Primers, probes for detecting Mycoplasma gallisepticum by LAMP-Taqman and their applications
By designing the LAMP-Taqman detection method, using specific primers and probes to perform Mycoplasma chicken poison under constant temperature conditions, the problems of false positive and detection height limit were solved, and early rapid detection with high specificity and high sensitivity were achieved.
Patent Information
- Application Number
- CN202210646129.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-08
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2042-06-08
AI Technical Summary
The existing mycoplasma chicken poison detection methods have problems such as high false positive probability and high detection limit, and cannot achieve early rapid detection.
A LAMP-Taqman detection method was designed to detect it under constant temperature conditions of 62-64°C using specific primers and probes, including internal primer FIP, internal primer BIP, external primer F3, external primer B3, loop primer LF and loop primer probe LBP. Combined with fluorescence detection technology, it avoids non-specific amplification and improves sensitivity and specificity.
High specificity and high sensitivity detection of Mycoplasma chicken poison is achieved, with a detection limit of 0.258fg/μL, which can be completed within 45 minutes, simplified operation, and is suitable for rapid detection under non-laboratory conditions, reducing the probability of false positives.
Smart Images

Figure CN114959081B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal disease detection technology, and in particular to a primer and probe for detecting Mycoplasma gallisepticum in chickens using the LAMP-Taqman method and its application. Background Technology
[0002] Mycoplasma galliscepticum (MG) is a mycoplasma that causes respiratory infections in chickens. Different strains have varying infectivity and pathogenicity. The main clinical manifestations after infection are runny nose, watery eyes, and coughing. In severe cases, it can manifest as difficulty breathing or open-mouth breathing, and moist rales may be heard. Moreover, chickens are generally asymptomatic carriers after infection; therefore, early screening is crucial for prevention and control. Currently, commonly used methods for detecting Mycoplasma galliscepticum include enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and real-time quantitative PCR. However, these methods all require complex operation and expensive testing equipment, limiting the rapid screening of Mycoplasma galliscepticum.
[0003] Loop-mediated isothermal amplification (LAMP), a novel isothermal detection method introduced in 2000, typically uses two pairs of primers: an outer primer (F3 / B3) and an inner primer (FIP / BIP), which bind to the target fragment with high specificity. Furthermore, isothermal amplification does not require temperature cycling; theoretically, the experiment can be completed in a single water bath. To accelerate the reaction, two loop primers can be designed before the two components of the upstream and downstream inner primers. Therefore, compared to PCR detection, LAMP technology offers advantages such as rapid reaction, low equipment cost, simple operation, and high specificity. In recent years, LAMP isothermal detection technology has been widely applied in the detection of food, microorganisms, and pathogens.
[0004] However, LAMP detection technology still has limitations that restrict its development. For example, the electrophoresis results cannot be visually observed due to varying amplified fragment sizes; the more primers used, the higher the probability of primer mismatch, leading to non-specific amplification and false positives; and the detection limit is relatively high, making it unsuitable for early detection of Mycoplasma gallisepticum. Therefore, there is an urgent need to develop a simple, highly specific, and highly sensitive rapid detection method for Mycoplasma gallisepticum. Summary of the Invention
[0005] To address the problems of high false positive rates and high detection limits in existing methods for detecting Mycoplasma gallisepticum, this invention provides primers and probes for detecting Mycoplasma gallisepticum using the LAMP-Taqman protocol and their applications. These primers and probes enable rapid detection of Mycoplasma gallisepticum under constant temperature conditions of 62-64℃, exhibiting high specificity and sensitivity. This facilitates early detection of Mycoplasma gallisepticum, enabling early diagnosis and treatment of the disease and helping to prevent its spread.
[0006] To achieve the above-mentioned objectives, the embodiments of the present invention employ the following technical solutions:
[0007] A LAMP-Taqman primer and probe for detecting Mycoplasma gallisepticum includes:
[0008] Inner primer FIP: 5′-CCGCCATTCATACCACCACTAAAGCCTGAACCAAAACCA-3′ (SEQ ID NO:1);
[0009] Inner primer BIP: 5′-GGAATGGATAATGCTGCTCCACACACCAACTTTTTCAGTTTGACCAT-3′ (SEQ IDNO: 2);
[0010] Outer primer F3: 5′-CTGAACCAAAGCCAAATCC-3′ (SEQ ID NO:3);
[0011] Outer primer B3: 5′-GTCTTTGATTTTTGCATAGTCAT-3′ (SEQ ID NO:4);
[0012] Loop primer LF: 5′-GGAGGGTTTGGCATCGGATC-3′ (SEQ ID NO:5);
[0013] Loop primer probe LBP: 5′-AGCAGCTGCTAAAACAGCTTTGA-3′ (SEQ ID NO:6).
