect, the present invention provides an application of the human chromosome InDel gene locus in individual identification;
[0012] The InDel loci include: rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs2307807, rs139101426, rs33955557, rs56110100, rs10541877, rs10656522, rs 59027185, rs3028599, rs10535391, rs145041883, rs56348842, rs10667259, rs3510591 8. rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, rs11471707 and Amel.
[0013] Secondly, the present invention provides a primer set for amplifying the above-mentioned InDel gene locus, the sequences of which are shown in SEQ ID NO.1 to SEQ ID NO.60.
[0014] Thirdly, the present invention provides a method for individual identification, comprising the following steps:
[0015] a. Using the DNA of the sample to be tested as a template, amplification is performed using the primer set described above;
[0016] b. Based on the amplification results of step a, perform inDel locus typing;
[0017] c. Individual identification based on genotype at loci;
[0018] The InDel loci include: rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs2307807, rs139101426, rs33955557, rs56110100, rs10541877, rs10656522, rs 59027185, rs3028599, rs10535391, rs145041883, rs56348842, rs10667259, rs3510591 8. rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, rs11471707 and Amel.
[0019] As a further technical solution, these are used to amplify rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs2307807, rs139101426, rs33955557, rs56110100, rs10541877, rs10656522, rs59027185, rs3028599, rs10535391, rs145041883, and rs5634884, respectively. 2. The primer concentration ratios of rs10667259, rs35105918, rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, rs11471707, and Amel are 2.25:1:2.25:1.5:2.25:1.5:2:3:1:1.5:1.5:1.5:1.75:1.5:1.5:2.5:3:1.25:2:1.25:2.5:2.5:4.25:2:1.5:1.5.
[0020] As a further technical solution, the PCR reaction program of the primer set is as follows: denaturation at 94℃ for 1 min; denaturation at 94℃ for 30 s, annealing at 60℃ for 45 s, extension at 72℃ for 45 s, for a total of 32 cycles; extension at 72℃ for 10 min.
[0021] Fourthly, the present invention provides a set of probes that capture the PCR amplification products of the primer set.
[0022] As a further technical solution, the probe has a sequence as shown in SEQ ID NO.61 to SEQ ID NO.111.
[0023] As a further technical solution, the 5' end of the probe is chemically modified with an amino group.
[0024] Fifthly, the present invention provides a gene chip including the aforementioned probe.
[0025] In a sixth aspect, the present invention provides a kit comprising at least one of the primer set, the probe, or the gene chip.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] Based on prior patent application (application number: 2022102199480), the inventors further selected 25 autosomal InDel loci, with Amel as the sex determination locus, and combined them with the 25 autosomal loci to form 26-plex InDels. Verification showed that this system satisfies Hardy-Weinberg equilibrium while maintaining linkage equilibrium among the loci. The cumulative individual identification rate of the 26-plex InDels system was 0.999 999 999 970 783, which is greater than the TDP of the conventional STR system (0.999 999 999 98), meeting the requirements for individual identification and thus suitable for individual identification.
[0028] The primer set provided by this invention exhibits high specificity and sensitivity, enabling amplification of the aforementioned 26 InDel loci. The probe provided by this invention can specifically capture the amplification products of the primer set. The gene chip provided by this invention demonstrates high specificity, high sensitivity, good stability, and reliable data. Attached Figure Description
[0029] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0030] Figure 1 The screening process for 25 autosomal loci;
[0031] Figure 2 This is an image of the gene chip.
[0032] Figure 3 This is a diagram showing the probe arrangement of a gene chip.
[0033] Figure 4 Electrophoresis diagram for primer concentration optimization in multiplex amplification systems;
[0034] Figure 5 Electrophoresis diagrams showing the optimized Tm value and cycle number for the PCR system;
[0035] Figure 6 Electrophoresis diagram of a single-spot PCR system;
[0036] Figure 7 This is a hybridization diagram evaluating the specificity between InDel gene loci;
[0037] Figure 8 A comparative diagram showing the evaluation of specificity within the InDel locus;
[0038] Figure 9 This is a hybridization diagram for sensitivity evaluation between InDel gene loci. Detailed Implementation
[0039] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0040] Example 1
[0041] 1. Materials and Methods
[0042] 1.1 Main reagents for the experiment
[0043] Table 1 Experimental Reagents
[0044]
[0045]
[0046] 1.2 Main Instruments and Equipment for the Experiment
[0047] Table 2 Main Instruments and Equipment Used in the Experiment
[0048]
[0049] 1.3 Reagent Preparation
[0050] Table 3 Experimental Reagents
[0051]
[0052]
[0053] 1.4 Sample collection and DNA extraction and quantification
[0054] DNA was extracted from peripheral blood samples of 100 unrelated Han Chinese individuals collected using a prior patent application (application number: 2022102199480). Sample collection and DNA extraction were performed in accordance with the prior application.
[0055] 1.5 Screening of the InDel locus and design of primers and probes
[0056] The InDel locus was screened according to the operating procedure of the prior patent application (application number: 2022102199480). The screened primers were then used in multiplex probe design, with selection based on factors such as probe specificity, probe length, annealing temperature, and avoidance of hairpin structures and dimers. The screening process is as follows: Figure 1 As shown. Thus, a total of 25 autosomal InDel loci were obtained for use in the InDel gene chip genotyping multiplex amplification system (26-plex InDels).
