Molecular marker BnMes-5A1 tightly linked to QTL for methylselenocysteine ​​content in rapeseed and its application

Abstract

The present invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker BnMes-5A1 closely linked to the QTL of rapeseed methylselenocysteine ​​content and its application. The present invention obtains a SNP marker significantly associated with the methylselenocysteine ​​content of rapeseed, which is located at the 36898348th base position on the chromosome A05 of the Darmor-bzh v10 genome and can explain 5.1% of the phenotypic variation. Through auxiliary selection by the molecular marker, the screening efficiency of single strains of rapeseed containing higher methylselenocysteine ​​can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker BnMes-5A1 tightly linked to a QTL of a rapeseed methylselenocysteine ​​content trait and an application thereof. Background Art

[0002] Modern research shows that different forms of selenium have great differences in physiological functions and biosafety. Among them, inorganic selenium has low bioavailability and high risk of toxicity; compared with inorganic selenium, methylselenocysteine ​​has higher human absorption efficiency, physiological activity and biosafety, so it has become a healthy form of selenium supplementation recommended by nutritionists.

[0003] Plants are the main pathway for selenium to enter the human food chain from the environment, and are also important carriers for converting inorganic selenium in the environment into organic selenium forms such as methylselenocysteine. Brassica napus is the main type of rapeseed cultivated in my country. It not only generally has excellent selenium enrichment ability, but its seedlings and stalks have also gradually become popular vegetable products among consumers in recent years due to their good taste, balanced nutrition, and easy processing. Studies have found that the selenium forms and contents of different rapeseed varieties vary greatly, and the genetic variation of traits related to organic selenium conversion is rich. This shows that rapeseed is a good carrier for the conversion of plant-derived organic selenium. In-depth exploration of the genetic regulatory sites for efficient synthesis of organic selenium in rapeseed-specific germplasm for breeding and improvement will help alleviate my country's growing demand for healthy selenium supplementation.

[0004] Traditional breeding methods are difficult to meet the current needs of crop breeding due to the long breeding period and low selection efficiency. With the rapid development of molecular biology and sequencing technology, accelerating the breeding process through genotype selection has become a widely used technical means in variety breeding. The use of molecular marker-assisted selection to detect molecular markers closely related to the efficient synthesis of methylselenocysteine ​​in rapeseed can overcome the difficulties in phenotypic identification of different forms of selenium content, guide the precise introduction or aggregation of traits, and greatly improve breeding efficiency. At present, there are no reports on the relevant research on the conversion efficiency of methylselenocysteine ​​in plants, and there are no reports on the identification of related genetic regulatory sites in rapeseed.

[0005] The present invention uses the rapeseed core germplasm resource population as material, utilizes genome-wide association analysis to identify QTL loci for efficient synthesis of methylselenocysteine ​​in rapeseed with breeding application potential, and develops molecular markers based on the QTL locus information, which will help improve the breeding efficiency of high-methylselenocysteine ​​rapeseed varieties. Summary of the invention

[0006] The present invention aims to provide an application of a reagent for detecting the 36898348th base on the A05 chromosome of the Brassica napus Darmor-bzh v10 genome in the screening and breeding of methylselenocysteine ​​content of rapeseed. By detecting the genotype of the 36898348th base on the A05 chromosome of the Brassica napus Darmor-bzh v10 genome, the screening and breeding of the methylselenocysteine ​​synthesis ability of rapeseed can be achieved.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] Obtaining the QTL locus qBnMes-5A1 for the efficient synthesis of methylselenocysteine ​​in rapeseed:

[0009] (1) A total of 327 Brassica napus inbred lines from various countries around the world were collected as rapeseed association groups. Individual leaves of each line in the association group were collected and total DNA was extracted using the CTAB method. The genotype of each sample was analyzed using the rapeseed 50K Illumina SNP chip developed by Wuhan Shuanglvyuan Chuangxin Technology Research Institute Co., Ltd.

[0010] (2) Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) was used to calculate the marker heterozygous rate, missing rate, and minor allele frequency at each locus of the population material. SNP markers were filtered using the criteria of missing rate ≤ 0.2, heterozygosity ≤ 0.2, minor allele frequency > 0.05, and unique match of SNP markers in the Darmor genome of Brassica napus (Chalhoub et al., 2014). Finally, 21,243 high-quality SNP markers were obtained for genome-wide association analysis.