[0014] Compared with existing technologies, the primers and probes for detecting Mycoplasma gallisepticum provided by this invention can specifically bind to the nucleic acid of Mycoplasma gallisepticum, accurately detect Mycoplasma gallisepticum, and by designing the downstream circular primer LB as a circular primer probe LBP, not only is non-specific amplification reduced and the probability of false positives lowered, but the detection efficiency and sensitivity of Mycoplasma gallisepticum are also improved. The primers and probes provided by this invention show no cross-amplification reactions with 21 pathogens, including Mycoplasma synoviae, Newcastle disease virus, avian influenza virus H9, and avian influenza virus H5, demonstrating significantly enhanced specificity. Furthermore, these primers and probes exhibit high sensitivity, with a detection limit of 0.258 fg / μL for Mycoplasma synoviae, enabling early and rapid diagnosis. Simultaneously, the detection is highly accurate and time-efficient, achieving rapid amplification at a constant temperature of 63℃, reaching detection level in just 45 minutes, significantly shortening the detection time. Moreover, no special instruments or professional operators are required, enabling rapid detection of Mycoplasma synoviae virus under non-laboratory conditions. This is of great significance for the prevention and control of Mycoplasma synoviae disease and has high practical value.
[0015] Preferably, the 5′ end of the circular primer probe LBP is labeled with a fluorescent group, and the 3′ end is labeled with a quenching group.
[0016] Preferably, the loop primer probe LBP is: 5′-FAM-AGCAGCTGCTAAAACAGCT TTGA-3′BHQ.
[0017] The present invention also provides the application of the primers and probes described in any of the above claims in the non-diagnostic detection of Mycoplasma chickenis.
[0018] The present invention also provides a kit for detecting Mycoplasma gallisepticum, comprising the primers and probes described in any of the above claims.
[0019] Preferably, the kit further includes a basic buffer, potassium chloride solution, ammonium sulfate solution, Tween 20, DNA polymerase, betaine, magnesium sulfate solution, dTNPs, and deionized water.
[0020] More preferably, the base buffer is Tris-HCl.
[0021] More preferably, the DNA polymerase includes Bst DNA polymerase large fragment and Taq DNA polymerase.
[0022] The present invention also provides a method for detecting Mycoplasma gallisepticum using the above-mentioned kit, the specific operation of which is as follows: extracting the nucleic acid of Mycoplasma gallisepticum as a template, performing LAMP amplification using the kit, and performing real-time fluorescence detection during the amplification process.
[0023] If both the test sample and the positive control can amplify fluorescent signals, while the negative control cannot amplify fluorescent signals, it indicates that the test sample is positive for Mycoplasma gallisepticum; if neither the test sample nor the negative control can amplify fluorescent signals, while the positive control can amplify fluorescent signals, it indicates that the test sample is negative for Mycoplasma gallisepticum.
[0024] The above-mentioned method for detecting Mycoplasma gallisepticum is time-efficient, simple to operate, and provides intuitive results, making it suitable for rapid detection of Mycoplasma gallisepticum.
[0025] Preferably, the LAMP amplification system comprises the following reagents and amounts: pH 8.8 Tris-HCl 20 mmol, KCl 10 mmol, (NH4)2SO4 10 mmol, Tween 20 0.024 μL, Bst DNA polymerase large fragment 8 U, Taq DNA polymerase 5 U, betaine 1 mol, MgSO4 8 mmol, dNTPs 1.6 mmol, inner primer FIP 2.0 μmol, inner primer BIP 2.0 μmol, outer primer F3 0.5 μmol, outer primer B3 0.5 μmol, loop primer LF 0.5 μmol, loop primer probe LBP 0.5 μmol, and deionized water to a final volume of 24 μL.
[0026] The above-mentioned optimized reaction conditions can further improve the detection efficiency of Mycoplasma gallisepticum.