[0057] This study used Primer Premier 5.0 and MFEprimer software for primer design, and the specific design criteria are as follows:
[0058] (1) Primer length is 16-28 nt and GC content is between 44% and 55%;
[0059] (2) The Tm value range should be kept at the same annealing temperature (60℃ as standard), and Fp and Rp should not differ too much;
[0060] (3) MFEprimer software was used to check for the presence of hairpin structures and primer dimers in the primers;
[0061] (4) The PCR product fragments should be kept as consistent as possible to avoid uneven amplification;
[0062] (5) The 5' end of the reverse primer was fluorescently labeled with Cy3.
[0063] This study used Primer Premier 5.0 software for hybridization probe design, and the specific design criteria are as follows:
[0064] (1) The probe sequence length is about 18bp;
[0065] (2) Hairpin structure and primer dimer;
[0066] (3) The Tm values of the two probes at each locus differ by less than 3°C;
[0067] (4) Add (T)15 to the 3' end to improve the spatial flexibility of the probe;
[0068] (5) Add amino modification after poly(T) at the 3' end and combine with gene chip.
[0069] 1.6 Optimization of primer ratios for multiplex PCR system
[0070] (1) All loci were prepared with the same primer concentration for PCR reaction system and were amplified by single-site PCR under the same PCR conditions. The specific PCR system and conditions are shown in Tables 4 and 5.
[0071] (2) The amplification products were examined by 1.5% agarose gel electrophoresis. Take 2.5 μL of each PCR product, add 2.5 μL of enzyme-free water, and then add 1 μL of 6× loading buffer. After mixing well, electrophore at 120V for 60 min in 1×TAE buffer.
[0072] Table 4 PCR reaction system
[0073]
[0074] Table 5 PCR reaction procedure
[0075]
[0076] (3) After electrophoresis, the primer concentration was adjusted based on the brightness of the PCR product bands captured by the automated electrophoresis gel imaging system. This process was repeated multiple times until the band brightness remained consistent.
[0077] (4) After determining the primer ratio, 26 pairs of primers (25 pairs of autosomal InDel loci and 1 pair of Amel loci) were mixed and labeled as Primer Mix, and then dispensed for use in subsequent studies.
[0078] 1.7 Optimization of Multiplex PCR Reaction Conditions
[0079] Based on the reaction system with the primer concentrations determined in 1.6, the annealing temperature and PCR cycle number were optimized. The primer mixture was prepared using the primer ratios validated in the previous step. Annealing temperatures were set to 56℃, 58℃, 59℃, 60℃, and 61℃, with cycle numbers of 30 cycles, 35 cycles, and 40 cycles, respectively. Combinations of annealing temperatures and cycle numbers were also performed. The PCR system and primers remained the same as in 1.6, except for the optimization conditions. The optimal annealing temperature and PCR cycle number were determined using agarose gel electrophoresis band brightness results.
[0080] 1.8 Evaluation of the specificity of multiplex PCR reaction
[0081] Following the steps outlined above, after determining the PCR primer ratios and PCR conditions, 52 primer pairs corresponding to the 26-plex InDels (including 25 autosomal InDel loci and 1 Amel sex determination locus) were individually amplified. The single-site PCR amplification products were detected by agarose gel electrophoresis (1.5% gel concentration) to observe whether primer dimers were present in the electrophoretic bands.
[0082] 1.9 Preparation of Gene Chips
[0083] (1) Centrifuge the biosynthesized oligonucleotide probe (lyophilized powder) at 14,000 rpm for 3 min, take it out and add enzyme-free water to make up the volume (the final concentration of each probe after volume adjustment is 100 μmol / L), shake and centrifuge, then aliquot and store at -20℃ for later use.
[0084] (2) Heat the spotting solution in a 45°C water bath. When the spotting solution becomes a clear solution, mix it with the probe solution in a 1:1 ratio. After mixing, add the solution to a 384-well plate.
[0085] (3) Customize the chip film according to the gene chip probe arrangement. Before spotting, equilibrate the aldehyde substrate to room temperature and then perform the film application process.
[0086] (4) Turn on the Bio-Spotting Instrument and first perform ultrasonic cleaning on the spotting needle. Set the program according to the calculated parameters, and then proceed with chip fabrication.
[0087] (5) After the chip fabrication is complete, place it in a desiccator overnight. See the image below for the appearance of the gene chip. Figure 2 See probe layout diagram Figure 3 ( Figure 3 W—wild type; M—mutant type.
[0088] 1.10 Gene chip hybridization and fluorescence signal detection
[0089] (1) First, turn on the water bath and adjust it to 45°C; put the hybridization solution into the water bath and heat it. The purpose is to completely dissolve the precipitated crystals. The hybridization solution can be used when it is a clear liquid.
[0090] (2) Denaturation treatment of PCR products: After incubation at 98°C for 3 min in a PCR amplification instrument, immediately place on ice for 5 min. The single strands formed after denaturation are more likely to bind to the probe.
[0091] (3) Remove the prepared gene chip from the desiccator. Since the spotting instrument is a contact spotting device, there may be problems such as missed spots or inconsistent sizes. Select a clear and uniform gene chip, wash it in the pre-washing solution for 10 seconds, and then rinse it in ultrapure water for 5 seconds. Shake off the water on the surface of the chip and let it air dry at room temperature.
[0092] (4) Mix the denatured multiplex PCR amplification product and the preheated hybridization solution in a 1:1 ratio, taking 30 μL for each. Quickly add 55 μL of the mixture to the chip reaction area. When adding the sample, be careful not to let the pipette tip touch the chip to avoid affecting the arrangement of the probes in the reaction area.
[0093] (5) Place the chip horizontally in the hybridization box and place it in a water bath at 45°C for 1 hour.
