A molecular marker tightly linked to the major QTL-qON.C2 for the number of ovules per ovary in rapeseed and its application

Abstract

The present invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked to the major effect QTL qON.C2 of the number of ovules per ovary of rapeseed and its application. The major effect QTL locus of the number of ovules per ovary located by using 201 strains of rapeseed DH population is qON.C2 The peak SNP marker closely linked to it is Bn‑scaff_15714_1‑p1900599, located at base 2,353,885 of chromosome C02 of the Darmor V4.1 reference genome of rapeseed, which can explain 15.4% of the phenotypic variance on average, with an average additive effect of ‑1.13. The PARMS marker designed using this SNP was used to test the remaining DH lines, and it was found that it was easy to operate and had clear typing, and had a good selection effect on the number of ovules per ovary of rapeseed.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker tightly linked to a major effect QTL-qON.C2 of the number of ovules per ovary of rapeseed and an application thereof. Background Art

[0002] With the continuous development of molecular marker technology, its application in crops is becoming more and more extensive. Grodzicker et al. (1974) created the restriction fragment length polymorphism (RFLP) marker technology. RFLP is the first generation of molecular markers, which has the characteristics of abundant quantity, stable inheritance, specificity, good repeatability, and co-dominance. However, the amount of DNA required for this marker is relatively large; the operation procedure is cumbersome, time-consuming and labor-intensive, and the cycle is long; it is also necessary to use radioactive isotopes to label the probes. These factors limit the widespread use of RFLP markers. AFLP markers combine PCR and RFLP marker technologies and have been widely used in crop genetic diversity research, cytological research, variety purity identification and disease resistance research (Song Shunhua et al., 2006; Yuan Suxia, 2009; Wang Xue, 2004). However, AFLP markers also have some disadvantages: high cost, complex process, high technical difficulty; most markers are dominant markers; high requirements for DNA quality and restriction endonuclease quality. SSR markers, also known as microsatellite DNA markers, have been widely used in crop gene localization, molecular marker-assisted selection, DNA fingerprinting, variety purity identification, germplasm resource conservation and utilization, and genetic diversity analysis (Chen Yeli, 2010; Miao Tiyun, 2007; Jing Zange, 2010; Wang Dongmei, 2011). SSR markers have the advantages of abundant quantity, high polymorphism, simple operation, and low cost, but it is difficult to achieve high-throughput batch detection. In the past decade, with the continuous advancement of sequencing technology, it has become possible to develop molecular markers based on genome sequence information, such as SNP markers and InDel markers (Hyten et al., 2010). At present, whole genome selection breeding chips have only begun to be tried in rice (Yu et al., 2014), and other crops such as rapeseed are still mainly based on molecular marker-assisted selection. At present, SNP detection methods are mainly divided into two categories: one is the traditional detection method based on gel electrophoresis, represented by single-strand conformation polymorphism (SS CP), denaturing gradient gel electrophoresis (DDGE), restriction amplification polymorphic sequence (CAPS), allele-specific PCR (AS-PCR), etc., and the other is the high-throughput and highly automated detection method represented by direct sequencing, DNA chips, denaturing high-performance liquid chromatography (DHPLC), mass spectrometry detection technology, high-resolution melting curve (HRM), etc. These two methods have their own advantages and disadvantages. At present, there are detection methods that combine the two, such as KASP (Lister et al., 2013) and PARMS (Lu et al., 2020), which are not only simple to operate and low-cost, but also can achieve high-throughput detection.