[0027] Preferably, the LAMP amplification reaction temperature is 62℃-64℃ and the reaction time is 45-50min.
[0028] More preferably, the LAMP amplification reaction temperature is 63°C and the reaction time is 45 min.
[0029] Optimal LAMP amplification conditions can improve the detection efficiency of Mycoplasma chickenis. Attached Figure Description
[0030] Figure 1 This is a graph showing the specificity test results of the LAMP-Taqman detection method in Embodiment 2 of the present invention;
[0031] Figure 2 This is a structural diagram of the recombinant plasmid in Example 3 of the present invention;
[0032] Figure 3This is a graph showing the sensitivity test results of the LAMP-Taqman detection method in Example 3 of the present invention; wherein, the amplification curves from left to right are 2.575 ng / μL, 257.500 pg / μL, 25.750 pg / μL, 2.575 pg / μL, 257.500 fg / μL, 25.750 fg / μL, 2.575 fg / μL and 0.258 fg / μL;
[0033] Figure 4 This is a graph showing the repeatability test results of the LAMP-Taqman detection method in Embodiment 4 of the present invention. Detailed Implementation
[0034] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0035] To better illustrate the embodiments provided by the present invention, further examples are given below.
[0036] Example 1
[0037] 1. Materials and Methods
[0038] 1.1 Virus Samples and Kits
[0039] Mycoplasma synoviae, Newcastle disease virus, avian influenza virus H9, avian influenza virus H5, Mycoplasma gallisepticum, Marek's disease virus, viral arthritis virus, fowlpox virus, infectious bursal disease virus, infectious bronchitis virus, Mycoplasma Iowa, infectious laryngotracheitis virus, avian encephalomyelitis virus, Haemophilus paragallinarum, turkey hemorrhagic enteritis virus, avian hepatomegaly and splenomegaly virus, avian adenovirus, avian reticuloendothelial proliferative disease virus, avian leukosis virus, chicken-derived Tembusu virus, and avian candidiasis were all isolated, identified, and preserved by our laboratory through clinical testing.
[0040] 1.2 Primer and probe design
[0041] Primers and probes were designed based on the conserved sequence (Sequence ID: KU577585) of the Mycoplasma gallisepticum-specific gene vlhA. The primer sequences are shown in Table 1 and were synthesized and labeled by Shanghai Sangon Biotech Co., Ltd.
[0042] Table 1 Primers and probes
[0043]
[0044]
[0045] 1.3. DNA / RNA Extraction
[0046] Sample pretreatment:
[0047] Nucleic acid can be extracted directly from liquid samples such as blood and serum.
[0048] Tissue sample: Weigh 50-200mg of tissue into a 2mL enzyme-free centrifuge tube, add 0.3-0.8mL of physiological saline or PBS buffer, 2-4 steel beads, and grind in a grinder at low temperature for 0.5-2min until no lumps are present. Then centrifuge at 8000rpm for 1min and take the supernatant for nucleic acid extraction.
[0049] Secretion samples: After soaking a cotton swab in physiological saline, swab it over the sampling site and spread it. After collection, break off the swab head and place it in a centrifuge tube containing 1 mL of physiological saline. Vortex for 30 seconds and take 200 μL of the mixture for nucleic acid extraction.
[0050] DNA and RNA were extracted according to the instructions of the commercially available DNA / RNA extraction kit; the extracted DNA and the cDNA obtained from reverse transcription of the RNA virus were stored at -20°C for subsequent experiments.
[0051] 1.4 Establishment of a method for detecting Mycoplasma gallisepticum using a kit for detecting Mycoplasma gallisepticum
[0052] The kit for detecting Mycoplasma gallisepticum includes inner primer FIP, outer primer F3, outer primer B3, loop primer LF, loop primer probe LBP, basal buffer, potassium chloride solution, ammonium sulfate solution, Tween 20, DNA polymerase, betaine, magnesium sulfate solution, dTNPs, and deionized water.