[0094] (6) After hybridization, the chip is placed in the cleaning solution and rinsed five times with a washing bottle, and then the liquid on the chip is shaken off.
[0095] (7) Before scanning, turn on the scanner to warm up to prevent uneven signal and affect the scanning results.
[0096] (8) Open the chip slot, place the chip with the sampled area facing down into the chip slot, and after ensuring the chip is fixed in place, close the chip mounting plate.
[0097] (9) Set the parameters of the “Hardware Settings” module, set the power of the 532nm wavelength to 100%, the resolution (Focus position) to 10μm, and the other parameters to the software default values.
[0098] (10) Select Wavelength 532 in the “Image” function. Click “Data Scan” to scan. Save the scan after it is complete.
[0099] (11) Select the “New Blocks” function and set the analysis array frame. Set the parameters as follows: Number of columns / rows = 14, Column / Row spacing = 800μm, Feature diameter = 200μm. Align the frame with the scanned array and manually adjust it according to the array signal.
[0100] (12) Select the “Analyze” function to read the fluorescence signal of the gene chip.
[0101] 1.11 Evaluation of gene chip specificity
[0102] (1) Evaluation of locus specificity: The 26 loci were amplified individually, and the amplification system, amplification conditions, and hybridization procedure were performed according to the steps described above. Each locus was replicated three times to avoid experimental errors. The binding of each locus to probes from other loci was observed.
[0103] (2) Evaluation of locus specificity: Based on the next-generation sequencing results, three genotypes (mutant, wild-type, and heterozygous) were identified for each locus. The three genotypes of the 25 autosomal InDel loci were subjected to PCR amplification, microarray hybridization, and scanning. The genotypes at each locus were replicated three times to avoid experimental errors. The consistency between the three genotypes at each locus and the next-generation sequencing results was observed.
[0104] 1.12 Evaluation of gene chip sensitivity
[0105] Human whole blood genomic DNA was collected and diluted to 10 ng / μL. This DNA was then diluted seven times in a 2-fold serial sequence. The concentrations were: 10 ng / μL, 5 ng / μL, 2.5 ng / μL, 1.3 ng / μL, 0.65 ng / μL, 0.33 ng / μL, 165 pg / μL, and 82.5 pg / μL. One μL of each diluted sample was taken and PCR amplified under the established conditions. The amplified PCR products were hybridized, and the lower limit of sensitivity was observed using microarray hybridization scanning.
[0106] 1.13 Gene chip repeatability evaluation
[0107] The coefficient of variation (CV) reflects the absolute value of data dispersion, and is calculated as: Coefficient of variation = Variance / Mean. CV can be used to assess the stability of gene chips and ensure data reliability. The method is as follows:
[0108] (1) Three batches of aldehyde substrates were used, with ten sheets taken from each batch, and the chips were prepared using a Bio-Spotting Instrument.
[0109] (2) To reduce experimental error, two chips were randomly selected from the same batch, and a total of six chips were selected from three batches for chip hybridization.
[0110] (3) Scanning with GenePix 4000B, using the identifier column as the judgment standard, the fluorescence signal values of the identifier column of each reaction area were read, and the mean and standard deviation of the fluorescence signal of the chip were statistically analyzed to calculate the intra-batch / inter-batch fluorescence signal variation coefficient. Variation coefficient = standard deviation / mean.
[0111] 1.14 Establishment of Gene Chip Discrimination Criteria
[0112] Because gene chips contain background signals, there is some error in interpreting experimental results. Therefore, it is necessary to establish discrimination criteria to achieve more accurate genotyping results. Chip discrimination criteria are established based on a comparison of chip scanning results and next-generation sequencing results.
[0113] 2 Results
[0114] 2.1 InDel gene chip locus information
[0115] Based on the dbSNP database (GRCh37.hg19 as the reference genome), 25 autosomal InDel loci were screened according to the above procedure, distributed across 17 chromosomes. Amel, as a sex-determining locus, combines with the 25 autosomal loci to form 26-plex InDels. Detailed information on the loci is shown in Table 6.
[0116] Individual identification rate was calculated using alleles_EAS from the dbSNP database. Assume the frequency of the wild-type dia allele is p1 and the frequency of the mutant allele is p2. The formula for calculating the individual identification rate is DP = 1 - (p1 / p2) * ... 2 ) 2 -(p2 2 ) 2 -(2*p1*p2) 2 The system satisfies Hardy-Weinberg equilibrium while maintaining linkage equilibrium among all loci. The cumulative individual identification rate of the 26-plexInDels system is 0.999 999 999 970 783, which is greater than the TDP of the conventional STR system (0.999999 999 98), thus meeting the requirements for individual identification.
[0117] Table 6. Genetic information of 26-plex InDels loci
[0118]
[0119]
[0120] 2.2 InDel gene chip primer information
[0121] Multiple primers were designed using Primer Premier 5.0 and MFEprimer software. The PCR amplification products of the 26 InDel sites were distributed in the range of 151-180 bp. Agarose gel electrophoresis detected no primer dimers in the amplification products. The specific primer sequences are shown in Table 7.
[0122] Table 7 Primer information for the 26-plex InDels system
[0123]
[0124]
[0125] 2.3 InDel gene chip probe information
[0126] Probes were designed using Primer Premier 5.0 software, and their specificity was compared using NCBI's BLAST alignment function. Validation was performed, resulting in the design of 25 pairs of autosomal InDel locus probes and one Amel sex determination locus probe. All probes were 31-38 bp in length and consisted of two parts: one part was the probe sequence designed by Primer Premier 5.0, used to capture PCR amplification products for individual identification (SEQ ID NO. 61–SEQ ID NO. 111); the other part was 15 T sequences (SEQ ID NO. 112), used to connect to the chip and the identification sequence, improving chip spatial flexibility and increasing locus binding efficiency. Furthermore, the 5' end was chemically modified with an amino group to form a covalent cross-link with the aldehyde group of the aldehyde substrate. Specific probe sequences are shown in Table 8, where W represents wild-type locus probes and M represents mutant locus probes.