[0003] The number of ovules per ovary is a typical complex quantitative trait controlled by multiple genes. The phenotype is continuously distributed and easily affected by environmental conditions. The combination of quantitative genetics and molecular marker technology can decompose complex quantitative traits into individual quantitative trait loci (QTL), and then study multiple genes that control quantitative traits like studying quality traits. QTL mapping is to analyze the quantitative trait phenotypic data of segregating populations based on genetic segregation populations, with the help of molecular markers and genetic maps, and use QTL mapping software to determine the location and effect of quantitative trait genes on chromosomes. At present, thousands of QTLs have been located in rapeseed using linkage mapping and association mapping methods, involving many important traits such as yield, plant type, quality and resistance (Hu et al., 2017). However, the QTL positioning research on the number of ovules per ovary in rapeseed has just started. Khan et al. (2019) used the genotype data of 521 rapeseed association populations and 60K rapeseed SNP chips to conduct genome-wide association analysis and obtained 8 SNP markers significantly associated with the number of ovules per ovary. Qadir et al. (2022) used the genotype data of 60K rapeseed SNP chips of 327 lines of rapeseed association populations to conduct genome-wide association analysis on the number of ovules per ovary, and identified 18 significant association loci in four environments.

[0004] The present invention uses rapeseed DH population to conduct multi-environment QTL positioning analysis on the trait of ovule number per ovary in rapeseed, aiming to find stable sites that have an improvement effect on the number of ovules per ovary in rapeseed, and based on this, develop practical high-throughput and low-cost molecular markers for selecting the number of ovules in rapeseed. Summary of the invention

[0005] The purpose of the present invention is to provide a reagent for detecting the 2,353,885th base of the C02 chromosome of Brassica napus for use in the screening and breeding of the number of ovules per ovary of Brassica napus.

[0006] Another object of the present invention is to provide a primer for detecting base 2,353,885 of chromosome C02 of Brassica napus for use in screening and breeding of Brassica napus based on the number of ovules per ovary.

[0007] The last object of the present invention is to provide a method for screening and breeding Brassica napus based on the number of ovules per ovary.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] Obtaining the tightly linked PARMS markers for the major QTL-qON.C2 for the number of ovules per ovary in rapeseed:

[0010] (1) 3S1181 and 3S1235 were selected from the rapeseed-associated population constructed in our laboratory as parents for emasculation and hybridization. The hybrid F1 was subjected to microspore culture and colchicine doubling to obtain 360 DH lines.

[0011] (2) 201 DH lines were randomly selected from the above 360 ​​DH lines for genotyping analysis using the rapeseed 50K-SNP chip, and 31,920 SNP markers were obtained and statistically analyzed. SNP markers with missing or no polymorphism in parental genotypes, missing or high heterozygous frequency in population genotypes, and too low minor allele frequency were removed. The remaining high-quality SNP markers were imported into Join map 4.0 software for linkage mapping analysis, and a high-density genetic linkage map containing 2,111 bins (including 8,905 markers) was constructed.

[0012] (3) The above 360 ​​DH lines were planted in four environments (codenamed 20QH, 21YL, 22YL, and 22HG) in 2020 Qinghai, 2021 Yangluo, 2022 Yangluo, and 2022 Huanggang. Five plants with uniform growth were selected from each line of the DH population during the flowering period. The three buds at the bottom of the main inflorescence were selected and the ovaries were peeled off. After the ovaries were made transparent, they were photographed under a stereo microscope and the ovules were counted (Zhu Yaoyao, 2019).

[0013] (4) Based on the above high-density genetic linkage map, the genotypes of 201 DH lines and the phenotypic data of the number of ovules per ovary, QTL positioning was performed using QTLCart2.5 software, and finally the major QTL locus -qON.C2 was obtained on chromosome C02 of the rapeseed DarmorV4 reference genome. Its peak SNP marker Bn-scaff_15714_1-p1900599 was located at the 2,353,885th base (the base was T / A or C / G), which could be repeatedly detected in both 21YL and 22YL environments.

[0014] (5) Extract the 100 bp sequence upstream and downstream of the 2,353,885th base of the rapeseed C02 chromosome, and obtain the PARMS detection primer sequence according to the primer design principle: qON.C2Ft: GAAGGTGACCAAGTTCATGCT GAACTAACACTCACTAACAACCTT;qON.C2Fc: GAAGGTCGGAGTCAACGGATT GAACTAACACTCACT AACAACCTC;qON.C2R:AATTTGGTTTTCGCCTCTGT.

[0015] The protection scope of the present invention includes:

[0016] Application of a reagent for detecting base 2,353,885 of chromosome C02 of Brassica napus in screening and breeding of Brassica napus with respect to the number of ovules per ovary.