[0053] Nucleic acid extracted from Mycoplasma gallisepticum was used as a template to construct a LAMP-Taqman reaction system (24 μL) using the above-mentioned kit: pH 8.8 Tris-HCl 20 mmol, KCl 10 mmol, (NH4+) 4)2 SO4 10mmol, Tween 20 0.024μL, Bst DNA polymerase large fragment 8U, Taq DNA polymerase 5U, betaine 1mol, MgSO4 8mmol, dNTPs 1.6mmol, inner primer FIP 2.0μmol, inner primer BIP 2.0μmol, outer primer F3 0.5μmol, outer primer B3 0.5μmol, loop primer LF 0.5μmol, loop primer probe LBP 0.5μmol, deionized water to 24μL.
[0054] Add 1 μL of the nucleic acid to be tested as a template to a reaction tube containing 24 μL of reaction solution, and perform LAMP amplification at 63℃ for 45 min, collecting fluorescence once per minute.
[0055] If both the test sample and the positive control can amplify fluorescent signals, while the negative control cannot amplify fluorescent signals, it indicates that the test sample is positive for Mycoplasma gallisepticum; if neither the test sample nor the negative control can amplify fluorescent signals, while the positive control can amplify fluorescent signals, it indicates that the test sample is negative for Mycoplasma gallisepticum.
[0056] Example 2
[0057] LAMP-Taqman specificity assay for detecting Mycoplasma gallisepticum:
[0058] Following the method in Example 1, 21 pathogens were tested as samples, including Mycoplasma synoviae, Newcastle disease virus, avian influenza virus H9, avian influenza virus H5, Mycoplasma gallisepticum, Marek's disease virus, viral arthritis virus, fowlpox virus, infectious bursal disease virus, infectious bronchitis virus, Mycoplasma turkey, Mycoplasma iawari, infectious laryngotracheitis virus, avian encephalomyelitis virus, infectious coryza virus, Mycoplasma septicemia virus, turkey hemorrhagic enteritis virus, avian hepatomegaly and splenomegaly virus, avian adenovirus, reticuloendothelial proliferative disease virus, and avian leukosis virus. Sterile water was used as a negative control.
[0059] DNA was extracted from Mycoplasma synoviae, Marek's virus, Mycoplasma gallisepticum, fowlpox virus, infectious laryngotracheitis virus, Haemophilus paragallinarum, turkey hemorrhagic enteritis virus, avian adenovirus, and avian leukosis virus, as well as RNA from Newcastle disease virus, avian influenza virus H9, avian influenza virus H5, avian viral arthritis virus, infectious bursal disease virus, Mycoplasma Iowa, infectious laryngotracheitis virus, avian encephalomyelitis virus, avian hepatomegaly and splenomegaly virus, avian reticuloendothelial proliferative disease virus, chicken-derived Tembusu virus, and avian candidiasis virus, according to the instructions of commercially available DNA / RNA extraction kits. The extracted DNA and cDNA reverse-transcribed from the RNA viruses were used as templates for LAMP amplification at 63℃ for 45 min.
[0060] LAMP amplification system: pH 8.8 Tris-HCl 20 mmol, KCl 10 mmol, (NH4+) 4)2SO4 10mmol, Tween 200.024μL, Bst DNA polymerase large fragment 8U, Taq DNA polymerase 5U, betaine 1mol, MgSO4 8mmol, dNTPs 1.6mmol, inner primer FIP 2.0μmol, inner primer BIP 2.0μmol, outer primer F3 0.5μmol, outer primer B3 0.5μmol, loop primer LF 0.5μmol, loop primer probe LBP 0.5μmol, deionized water to 24μL.
[0061] Test results as follows Figure 1 As shown in the figure, only Mycoplasma gallisepticum exhibits a typical S-shaped amplification curve, while the nucleic acids of other pathogens do not show amplification. This demonstrates that the LAMP-Taqman detection method provided by this invention has excellent specificity for detecting Mycoplasma gallisepticum.
[0062] Example 3
[0063] LAMP-Taqman susceptibility test for detecting Mycoplasma chickenis:
[0064] The vlhA sequence of the Mycoplasma gallisepticum genome was recombined into the PUC57 plasmid to obtain the recombinant plasmid, as follows: Figure 2 As shown. Engineered bacteria containing recombinant plasmids were synthesized by Shanghai Sangon Biotech. After fermentation, plasmids were extracted using a plasmid mini-prep kit (Beijing Tiangen). The plasmid concentration and purity were determined using an ultra-micro UV-Vis spectrophotometer. The plasmid concentration was 25.75 ng / μL, and a 10-fold dilution (2.575 ng / μL) was used as the starting concentration for testing.