[0127] Table 8 Probe information for the 26-plex InDels system
[0128]
[0129]
[0130] 2.4 Optimization of Multiplex PCR System
[0131] To ensure consistent amplification efficiency for each locus in the multiplex primer amplification system, the primer ratio (concentration ratio, i.e., mass-to-volume concentration) needs to be optimized. Amplification was performed using a single-site PCR system, and the amplification products were subjected to agarose gel electrophoresis. Adjustments were made based on the brightness of the agarose gel electrophoresis bands. After multiple optimizations, PCR amplification was performed using the primer ratios in Table 9, and the brightness of the agarose gel electrophoresis bands for each locus tended to be consistent.
[0132] It should be noted that for a gene locus with two primer pairs designed, such as rs56348842, its proportion in the primer set is 3, so the proportions of its two primer pairs in the primer set are 1.5 each (each primer pair accounts for half). The same applies to other gene loci with two primer pairs designed.
[0133] Table 9. Primer ratios for multiplex amplification
[0134]
[0135] After optimizing the primer ratios, primers with a final concentration of 100 μM were mixed according to the ratios in Table 9, denoted as Primer MIX, to further optimize the primer concentrations. Figure 4 ( Figure 4In the diagram (M—DL50 Marker; 1—PCR input 0.5 μL; 2—PCR input 1 μL; 3—PCR input 2 μL; 4—PCR input 3 μL; 5—Blank control), the PCR product amplification efficiency was too low when the Primer MIX input was 0.5 μL; the band brightness was weaker than that of 2 μL and 3 μL when the input was 1 μL, and the PCR product was relatively less; the band brightness was basically the same when the input was 2 μL and 3 μL. To save costs, the final primer input in this system was 2 μL.
[0136] Once the PCR system is determined, we optimize it, such as... Figure 5 ( Figure 5 In the diagram (M—DL50 Marker; 1-5—28 cycles; 6-10—30 cycles; 11-15—32 cycles; Tm values for 1, 6, and 11—61℃; Tm values for 2, 7, and 12—60℃; Tm values for 3, 8, and 13—59℃; Tm values for 4, 9, and 14—58℃; Tm values for 5, 10, and 15—56℃), combining the Tm values and PCR cycle parameters, it can be seen that for the same Tm value, the more cycles, the brighter the electrophoretic bands of the PCR product. The optimal number of cycles is determined to be 32 cycles. When the number of cycles is 32, the brightness of the target product bands is basically the same at Tm values of 60℃ and 61℃, so the Tm value for this system is determined to be 60℃.
[0137] 2.5 Specificity evaluation of multiplex PCR system
[0138] The purpose of specificity evaluation is to observe whether dimers exist between primers and whether the amplification products of each primer are consistent in size with the target fragment. Experiments are conducted based on the optimized multiplex amplification primer concentrations and PCR conditions (Tm value, cycle number). Figure 6(In the picture, M-DL50 Marker; 1-25—rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs2307807, rs1 39101426, rs33955557, rs56110100, rs10541877, rs10656522, rs59027185, rs3028599, rs10535391, rs145 041883, rs56348842, rs10667259, rs35105918, rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, rs11471707; 26—Amel; 27—Blank control). Based on the band brightness of the agarose gel electrophoresis bands, it can be seen that the 26 gene loci have clear bands, there are no primer dimers, and the band positions are consistent with the length of the PCR amplification products. The blank control group has no bands, indicating no contamination, and the experimental data are reliable.
[0139] 2.6 Evaluation of gene chip specificity
[0140] The purpose of microarray specificity evaluation is to observe whether mismatches occur between loci or between two probes at the same locus during hybridization. Mismatches can lead to false positives, affecting the interpretation of experimental results. This study performed single-site PCR amplification on 25 InDel loci, and the amplification products were hybridized onto a microarray. The specificity of the microarray was evaluated based on the fluorescence signal values of the loci obtained from the microarray scanner. Figure 7(In the picture, AY—rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs23078 07. rs139101426, rs33955557, rs56110100, rs10541877, rs10656522, rs59027185, rs3028599, The results from rs10535391, rs145041883, rs56348842, rs10667259, rs35105918, rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, and rs11471707 (Amel) showed good specificity among the 25 InDel loci, with no mismatches between probes. The Amel sex determination locus was able to identify male and female samples. Next, intra-locus specificity was assessed using next-generation sequencing genotyping results. Each locus contained three genotypes (wild-type, heterozygous, and mutant). Unit-site PCR amplification was performed based on the sequencing results, with each locus including the three genotypes. Intra-locus specificity was then assessed based on the gene chip scanning results. Figure 8 (As shown in the figure, A—wild type; B—mutant; C—heterozygote) Taking rs56113354 as an example, the three genotyping results obtained by gene chip detection are consistent with the genotyping results of next-generation sequencing. The probes within the loci have good specificity and can distinguish the three genotyping results. In summary, the 26-plex InDels gene has good inter-locus and intra-locus specificity, which meets the requirements for subsequent experimental results.