[0011] (3) The genotype data of the association analysis population were imported into STRUCTURE v.2.3.4 for population structure analysis, and the 327 Brassica napus germplasm resources were divided into three subgroups. The kinship among the 327 Brassica napus germplasm resources was calculated using SPAGeDi software (Hardy and Vekemans, 2002).

[0012] (4) Using the rapeseed hydroponic culture system, 327 materials were planted in a hydroponic greenhouse; after culturing to the three-leaf stage, 10 μM sodium selenite was added to the culture medium and cultured for 5 days, and seedling samples were collected for selenium morphology determination. Three biological replicates were set up, and 5 materials were evenly crushed from each sample, and the methylselenocysteine ​​content was determined by liquid chromatography-morphology pretreatment device-atomic fluorescence spectrometry (LC-AFS, GH / T 1135-2017).

[0013] (5) Combining genotype data, population structure and selenium content data of rapeseed seedlings, association analysis was performed using TASSEL 5.0 software (Bradbury et al., 2007). The SNP marker A05-36898348, which was significantly associated with the methylselenocysteine ​​content of rapeseed, was detected on chromosome A05, which could explain up to 5.1% of the phenotypic variation. The SNP variation site (variation from C to G) was located at base 36898348 on chromosome A05 of the Brassica napus Darmor-bzh v10 genome (Rousseau-Gueutin et al., 2020). The major QTL site for efficient synthesis of methylselenocysteine ​​closely linked to this SNP site was named qBnMes-5A1.

[0014] The use of a reagent for detecting the 36898348th base on chromosome A05 of the Darmor-bzh v10 genome of Brassica napus in screening and breeding of rapeseed methylselenocysteine ​​enrichment ability belongs to the protection scope of the present invention.

[0015] The use of a reagent for detecting a rapeseed sequence comprising base 36898348 on chromosome A05 of the Brassica napus Darmor-bzh v10 genome in screening and breeding of rapeseed for its methylselenocysteine ​​enrichment ability also falls within the protection scope of the present invention.

[0016] In the above application, preferably, the rapeseed sequence is shown as SEQ ID NO.2.

[0017] The use of primers designed for base 36898348 on chromosome A05 of the Darmor-bzh v10 genome of Brassica napus in screening and breeding of rapeseed for its methylselenocysteine ​​enrichment ability also falls within the protection scope of the present invention.

[0018] In the above application, the applicant developed the KASP marker BnMes-5A1 of the positive strand according to the above SNP site, and the primers designed according to the marker are:

[0019] qBnMes-5A1 low selenium enrichment ability allele specific primer BnMes-5A1-F1: GAATTACACATTTGAGGAGCAAAC

[0020] qBnMes-5A1 high selenium enrichment ability allele-specific primer BnMes-5A1-F2: GAATTACACATTTGAGGAGCAAAG

[0021] Reverse primer BnMes-5A1-R: CGGATCTCTCCATACTTAGCTTTCT.

[0022] The above primers must be developed according to the principles of KASP labeling and must be added with a KASP-labeled universal adapter before use.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] (1) The present invention obtained for the first time a major QTL locus qBnMes-5A1 significantly associated with the efficient synthesis of methylselenocysteine ​​in rapeseed, which can explain up to 5.1% of the phenotypic variation and can be effectively applied to the genetic improvement of the efficient synthesis trait of methylselenocysteine ​​in rapeseed.

[0025] (2) For the first time, the molecular marker BnMes-5A1 was discovered to be significantly associated with the efficient synthesis of methylselenocysteine ​​in rapeseed, providing a reliable source of molecular markers for the pre-selection of the trait of efficient synthesis of methylselenocysteine ​​in rapeseed.

[0026] (3) The molecular marker BnMes-5A1 can be used to quickly select excellent alleles of qBnMes-5A1 in rapeseed varieties or lines during the growth period of rapeseed seedlings, which can greatly reduce the workload of breeding screening, shorten the breeding cycle, and accelerate the breeding process for efficient synthesis of methylselenocysteine ​​in rapeseed. DETAILED DESCRIPTION

[0027] The technical solutions of the present invention, unless otherwise specified, are all conventional techniques in the art; the reagents or materials, unless otherwise specified, are all from commercial channels. In the present invention, unless otherwise specified, the Brassica napus genome is referenced to Darmor-bzh v10 (Rousseau-Gueutin et al., 2020). The Brassica napus reference of the present invention: Whole-Genome Resequencing of a Worldwide Collection of Rapeseed Accessions Reveals the Ge netic Basis of Ecotype Divergence.