[0065] The 2.575 ng / μL test plasmid was sequentially diluted 10-fold in seven different gradients to a concentration of 0.258 fg / μL, resulting in plasmid concentrations of 2.575 ng / μL, 257.500 pg / μL, 25.750 pg / μL, 2.575 pg / μL, 257.500 fg / μL, 25.750 fg / μL, 2.575 fg / μL, and 0.258 fg / μL. These eight plasmid concentrations were used as templates for systematic testing, with the empty PUC57 plasmid serving as a negative control. The results are as follows: Figure 3 As shown.
[0066] The results showed that the limit of detection for Mycoplasma gallisepticum detected by the LAMP-Taqman method provided in this invention was 0.258 fg / μL, and the correlation coefficient R0 was [missing value]. 2 The value was 0.995, and there was no nonspecific amplification.
[0067] Example 4
[0068] Stability validation of the LAMP-Taqman method for detecting Mycoplasma chickenis:
[0069] The test plasmid at a concentration of 2.575 ng / μL was used as a repeatable detection sample, and the LAMP-Taqman detection method established in this invention was used for detection. The results are as follows. Figure 4 As shown.
[0070] The experimental results show that the coefficient of variation (Cv) for repeatability detection is less than 5%, indicating that the LAMP-Taqman method for detecting Mycoplasma chickenis provided by this invention has good repeatability.
[0071] Example 5
[0072] Clinical sample testing:
[0073] Thirty nasopharyngeal swabs from chickens at a poultry farm in Hebei Province were collected. Nucleic acid was extracted from the samples using a commercially available nucleic acid extraction kit (Sanshibio, DP301). 1 μL of the nucleic acid to be tested was used as a template and detected according to the LAMP-Taqman method provided in Example 1. The results were compared with the reference detection method (standard detection method NY / T 553-2015 issued by the Ministry of Agriculture).
[0074] The results showed that after nucleic acid extraction from 30 samples using a nucleic acid extraction kit, LAMP-Taqman detection was performed, and 11 samples were positive for Mycoplasma gallisepticum. The reference detection method also detected 11 samples positive for Mycoplasma gallisepticum, and the results were consistent with each other, with a concordance rate of 100%.
[0075] Comparative Example 1
[0076] qPCR primers were designed based on the conserved sequence (Sequence ID: KU577585) of the Mycoplasma gallisepticum-specific gene vlhA:
[0077] Upstream primer GTF: 5′-GCAACTACCCCAACTCC-3′ (SEQ ID NO:7);
[0078] Downstream primer GTR: 5′-TCTCCGCCATTCATACC-3′ (SEQ ID NO: 8);
[0079] Probe GTP: 5'-FAM-CCTGAACCAAAGCCAAATCCAAAGCCT-3'BHQ (SEQ ID NO: 9).
[0080] The reaction conditions for quantitative real-time qPCR detection were: 95℃ for 5 min; 95℃ for 10 s, 58℃ for 30 s (fluorescence acquisition), for a total of 40 cycles.
[0081] Based on the above conserved sequence, the first set of LAMP primers is involved:
[0082] Inner primer FIP: 5′-CCGCCATTCATACCACCACTAAAGCCTGAACCAAAACCA-3′;
[0083] Inner primer BIP: 5′-GGAATGGATAATGCTGCTCCACACCAACTTTTTCAGTTTGACCAT-3′;
[0084] Outer primer F3: 5′-CTGAACCAAAGCCAAATCC-3′;
[0085] Outer primer B3: 5′-GTCTTTGATTTTTGCATAGTCAT-3′.
[0086] Based on the above conserved sequence, the second set of LAMP primers is involved:
[0087] Inner primer FIP: 5′-CCGCCATTCATACCACCACTAAAGCCTGAACCAAAACCA-3′;
[0088] Inner primer BIP: 5′-GGAATGGATAATGCTGCTCCACACCAACTTTTTCAGTTTGACCAT-3′;
[0089] Outer primer F3: 5′-CTGAACCAAAGCCAAATCC-3′;
[0090] Outer primer B3: 5′-GTCTTTGATTTTTGCATAGTCAT-3′;
[0091] Loop primer LF: 5′-GGAGGGTTTGGCATCGGATC-3′;
[0092] LB loop primer: 5′-AGCAGCTGCTAAAACAGCTTTGA-3′.