[0141] 2.7 Evaluation of gene chip sensitivity
[0142] The initial sample concentration was 10 ng / μL. The DNA template was diluted 2-fold, for a total of seven dilutions. The resulting DNA concentrations were 10 ng / μL, 5 ng / μL, 2.5 ng / μL, 1.3 ng / μL, 0.65 ng / μL, 0.33 ng / μL, 165 pg / μL, and 82.5 pg / μL, respectively. 1 μL of each DNA sample was used for multiplex PCR amplification. After hybridization, the amplified products were scanned using a scanner to check the fluorescence signal intensity of the microarray under different sensitivity conditions. The results are shown below. Figure 9(A—10ng; B—5ng; C—2.5ng; D—1.3ng; E—0.65ng; F—0.33ng; G—165pg; H—82.5pg) are shown. When the template input is 1.3ng, the locus detection rate is 100%; when the template input is 0.65ng, the locus detection rate decreases to 88%; when the template input is 0.33ng or less, the signal is significantly weakened, the gene chip typing results have large errors, and gene typing interpretation is impossible. In summary, the detection sensitivity of the 26-plex InDels gene chip established in this study is 1.3ng.
[0143] 2.8 Gene chip repeatability evaluation
[0144] Three batches of pre-prepared gene chips were selected, with 12 chips prepared from each batch. Two chips were randomly selected for repeatability evaluation. The three batches were designated B1, B2, and B3 (Batch 1, Batch 2, Batch 3), and different chips within each batch were designated C1 and C2 (Chip 1, Chip 2). Multiplex PCR amplification was performed using the same DNA sample as a template to maintain consistent genotyping results and minimize errors caused by experimental procedures. After PCR product deformation, chip hybridization was performed. The probe fluorescence signal intensity at each locus was read after scanning with a GenePix4000B scanner. The results are shown in Tables 10 and 11. Statistical analysis of the hybridization genotyping results showed that the coefficient of variation for both chips from the same batch and chips from different batches was less than 12%, indicating that 26-plex InDels exhibited good repeatability and the data were reliable.
[0145] Table 10 Chip Repeatability Evaluation (within batch)
[0146]
[0147] Table 11 Chip repeatability evaluation (between batches)
[0148]
[0149] 2.9 Gene chip discrimination criteria
[0150] Based on the NGS sequencing genotyping results of 100 unrelated individual samples, gene chip discrimination criteria were formulated as follows: when 3:1 < Ratio(Ref / Alt) < 1:3, the locus was determined to be heterozygous; when Ratio(Ref / Alt) ≥ 1:3, the locus was determined to be mutant; when Ratio(Ref / Alt) ≥ 3:1, the locus was determined to be wild type. According to these discrimination criteria, the gene chip genotyping results were statistically analyzed, and the sample gene typing accuracy rate was above 92.3%. Among them, there were 87 samples with a genotyping accuracy rate of 100%. Analyzing the genotyping information of the remaining sample loci, 24 out of 26 loci had the same genotyping as NGS, and the genotyping accuracy rate was 100%. There were genotyping errors in rs56348842 and rs34105738, which needed to be further optimized in future experiments.
[0151] 3 Discussion
[0152] In this study, based on the previously screened InDel loci, a 26-plex InDels multiplex amplification system (including 25 autosomal InDel loci and 1 Amel sex determination locus) was independently established based on gene chip technology. After adjusting the primer ratio, the brightness of the agarose electrophoresis bands of the single-locus PCR products of the 26 loci was basically the same, indicating that the amplification efficiency of each single locus in the multiplex amplification system was uniform. After gradient optimization, the optimal primer input amount of the 26-plex InDels system was 2 μL, and the optimal number of PCR cycles and Tm value of the PCR system were 32 cycles and 60 °C, respectively. For single-locus PCR amplification of the 26 loci, it could be seen from the agarose gel electrophoresis map that the electrophoresis bands of the 26 loci were clear and bright, the positions of the amplified products were consistent with the lengths of the target fragments, and there were no dimer primer bands, indicating that effective amplification was obtained and the primer specificity was good. Analyzed by GenePix4000B scanning, the sensitivity of the 26-plex InDel gene chip was 1.3 ng. After verification, the specificity within and between the 26 loci was good, and there was no hybridization mismatch phenomenon; at the same time, the coefficient of variation within and between batches was less than 13%, indicating that the gene chip had good stability and reliable data for individual identification research.
[0153] This study independently constructed a 26-plex InDels (InDels) hormone multiplex amplification system based on gene chip technology, containing 25 autosomal InDel loci and 1 Amel sex determination locus. The system achieved a cumulative individual identification efficiency of 0.99999999970783, meeting the requirements for individual identification research. Furthermore, the experiment's time from sampling to genotyping result detection was approximately 3 hours, enabling rapid on-site testing. By comparing the genotyping results with those of 100 unrelated Han Chinese individuals using NGS sequencing, the gene chip genotyping results were analyzed, providing fundamental data for individual identification research.