[0017] The reagents described above are preferably primers.

[0018] The primers mentioned above are preferably the PARMS detection primers provided by the present invention.

[0019] A method for screening and breeding Brassica napus by using ovules per ovary, comprising detecting base 2,353,885 of chromosome C02 of Brassica napus by using conventional schemes in the art, wherein the conventional schemes include but are not limited to: sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] (1) The present invention obtains the major effect QTL locus qON.C2 for the number of ovules per ovary of rapeseed, which can be detected repeatedly and can explain an average of 15.4% of the phenotypic variance. The average additive effect is -1.13, and can be used for the genetic improvement of the number of ovules per ovary of rapeseed.

[0022] (2) The present invention obtains a PARMS marker tightly linked to qON.C2, and the detection method thereof is simple and low-cost, and can perform high-throughput screening on regions linked to the number of ovules per ovary, thereby improving selection efficiency and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Frequency distribution of ovule number per ovary phenotype of 201 DH lines of rapeseed in four environments. DETAILED DESCRIPTION

[0024] The technical solutions described in the present invention, unless otherwise specified, are all conventional techniques in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels. The version number of the Brassica napus genome used in the present invention is Darmor-bzh (Version 4.1) https: / / www.genoscope.cns.fr / brassicanapus / .

[0025] Embodiment 1:

[0026] Obtaining SNP markers closely linked to the major QTL for the number of ovules per ovary in rapeseed -qON.C2

[0027] (1) 3S1181 and 3S1235 were selected as parents from the rapeseed association population constructed in our laboratory (Li et al., 2020) for emasculation and hybridization, and the hybrid F1 was cultured with microspores and doubled with colchicine to obtain 360 DH lines. 201 strains were randomly selected from the 360 ​​DH population lines, and the leaves were collected and the total DNA was extracted using the CTAB method. The genotype of each sample was analyzed using the rapeseed 50K-SNP chip (https: / / www.greenfafa.com / index.php?a=lists&catid=48), and 31,920 SNP markers were obtained and statistically analyzed. Markers with missing or no polymorphism in parental genotypes, high missing ratio or heterozygosity of population genotypes, and low minor allele frequency were filtered out.

[0028] (2) The remaining high-quality SNP markers were imported into Joinmap4.0 software for mapping, and a high-density genetic linkage map was obtained: it contained 19 linkage groups with a total length of 1715.7 cM; it included 2111 bins and 8905 SNP markers; the marker density was 3.37 bins and 14.2 SNP / Mb.

[0029] (3) 360 DH lines were planted in four environments, namely 2020 Qinghai, 2021 Yangluo, 2022 Yangluo, and 2022 Huanggang (codenamed 20QH, 21YL, 22YL, and 22HG). Five plants with uniform growth were selected from each DH line during the flowering period, and three buds were selected from each plant. After the ovary was peeled off and made transparent as a whole, it was photographed under a stereo microscope and the ovules were counted, and the average value of each line was calculated. Statistical analysis was performed on the number of ovules per ovary of the above 201 DH lines in the four environments, and it was found that the number of ovules per ovary in each environment showed a large variation range and was normally distributed ( Figure 1 ), which can be directly used for subsequent QTL positioning.

[0030] (4) Based on the genotype, SNP marker genetic map and number of ovules per ovary of the DH population, QTL linkage analysis was performed using QTLCart2.5 software. The major QTL locus qON.C2 for the number of ovules per ovary was obtained on chromosome C02 (Table 1). It could be repeatedly detected in both the 21YL and 22YL environments. Its peak SNP marker Bn-scaff_15714_1-p1900599 was located at base 2,353,885 (T / A or C / G) of the DarmorV4.1 reference genome, which explained an average of 15.4% of the phenotypic variance. The average additive effect was -1.13, indicating that the enhancing allele came from the second parent 3S1235.