[0093] LAMP detection reaction conditions: 63℃, 60min.
[0094] Based on the above conserved sequences, the third set of LAMP primers and probes is involved:
[0095] Inner primer FIP: 5′-CCGCCATTCATACCACCACTAAAGCCTGAACCAAAACCA-3′;
[0096] Inner primer BIP: 5′-GGAATGGATAATGCTGCTCCACACCAACTTTTTCAGTTTGACCAT-3′;
[0097] Outer primer F3: 5′-CTGAACCAAAGCCAAATCC-3′;
[0098] Outer primer B3: 5′-GTCTTTGATTTTTGCATAGTCAT-3′;
[0099] Loop primer probe LFB: 5′-FAM-GGAGGGTTTGGCATCGGATC-3′BHQ;
[0100] LB loop primer: 5′-AGCAGCTGCTAAAACAGCTTTGA-3′.
[0101] LAMP detection reaction conditions: 63℃, 60min.
[0102] Based on the above conserved sequences, the fourth set of LAMP primers and probes is involved:
[0103] Inner primer FIP: 5′-CCGCCATTCATACCACCACTAAAGCCTGAACCAAAACCA-3′;
[0104] Inner primer BIP: 5′-GGAATGGATAATGCTGCTCCACACCAACTTTTTCAGTTTGACCAT-3′;
[0105] Outer primer F3: 5′-CTGAACCAAAGCCAAATCC-3′;
[0106] Outer primer B3: 5′-GTCTTTGATTTTTGCATAGTCAT-3′;
[0107] Loop primer LF: 5′-GGAGGGTTTGGCATCGGATC-3′;
[0108] Loop primer LB: 5′-AGCAGCTGCTAAAACAGCTTTGA-3′;
[0109] Taqman probe: 5'-FAM-CTCCGCCATTCATACCACC-3'BHQ (SEQ ID NO: 10).
[0110] The reaction conditions for LAMP-Taqman detection were: 63℃ for 60 min.
[0111] The above four sets of primers and probes were synthesized by Shanghai Sangon Biotech.
[0112] The eight gradient concentrations of test plasmids from Example 3 were used as templates for systematic testing. The sensitivity of each primer and probe system was compared, and the results are shown in Table 2.
[0113] Table 2
[0114]
[0115] The results show that the LAMP-Taqman detection method provided by this invention has a detection limit one order of magnitude lower than that of real-time quantitative qPCR in the detection of Mycoplasma gallisepticum.
[0116] Non-specific amplification and false positives were observed in the negative controls of the first LAMP method (i.e., without LF / LB) and the second LAMP method (i.e. with LF / LB).
[0117] The third LAMP method (which designs the upstream loop primer as a TAqman probe) avoids non-specific amplification, but its detection rate is significantly lower than that of the present invention, and its detection limit is also an order of magnitude higher.
[0118] The fourth group, the LAMP method (i.e., the additional design of a Taqman probe), has a high detection limit but low sensitivity and a low linearity coefficient R0. 2 The value is 0.982, indicating poor linearity.
[0119] Comparative Example 2
[0120] The detection temperatures of LAMP-Taqman were set to 61℃, 63℃, and 65℃, with a reaction time of 45 min for each. The LAMP-Taqman system of Example 1 was used to detect the eight gradient concentrations of test plasmids from Example 3, and the results are shown in Table 3.
[0121] Table 3
[0122]
[0123] The results showed that, under isothermal detection at 63℃, the detection time (Ct) of each concentration of the test plasmid and the linearity test results (R) of the serially diluted samples were significantly improved. 2 Both are significantly better than 61℃ and 65℃.
[0124] In summary, this invention establishes a LAMP-Taqman detection method for Mycoplasma gallisepticum using designed primers and probes. This method can rapidly amplify at 63°C, reaching the detection level after 45 minutes of reaction. Furthermore, the method avoids false positive results caused by nonspecific amplification, exhibiting high specificity, high sensitivity, and a detection limit as low as 0.258 fg / μL. It provides a reliable guarantee for the early clinical detection and epidemiological investigation of Mycoplasma gallisepticum, and is conducive to its widespread application in clinical practice.