[0154] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention. SEQUENCE LISTING <110> Military Medical Research Institute of the Academy of Military Sciences of the Chinese People's Liberation Army <120> A primer set, reagent kit, and application for individual identification. <160> 112 <170> PatentIn version 3.5 <210> 1 <211> 25 <212> DNA <213> Artificial sequence <400> 1 acaagagtag gataggtgcc acttt 25 <210> 2 <211> twenty three <212> DNA <213> Artificial sequence <400> 2 ttgcttgtgg tatccatggt gac 23 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence <400> 3 aaatctcatc cccctgctgt ac 22 <210> 4 <211> twenty two <212> DNA <213> Artificial sequence <400> 4 tttccctgct atatccccag ca 22 <210> 5 <211> twenty three <212> DNA <213> Artificial sequence <400> 5 ggccccattt gttgcttatt acc 23 <210> 6 <211> twenty four <212> DNA <213> Artificial sequence <400> 6 tggagaaatt ctcagcacac ctac 24 <210> 7 <211> twenty three <212> DNA <213> Artificial sequence <400> 7 ctggtgaatt tccgtccaga caa 23 <210> 8 <211> twenty two <212> DNA <213> Artificial sequence <400> 8 atgtcccctg gcttatgtcc ta 22 <210> 9 <211> twenty four <212> DNA <213> Artificial sequence <400> 9 ctgcctctct ttcccctaat tgac 24 <210> 10 <211> 26 <212> DNA <213> Artificial sequence <400> 10 aacctccactttcctaccag aagttc 26 <210> 11 <211> twenty three <212> DNA <213> Artificial sequence <400> 11 tgtccaatgc ctgtcctctc tgc 23 <210> 12 <211> twenty three <212> DNA <213> Artificial sequence <400> 12 tcactcaacg acgggaaata cgt 23 <210> 13 <211> twenty three <212> DNA <213> Artificial sequence <400> 13 caatgcctgt cctctctgca tct 23 <210> 14 <211> twenty two <212> DNA <213> Artificial sequence <400> 14 tcaacgacgg gaaatacgtc ct 22 <210> 15 <211> 25 <212> DNA <213> Artificial sequence <400> 15 cctcttcctc ataaatctgg ctgtc 25 <210> 16 <211> 25 <212> DNA <213> Artificial sequence <400> 16 aggtagcctctttcttcagg aatcg 25 <210> 17 <211> 26 <212> DNA <213> Artificial sequence <400> 17 ctggttaaga tgctaagacc cagtct 26 <210> 18 <211> 31 <212> DNA <213> Artificial sequence <400> 18 tctgatgatg caataaagtg ttattttcac a 31 <210> 19 <211> twenty one <212> DNA <213> Artificial sequence <400> 19 agcggcagaa aatgagtgac a 21 <210> 20 <211> twenty two <212> DNA <213> Artificial sequence <400> 20 tggagaattc ccagcatgga ac 22 <210> twenty one <211> 32 <212> DNA <213> Artificial sequence <400> twenty one ccttaggtag atgtatgtat gtactgagtg cc 32 <210> twenty two <211> 32 <212> DNA <213> Artificial sequence <400> twenty two cagtcattta catcaatgtg tggattaaat cc 32 <210> twenty three <211> 25 <212> DNA <213> Artificial sequence <400> twenty three cagccatctt tatcaacttc ccatg 25 <210> twenty four <211> 28 <212> DNA <213> Artificial sequence <400> twenty four tagatattgt tgctcttaca agaggcaa 28 <210> 25 <211> twenty two <212> DNA <213> Artificial sequence <400> 25 accttgccct gtctatgtct tc 22 <210> 26 <211> twenty one <212> DNA <213> Artificial sequence <400> 26 gcagagtcta agcatgccct t 21 <210> 27 <211> twenty one <212> DNA <213> Artificial sequence <400> 27 cacagcaagc aagtcctgaa c 21 <210> 28 <211> twenty three <212> DNA <213> Artificial sequence <400> 28 ggccctttag gccactttaa gac 23 <210> 29 <211> twenty four <212> DNA <213> Artificial sequence <400> 29 gcaagcaagt cctgaactgg tata 24 <210> 30 <211> 25 <212> DNA <213> Artificial sequence <400> 30 ggccctttag gccactttaa gacct 25 <210> 31 <211> twenty two <212> DNA <213> Artificial sequence <400> 31 ttctaaccat tgccctggtg ag 22 <210> 32 <211> twenty three <212> DNA <213> Artificial sequence <400> 32 ttccatgcag gtcacacaag atc 23 <210> 33 <211> twenty three <212> DNA <213> Artificial sequence <400> 33 ccgtggtgcc atattttgag gta 23 <210> 34 <211> twenty three <212> DNA <213> Artificial sequence <400> 34 tcagaagcaa gagtctacca acc 23 <210> 35 <211> 25 <212> DNA <213> Artificial sequence <400> 35 tgaggtactg tgtcctaaaccctat 25 <210> 36 <211> twenty four <212> DNA <213> Artificial sequence <400> 36 ttcagaagca agagtctacc aacc 24 <210> 37 <211> 26 <212> DNA <213> Artificial sequence <400> 37 gtttatttaa tccctggctc ccatgc 26 <210> 38 <211> 26 <212> DNA <213> Artificial sequence <400> 38 tctcactcca tctaaacaac gaaacc 26 <210> 39 <211> 33 <212> DNA <213> Artificial sequence <400> 39 actttgataa tactgctatg taacatattc ctt 33 <210> 40 <211> 27 <212> DNA <213> Artificial sequence <400> 40 cctgaaaatg taactctgag ttttgga 27 <210> 41 <211> 33 <212> DNA <213> Artificial sequence <400> 41 actttgataa tactgctatg taacatattc ctt 33 <210> 42 <211> 29 <212> DNA <213> Artificial sequence <400> 42 cctgaaaatg taactctgag ttttggaga 29 <210> 43 <211> twenty four <212> DNA <213> Artificial sequence <400> 43 