[0031] Table 1. Information of the major QTL for number of ovules per ovary -qON.C2

[0032]

[0033] Embodiment 2:

[0034] Development of a PARMS marker tightly linked to the number of ovules per ovary

[0035] The linkage markers obtained in Example 1 are derived from the SNP chip, which only has the probe sequence information used for molecular hybridization. The rapeseed SNP chip can detect tens of thousands of sites at a time, but its operation is relatively cumbersome and requires special equipment. In addition, it is expensive to use the rapeseed SNP chip to detect a large number of intermediate breeding materials, so it is necessary to convert it into a simple and low-cost PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System) marker. This marker system includes a pair of fluorescent universal primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers and a reverse shared primer, which can quickly and easily perform SNP allele type detection.

[0036] (1) For the peak SNP marker Bn-scaff_15714_1-p1900599 that is closely linked to qON.C2-1, extract the 100 bp sequence upstream and downstream of the 2,353,885th base of the C02 chromosome of the rapeseed Darmor V4.1 reference genome. According to the primer design principle, the PARMS marker detection primer sequence is obtained as follows:

[0037] qON.C2Ft: GAAGGTGACCAAGTTCATGCT GAACTAACACTCACTAACAACCTT;

[0038] qON.C2Fc: GAAGGTCGGAGTCAACGGATT GAACTAACACTCACTAACAACCTC;

[0039] qON.C2R: AATTTGGTTTTCGCCTCTGT

[0040] (2) Using the genomic DNA of the rapeseed DH linkage population as a template, the above primers were used for fluorescence quantitative PCR amplification, and Tecan F200 was used to scan the FAM and HEX signals and output the results, which were finally converted into genotypes.

[0041] Using the above primers, the sequence amplified in 3S1181 is: AATTTTGGTTTTTCGCCTCTGTGGTTA ATCTTGATAAAGCTTTTACAGTTTTACTACACAAGAGGTTGTTAGTGAGTGTTAGTTC

[0042] The sequence amplified in 3S1235 is: AATTTTGGTTTTTCGCCTCTGTGGTTAATCTTGATAAA GCTTTTACAGTTTTACTACACAAAAGGTTGTTAGTGAGTGTTAGTTC

[0043] Embodiment 3:

[0044] Application of PARMS marker in selection of ovule number per ovary in rapeseed

[0045] Among the 360 ​​DH lines, 159 were left except for 201 used for QTL mapping. The PA RMS marker qON.C2 provided in Example 2 detected that there were 95 materials with genotype AA / TT and 57 materials with genotype GG / CC (Table 2). The difference in the number of ovules per ovary between the AA and GG genotypes reached an extremely significant level in the three environments except 20QH, with the difference ranging from 1.51 to 2.07 and an average of 1.80.

[0046] Table 2. Phenotypes of the number of ovules per ovary of two genotypes of PARMS marker qON.C2 in the DH population

[0047] Genotype 20QH 21YL 22YL 22HG AA (n = 99) 35.3 29.1 29.1 28.9 GG (n = 57) 35.2 27.0 27.3 27.4 AA - GG 0.17 2.07 1.82 1.51 Pt - test 6.7E-01 7.0E-06 9.3E-05 3.0E-04

[0048] The above results indicate that the prepared PARMS molecular marker qON.C2 has a significant effect on the number of ovules per ovary of rapeseed and has a good screening effect.

Claims

1. Application of a reagent for detecting base 2,353,885 of chromosome C02 of Brassica napus in selective breeding for the number of ovules per ovary, wherein the chromosome C02 is the chromosome C02 on the genome of Brassica napus Darmor-bzh 4.1, and the reagent detects that the base 2,353,885 of chromosome C02 of Brassica napus is T / A or C / G.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primers are: qON.C2Ft: GAAGGTGACCAAGTTCATGCTGAACTAACACTCACTAACAACCTT; qON.C2Fc: GAAGGTCGGAGTCAACGGATTGAACTAACACTCACTAACAACCTC; qON.C2R: AATTTGGTTTTTCGCCTCTGT.

4. A method for selecting and breeding ovules per ovary of Brassica napus, the method comprising detecting base 2,353,885 of chromosome C02 of Brassica napus, the method comprising: Sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method, the C02 chromosome is Brassica napus Darmor-bzh 4.1 Chromosome C02 on the genome.

Images