A detection method and application of gene polymorphic loci related to sheep meat tenderness

Abstract

The present invention discloses a detection method and application of gene polymorphic sites related to sheep meat tenderness. The genetic polymorphism of sheep CCN5 gene in a population is analyzed by sequencing technology, and correlation analysis is performed by combining with individual meat quality trait data. It is found that the sheep population with superior meat tenderness can be selected early based on the polymorphic sites on the 5th exon of the CCN5 gene.

Description

Technical Field

[0001] The invention belongs to the field of gene detection and livestock and poultry variety improvement and breeding, and specifically relates to the identification of single nucleotide polymorphism (SNP) markers related to sheep meat tenderness. Background Art

[0002] With economic progress, the continuous improvement of residents' living standards and the booming catering industry, mutton has become more and more popular among the public. As the demand for mutton increases, people's requirements for its meat quality also increase. In recent years, breeders have gradually shifted their research direction to the improvement of sheep meat quality traits. The overall quality of mutton is affected by a variety of factors. For example, the intramuscular fat content can significantly affect the tenderness of the meat; the unsaturated fatty acids in mutton not only affect the flavor of mutton but are also essential nutrients for the human body. By exploring the correlation between the candidate genes affecting the meat quality traits of sheep and the mutation sites on them and the differences in meat quality traits of sheep populations, it provides an important basis for the molecular breeding work of sheep to improve meat quality. Early studies revealed the expression pattern of genes related to the differentiation process of preadipocytes in small-tailed Han sheep (DOI:10.16431 / j.cnki.1671-7236.2019.07.018.), but the main genes affecting meat quality traits have not yet been determined.

[0003] Cellular communication network factor 5 (CCN5) is involved in many physiological processes of the body, such as cell adhesion, proliferation, differentiation, migration, maturation, etc. Studies have shown that the CCN5 gene can affect the proliferation and differentiation of mesenchymal stem cells (MSCs) and participate in the body's fat metabolism. However, there are few studies on the CCN5 gene in livestock meat quality, and its regulatory role in affecting the body's meat quality traits is still unclear. At present, the exploration of SNP markers for the CCN5 gene is at a standstill. Summary of the invention

[0004] The purpose of the present invention is to provide a detection method and application of gene polymorphic sites related to the tenderness of sheep meat, to provide a fast and effective method for selecting sheep individuals with relatively high intramuscular fat content in a fixed group, and to provide a basis for breeding to improve the quality of sheep meat.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A method for detecting single nucleotide polymorphism of sheep CCN5 gene comprises the following steps:

[0007] Using sheep genomic DNA or DNA contained in sheep in vitro biological materials as a template, a partial fragment of the CCN5 gene was amplified by PCR, and the genotype of the single nucleotide polymorphism site in the 5th exon of the CCN5 gene was identified using the fragment.

[0008] Preferably, the single nucleotide polymorphism site is located at chr.13:7625253, which has a CG mutation in a sheep (eg, Small-tailed Han sheep) population.

[0009] Preferably, the primers for PCR are:

[0010] Upstream primer: 5'-AACGGAGGGAAGGACATCAAAT-3' (i.e. SEQ.ID.NO.1)

[0011] Downstream primer: 5'-AGCGGCTGACATAGAGTTTCCA-3' (ie, SEQ.ID.NO.2).

[0012] Preferably, the sheep ex vivo biological material is blood collected from individual sheep.

[0013] Preferably, the PCR reaction system includes: 1 to 2 μL of 50 to 150 ng / μL sheep genomic DNA or 1 to 2 μL of sheep blood sample, and 0.4 to 0.5 μL of 10 to 20 μmol / L upstream and downstream primers, respectively.

[0014] Preferably, the reaction conditions of the PCR include: 94°C for 5 min; 94-95°C for 30 s, 55-65°C for 30 s, 72°C for 16 s, for a total of 35 cycles; 72°C for 8 min.