[0125] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention. SEQUENCE LISTING <110> Hebei Sanshi Biotechnology Co., Ltd. <120> Primers and probes for detecting Mycoplasma gallisepticum using LAMP-Taqman assay and their applications <130> 2022 <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 39 <212> DNA <213> Artificial sequence <400> 1 ccgccattca taccaccact aaagcctgaa ccaaaacca 39 <210> 2 <211> 45 <212> DNA <213> Artificial sequence <400> 2 ggaatggata atgctgctcc acaccaactttttcagtttg accat 45 <210> 3 <211> 19 <212> DNA <213> Artificial sequence <400> 3 ctgaaccaaa gccaaatcc 19 <210> 4 <211> twenty three <212> DNA <213> Artificial sequence <400> 4 gtctttgatt tttgcatagt cat 23 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 ggagggtttg gcatcggatc 20 <210> 6 <211> twenty three <212> DNA <213> Artificial sequence <400> 6 agcagctgct aaaacagctt tga 23 <210> 7 <211> 17 <212> DNA <213> Artificial sequence <400> 7 gcaactaccc caactcc 17 <210> 8 <211> 17 <212> DNA <213> Artificial sequence <400> 8 tctccgccat tcatacc 17 <210> 9 <211> 27 <212> DNA <213> Artificial sequence <400> 9 cctgaaccaa agccaaatcc aaagcct 27 <210> 10 <211> 19 <212> DNA <213> Artificial sequence <400> 10 ctccgccatt cataccacc 19
Claims
1. A primer and probe for LAMP-Taqman detection of Mycoplasma gallisepticum, characterized in that: include: Inner primer FIP: 5′-CCGCCATTCATACCACCACTAAAGCCTGAACCAAAACCA-3′; Internal primer BiP: 5′-GGAATGGATAATGCTGCTCCACACCAACTTTTTCAGTTTGACCAT-3′; Outer primer F3: 5′-CTGAACCAAAGCCAAATCC-3′; Outer primer B3: 5′-GTCTTTGATTTTTGCATAGTCAT-3′; Loop primer LF: 5′-GGAGGGTTTGGCATCGGATC-3′; Loop primer probe LBP: 5′-FAM-AGCAGCTGCTAAAACAGCTTTGA-3′BHQ.
2. Use of the primers and probes according to claim 1 in non-diagnostic detection of Mycoplasma gallisepticum.
3. A kit for detecting Mycoplasma gallisepticum, characterized in that: Comprising the primers and probes according to claim 1.
4. The kit for detecting Mycoplasma gallisepticum according to claim 3, wherein Also included are basic buffer, potassium chloride solution, ammonium sulfate solution, Tween 20, DNA polymerase, betaine, magnesium sulfate solution, dTNPs, and deionized water.
5. A method for detecting Mycoplasma gallisepticum for non-diagnostic purposes using the kit according to claim 3, characterized in that: The specific operation is: extracting nucleic acid of Mycoplasma gallisepticum as a template, performing LAMP amplification with the kit, and performing real-time fluorescence detection during the amplification process.
6. The method for detecting Mycoplasma gallisepticum for non-diagnostic purposes according to claim 5, wherein: The LAMP amplification system includes the following reagents and amounts: pH 8.8 Tris-HCl 20 mmol, KCl 10 mmol, (NH 4)2 SO4 10 mmol, Tween 20 0.024 µL, Bst DNA polymerase large fragment 8 U, Taq DNA polymerase 5 U, betaine 1 mol, MgSO4 8 mmol, dNTPs 1.6 mmol, inner primer FIP 2.0 µmol, inner primer BIP 2.0 µmol, outer primer F3 0.5 µmol, outer primer B3 0.5 µmol, loop primer LF 0.5 µmol, loop primer probe LBP 0.5 µmol, and deionized water to 24 µL.
7. The method for detecting Mycoplasma gallisepticum for non-diagnostic purposes according to claim 5, wherein: The reaction temperature of the LAMP amplification is 62° C.-64° C., and the reaction time is 45-50 min.
8. The method for detecting Mycoplasma gallisepticum for non-diagnostic purposes according to claim 7, wherein: The reaction temperature of the LAMP amplification was 63° C., and the reaction time was 45 min.