ggctgctatg ctgagtagat gtag 24 <210> 44 <211> 25 <212> DNA <213> Artificial sequence <400> 44 ttggggaggaa gaactaagga cctag 25 <210> 45 <211> 26 <212> DNA <213> Artificial sequence <400> 45 ctcttattca cactcatagg ctgctt 26 <210> 46 <211> 25 <212> DNA <213> Artificial sequence <400> 46 agaccacctc gagatttagactcca 25 <210> 47 <211> 26 <212> DNA <213> Artificial sequence <400> 47 ctctgccttt tcaagaacaa ttctgt 26 <210> 48 <211> 29 <212> DNA <213> Artificial sequence <400> 48 actgtgattt atcaagttaa catcactct 29 <210> 49 <211> twenty three <212> DNA <213> Artificial sequence <400> 49 tttctctctc aactggggct tga 23 <210> 50 <211> twenty four <212> DNA <213> Artificial sequence <400> 50 tcagctgttc tccgtctact ctga 24 <210> 51 <211> 30 <212> DNA <213> Artificial sequence <400> 51 tgcatactga atttgtactt ctaatgcttt 30 <210> 52 <211> 31 <212> DNA <213> Artificial sequence <400> 52 aagtacaatc cagttttcta ttttaatcca t 31 <210> 53 <211> twenty two <212> DNA <213> Artificial sequence <400> 53 ttacccagtc ttgcccttca tg 22 <210> 54 <211> 27 <212> DNA <213> Artificial sequence <400> 54 atctctaaga tgaactccat ttggctt 27 <210> 55 <211> 26 <212> DNA <213> Artificial sequence <400> 55 ccaacggtgt gtaagtattc ctcttt 26 <210> 56 <211> 25 <212> DNA <213> Artificial sequence <400> 56 gacctgacca aactctatga actga 25 <210> 57 <211> twenty three <212> DNA <213> Artificial sequence <400> 57 ctgcctagca aaaggtcaat gct 23 <210> 58 <211> twenty four <212> DNA <213> Artificial sequence <400> 58 gtgggtttga cagttggatg cttg 24 <210> 59 <211> twenty one <212> DNA <213> Artificial sequence <400> 59 aacacaggct tgaggccaac c 21 <210> 60 <211> twenty two <212> DNA <213> Artificial sequence <400> 60 gggactgcta atgcaaacag tg 22 <210> 61 <211> 17 <212> DNA <213> Artificial sequence <400> 61 ttattagaag agtgggt 17 <210> 62 <211> 17 <212> DNA <213> Artificial sequence <400> 62 taatgaagag tgggtat 17 <210> 63 <211> 16 <212> DNA <213> Artificial sequence <400> 63 ttgttgtcaa actccc 16 <210> 64 <211> 16 <212> DNA <213> Artificial sequence <400> 64 aggcttggtc aaactc 16 <210> 65 <211> 20 <212> DNA <213> Artificial sequence <400> 65 atagaaagca taacattgac 20 <210> 66 <211> 20 <212> DNA <213> Artificial sequence <400> 66 ttataataac attgactggt 20 <210> 67 <211> 16 <212> DNA <213> Artificial sequence <400> 67 gacccagaag agatgc 16 <210> 68 <211> 18 <212> DNA <213> Artificial sequence <400> 68 cccagaagag acagtgca 18 <210> 69 <211> 15 <212> DNA <213> Artificial sequence <400> 69 gtaacggggc aagaa 15 <210> 70 <211> 16 <212> DNA <213> Artificial sequence <400> 70 tgagatgtaa cagggg 16 <210> 71 <211> 16 <212> DNA <213> Artificial sequence <400> 71 aagagacagg gaggaa 16 <210> 72 <211> 16 <212> DNA <213> Artificial sequence <400> 72 gaaagagacg gaggaa 16 <210> 73 <211> 20 <212> DNA <213> Artificial sequence <400> 73 tgagagaaca gacagaagga 20 <210> 74 <211> 20 <212> DNA <213> Artificial sequence <400> 74 aatgtgagag gacagaagga 20 <210> 75 <211> 18 <212> DNA <213> Artificial sequence <400> 75 ccaaacataa ttaagact 18 <210> 76 <211> 17 <212> DNA <213> Artificial sequence <400> 76 ctaaccaaaa agacttc 17 <210> 77 <211> 20 <212> DNA <213> Artificial sequence <400> 77 tctcctcacc actgaaagtg 20 <210> 78 <211> 20 <212> DNA <213> Artificial sequence <400> 78 ctctctcctc accacctcag 20 <210> 79 <211> 18 <212> DNA <213> Artificial sequence <400> 79 gatttacctt tatgacaa 18 <210> 80 <211> 16 <212> DNA <213> Artificial sequence <400> 80 tttataaggg aggcag 16 <210> 81 <211> 16 <212> DNA <213> Artificial sequence <400> 81 agtccctgtt ttatac 16 <210> 82 <211> 16 <212> DNA <213> Artificial sequence <400> 82 cgagtccgtt ttatac 16 <210> 83 <211> 16 <212> DNA <213> Artificial sequence <400> 83 cacctctcga agcagt 16 <210> 84 <211> 18 <212> DNA <213> Artificial sequence <400> 84 cacctctctt gaagcagt 18 <210> 85 <211> 20 <212> DNA <213> Artificial sequence <400> 85 atacactttt gtgagctgct 20 <210> 86 <211> 20 <212> DNA <213> Artificial sequence <400> 86 cactgaatac ctgctgactt 20 <210> 87 <211> 18 <212> DNA <213> Artificial sequence <400> 87 gctttcaaga acttgttc 18 <210> 88 <211> 20 <212> DNA <213> Artificial sequence <400> 88 aatgaagctg agagattcaa 20 <210> 89 <211> 20 <212> DNA <213> Artificial sequence <400> 89 ttagaaagga acatcattga 20 <210> 90 <211> 20 <212> DNA <213> Artificial sequence <400> 90 gttagaaagg aacatcgagt 20 <210> 91 <211> twenty three <212> DNA <213> Artificial sequence <400> 91 cccaccaccc cagcatgtca gat 23 <210> 92 <211> 20 <212> DNA <213> Artificial sequence <400> 92 accaccccag ctcagatgca 20 <210> 93 <211> 18 <212> DNA <213> Artificial sequence <400> 93 gaaacgtgct aactagaa 18 <210> 94 <211> 16 <212> DNA <213> Artificial sequence <400> 94 catgtgctaa ctagaa 16 <210> 95 <211> 16 <212> DNA <213> Artificial sequence <400> 95 cttagtccaa aacgat 16 <210> 96 <211> 16 <212> DNA <213> Artificial sequence <400> 96 aacttgatca catttc 16 <210> 97 <211> 18 <212> DNA <213> Artificial sequence <400> 97 aaaatatcct cagtggtg 18 <210> 98 <211> 16 <212> DNA <213> Artificial sequence <400> 98 tatcctcagt gttgtg 16 <210> 99 <211> 17 <212> DNA <213> Artificial sequence <400> 99 tacatacatc tggaatg 17 <210> 100 <211> 17 <212> DNA <213> Artificial sequence <400> 100 tgtacatacc tggaatg 17 <210> 101 <211> 20 <212> DNA <213> Artificial sequence <400> 101 gtgatccgaa gtactggcag 20 <210> 102 <211> twenty three <212> DNA <213> Artificial sequence <400> 102 tccttcggtg atcagtactg gca 23 <210> 103 <211> 17 <212> DNA <213> Artificial sequence <400> 103 agatcaatct tatactt 17 <210> 104 <211> 17 <212> DNA <213> Artificial sequence <400> 104 ttagatcaat catactt 17 <210> 105 <211> 20 <212> DNA <213> Artificial sequence <400> 105 aatattacac gtgtccatga 20 <210> 106 <211> 16 <212> DNA <213> Artificial sequence <400> 106 tattacacat gtgtcc 16 <210> 107 <211> 18 <212> DNA <213> Artificial sequence <400> 107 ttcattcctt aaagtttc 18 <210> 108 <211> 18 <212> DNA <213> Artificial sequence <400> 108 cccattcatt caagtttc 18 <210> 109 <211> 20 <212> DNA <213> Artificial sequence <400> 109 aagtttccat ataacgagag 20 <210> 110 <211> 20 <212> DNA <213> Artificial sequence <400> 110 gtttccatat aacaagagag 20 <210> 111 <211> 18 <212> DNA <213> Artificial sequence <400> 111 gctgatggta ggaactgt 18 <210> 112 <211> 15 <212> DNA <213> Artificial sequence <400> 112 tttttttttt ttttt 15
Claims
1. An application of a human chromosome InDel locus in individual identification; The InDel loci are: rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs2307807, rs139101426, rs33955557, rs56110100, rs10541877, rs10656522, rs5 9027185, rs3028599, rs10535391, rs145041883, rs56348842, rs10667259, rs35105918 , rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, rs11471707 and Amel.
2. A primer set for amplifying the InDel locus as described in claim 1, characterized in that, The sequences of the primer set are shown in SEQ ID NO.1 to SEQ ID NO.
60.
3. A method for individual identification, characterized in that, Includes the following steps: a. Using the DNA of the sample to be tested as a template, amplification is performed using the primer set described in claim 2; b. Based on the amplification results of step a, perform inDel locus typing; c. Individual identification based on genotype at loci; The InDel loci are: rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs2307807, rs139101426, rs33955557, rs56110100, rs10541877, rs10656522, rs5 9027185, rs3028599, rs10535391, rs145041883, rs56348842, rs10667259, rs35105918 , rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, rs11471707 and Amel.
4. The method according to claim 3, characterized in that, The amplification system was used to amplify rs56113354, rs76989317, rs66493016, rs34564973, rs5849187, rs71843136, rs2307807, rs139101426, rs33955557, rs56110100, rs10541877, rs10656522, rs59027185, rs3028599, rs10535391, rs145041883, and rs56348842, respectively. The concentration ratios of primers rs10667259, rs35105918, rs372779701, rs146109101, rs3993057, rs34105738, rs10544053, rs11471707, and Amel are 2.25:1:2.25:1.5:2.25:1.5:2:3:1:1.5:1.5:1.5:1.75:1.5:1.5:2.5:3:1.25:2:1.25:2.5:2.5:4.25:2:1.5:1.
5.
5. The method according to claim 3, characterized in that, The PCR reaction program for the primer set was as follows: denaturation at 94℃ for 1 min; denaturation at 94℃ for 30 s, annealing at 60℃ for 45 s, extension at 72℃ for 45 s, for a total of 32 cycles; extension at 72℃ for 10 min.
6. A set of probes, characterized in that, The probe captures the PCR amplification product of the primer set described in claim 2; The sequence of the probe is shown in SEQ ID NO.61 to SEQ ID NO.
111.
7. The probe according to claim 6, characterized in that, The 5' end of the probe is chemically modified with an amino group.
8. A gene chip, characterized in that, Includes the probe described in claim 6 or 7.
9. A reagent kit, characterized in that, It includes at least one of the primer set of claim 2, the probe of claim 6 or 7, or the gene chip of claim 8.
Citation Information
Patent Citations
44 InDels locus composite amplification detection kit for forensic individual identification of degradation samples
CN109762909A
Six-color fluorescence labeling detection system for 64 gene loci on human autosomes and sex chromosomes for degrading detected material typing
CN113584179A