[0028] Embodiment 1:

[0029] Obtaining the QTL locus qBnMes-5A1 for the methylselenocysteine ​​content in rapeseed:

[0030] (1) A total of 327 Brassica napus inbred lines from various countries around the world were collected as rapeseed association groups. Individual leaves of each line in the association group were collected and total DNA was extracted using the CTAB method. The genotype of each sample was analyzed using the rapeseed 50K Illumina SNP chip developed by Wuhan Shuanglvyuan Chuangxin Technology Research Institute Co., Ltd.

[0031] (2) Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) was used to calculate the marker heterozygous rate, missing rate, and minor allele frequency at each locus of the population material. SNP markers were filtered using the criteria of missing rate ≤ 0.2, heterozygosity ≤ 0.2, minor allele frequency > 0.05, and unique match of SNP markers in the Darmor genome of Brassica napus (Chalhoub et al., 2014). Finally, 21,243 high-quality SNP markers were obtained for genome-wide association analysis.

[0032] (3) The genotype data of the association analysis population were imported into STRUCTURE v.2.3.4 for population structure analysis, and the 327 Brassica napus germplasm resources were divided into three subgroups. The kinship among the 327 Brassica napus germplasm resources was calculated using SPAGeDi software (Hardy and Vekemans, 2002).

[0033] (4) Using the rapeseed hydroponic culture system, 327 materials were planted in a hydroponic greenhouse; after culturing to the three-leaf stage, 10 μM sodium selenite was added to the culture medium and cultured for 5 days, and seedling samples were collected for selenium morphology determination. Three biological replicates were set up, and 5 materials were evenly crushed from each sample, and the methylselenocysteine ​​content was determined by liquid chromatography-morphology pretreatment device-atomic fluorescence spectrometry (LC-AFS, GH / T 1135-2017).

[0034] (5) Combining the genotype data, population structure and methylselenocysteine ​​content data of rapeseed seedlings, association analysis was performed using TASSEL 5.0 software (Bradbury et al., 2007). The SNP marker A05-36898348, which was significantly associated with the methylselenocysteine ​​content of rapeseed, was detected on chromosome A05, which could explain up to 5.1% of the phenotypic variation. The SNP variation site (variation from C to G) was located at the 36898348th base of chromosome A05 of the genome of Brassica napus Darmor-bzh v10 (Rousseau-Gueutin et al., 2020). The major QTL site for efficient synthesis of methylselenocysteine ​​closely linked to this SNP site was named qBnMes-5A1.

[0035] Embodiment 2:

[0036] Obtaining a molecular marker primer closely linked to the QTL locus qBnMes-5A1 for the methylselenocysteine ​​content trait:

[0037] (1) Sequences of 100 bp upstream and downstream of base 36898348 of the A05 chromosome of Brassica napus were extracted. According to the design principle of KASP (Kompetitive Allele-Specific PCR) molecular marker primers, the KASP molecular marker BnMes-5A1 was developed for its positive strand. The marker includes two competitive forward primers BnMes-5A1-F1 and BnMes-5A1-F2, which correspond to the sequence bases C and G of the above-mentioned SNP variant site, respectively, and a reverse universal primer BnMes-5A1-R. The primer sequences are as follows:

[0038] BnMes-5A1-F1:gaattacacatttgaggagcaaac

[0039] BnMes-5A1-F2:gaattacacatttgaggagcaaag

[0040] BnMes-5A1-R:cggatctctccatacttagctttct

[0041] The above primers must be developed according to the principles of KASP labeling and must be added with a KASP-labeled universal adapter before use.

[0042] The linker sequence added before BnMes-5A1-F1 is gaaggtgaccaagttcatgct, and the linker sequence added before BnMes-5A1-F2 is gaaggtcggagtcaacggatt.

[0043] The sequence amplified in Brassica napus Bingo is of genotype A (ie, CC genotype), and the sequence is as follows: gaattacacatttgaggagcaaacagaaagctaagtatggagagatccg (shown in SEQ ID NO. 1).

[0044] The sequence amplified in Brassica napus Westar is of genotype B (ie, genotype GG), and the sequence is as follows: gaattacacatttgaggagcaaagagaaagctaagtatggagagatccg (shown in SEQ ID NO. 2).

[0045] (2) Competitive allele-specific PCR was used to genotype the markers in the rapeseed-associated population. The amplification kit used was the five-primer amplification blocked mutation system (PAMS). According to the instructions of the PAMS pro SNP GentypingPCR mix kit, a 10uL reaction system was designed: 2×PARMS master mix 5μL, Allele X primer (10μM) 0.15μL, Allele Y primer (10μM) 0.15μL, Common R primer (10μM) 0.4μL, rapeseed genomic DNA 10-100ng. The amplification program was: 94℃15min; 94℃20s, 65-57℃ (Touch-down) 1min, 10 cycles; 94℃20s, 57℃1min, 30 cycles; collect the fluorescence signal once and output the genotype result. Tassel software was then used for association analysis, which confirmed that BnMes-5A1 was significantly associated with the main QTL locus qBnMes-5A1 for the efficient synthesis of methylselenocysteine ​​in rapeseed.

[0046] Using the above method, it was confirmed that the BnMes-5A1 marker was significantly associated with the major QTL locus qBnMes-5A1 for the efficient synthesis of methylselenocysteine ​​in rapeseed.

[0047] Embodiment 3:

[0048] The application of primers designed based on the 36898348th base of rapeseed A05 chromosome in the screening and breeding of rapeseed methylselenocysteine ​​efficient synthesis traits is as follows:

[0049] (1) 25 materials with high methylselenocysteine ​​content and low methylselenocysteine ​​content that have been homozygous after multiple generations of self-pollination were selected from 327 materials; the above materials were planted in a hydroponic greenhouse, and after culturing to the three-leaf stage, 10μM sodium selenite was added to the culture medium and continued to be cultured for 5 days, and seedling samples were collected for selenium morphology determination. Three biological replicates were set up, and 5 materials were uniformly crushed from each sample, and the methylselenocysteine ​​content was determined by liquid chromatography-morphological pretreatment device-atomic fluorescence spectrometry (LC-AFS, GH / T 1135-2017).

[0050] (2) The distribution of the two genotypes of the molecular marker BnMes-5A1 in the materials with higher and lower methylselenocysteine ​​contents was examined. The results showed that the genotype of the molecular marker BnMes-5A1 was A in 4 of the 25 materials with higher methylselenocysteine ​​contents and B in 21, while it was A in 15 of the 25 materials with lower methylselenocysteine ​​contents and B in 10 (Table 1).

[0051] (3) The results of the T test showed that there were extremely significant differences in the content of methylselenocysteine ​​in rapeseed seedlings between the two genotypes A and B detected by the molecular marker BnMes-5A1 (P<0.01).

[0052] The above results are sufficient to show that the molecular marker BnMes-5A1 prepared by us is highly correlated with the methylselenocysteine ​​content in rapeseed seedlings, and can therefore be used for molecular marker-assisted selection of high-methylselenocysteine ​​traits in rapeseed.

[0053] Table 1: Genotypes of molecular marker BnMes-SC7 in rapeseed seedlings with extreme methylselenocysteine ​​content

[0054] Sequence Listing <110> Oil Crops Research Institute, Chinese Academy of Agricultural Sciences <120> Molecular marker BnMes-5A1 tightly linked to QTL for methylselenocysteine ​​content in rapeseed and its application <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 49 <212> DNA <213> Artificial Sequence <400> 1 gaattacaca tttgaggagc aaacagaaag ctaagtatgg agagatccg 49 <210> 2 <211> 49 <212> DNA <213> Artificial Sequence <400> 2 gaattacaca tttgaggagc aaagagaaag ctaagtatgg agagatccg 49 <210> 3 <211> twenty four <212> DNA <213> Artificial Sequence <400> 3 gaattacaca tttgaggagc aaac 24 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 gaattacaca tttgaggagc aaag 24 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 cggatctctc catacttagc tttct 25 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 gaaggtgacc aagttcatgc t 21 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 gaaggtcgga gtcaacggat t 21

Claims

1. Use of a reagent for detecting the 36898348th base on chromosome A05 of the Darmor-bzh v10 genome of Brassica napus in screening and breeding of methylselenocysteine ​​content of Brassica napus, wherein the 36898348th base is C or G.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primers are BnMes-5A1-F1: GAATTACACATTTGAGGAGCAAAC, BnMes-5A1-F2: GAATTACACATTTGAGGAGCAAAG, and BnMes-5A1-R: CGGATCTCTCCATACTTAGCTTTCT.

4. Use of a reagent for detecting a rapeseed sequence comprising the 36898348th base on chromosome A05 of the Darmor-bzh v10 genome of Brassica napus in screening and breeding of methylselenocysteine ​​content of Brassica napus, wherein the sequence is shown in SEQ ID NO.2, and the 36898348th base is C or G.

Images