[0015] Preferably, the identification of the genotype specifically comprises the following steps: sequencing the fragments, and then comparing the sequencing results with the reference sequence.

[0016] A detection kit for single nucleotide polymorphism of sheep CCN5 gene, comprising site amplification primers (for example, the upstream primer and downstream primer mentioned above) for identifying the genotype of the single nucleotide polymorphism site of the fifth exon of CCN5 gene by PCR-sequencing method.

[0017] The application of the above-mentioned sheep CCN5 gene single nucleotide polymorphism detection method in sheep molecular marker-assisted selection breeding.

[0018] Preferably, individuals whose genotype at the single nucleotide polymorphism site (specifically chr.13:7625253) is CG or CC have better meat quality traits.

[0019] Preferably, the meat quality trait is selected from intramuscular fat content.

[0020] Preferably, the sheep is selected from Small Tail Han sheep.

[0021] The beneficial effects of the present invention are embodied in:

[0022] According to the SNP site found in the fifth exon of the CCN5 gene, the present invention can not only realize the rapid and accurate typing of the CCN5 gene of a sheep (such as the small-tailed Han sheep) population, but also based on the significant correlation between the site and the individual meat quality traits, the molecular marker (i.e., SNP marker) can be used to screen sheep individuals with good meat quality (such as tenderness) at an early stage, thereby improving the breeding speed of superior meat sheep (such as the small-tailed Han sheep).

[0023] Furthermore, compared with the traditional typing method, the present invention identifies genotypes by sequencing, which has the advantages of short time consumption, high success rate, more intuitive results, and the ability to identify and select in large quantities. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the electrophoresis of the amplified product of the 5th exon of the CCN5 gene of the Small Tail Han sheep; the 5 lanes on the right side of the marker in the figure are samples from different individuals.

[0025] Figure 2 This is the sequencing map of the partial region of exon 5 of the CCN5 gene of the Small-Tail Han sheep; WE5-25-W5R_E02 / F02 / G02 / H02 / A03 / B03 / C03.ab1RC in the figure represents samples from different individuals.

[0026] Figure 3 The sequencing peak diagram of different genotypes of the CCN5 gene (exon 5) of Small Tail Han sheep; among them: A is the CC genotype, B is the GG genotype, and C is the CG genotype. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The embodiments are only used to explain the present invention, but not to limit the scope of protection of the present invention.

[0028] (I) Screening of candidate regions in the sheep genome

[0029] In the present invention, the representative mutton breed Small Tail Han sheep is selected as the experimental subject. In the early stage of the laboratory, the differentially expressed genes in the differentiation process of experimental sheep fat cells were detected by transcriptome sequencing technology. The results showed that the CCN5 gene was related to the fat metabolism of the experimental sheep and could affect the meat quality traits of the experimental sheep, and the latter finding had not been reported before. Subsequent experimental tests found that there was only a potential SNP site in the 5th exon of the CCN5 gene. Therefore, this site was associated with the experimental sheep meat quality data for analysis, attempting to prove that the CCN5 gene has a SNP marker related to the sheep meat quality traits (see the following experimental content for details).

[0030] (II) Sheep sample collection and CCN5 gene exon 5 mutation detection

[0031] 1. Sample Collection

[0032] Blood samples were collected from small-tailed Han sheep raised by Jilin Academy of Agricultural Sciences in Changchun, Jilin Province in October 2021. Blood samples were obtained by sampling blood from the jugular vein, and the collected blood was stored in anticoagulant tubes and stored in a 4°C refrigerator; a total of 96 6-month-old small-tailed Han sheep were collected.

[0033] 2. Mutation Detection Strategy

[0034] Based on the sheep CCN5 gene sequence, specific primers were designed, and then a DNA fragment of the partial region of the 5th exon of the CCN5 gene was cloned by PCR. The DNA fragment was detected using direct sequencing technology to obtain sequence information, and then the mutation of the 5th exon of the CCN5 gene of the sample was determined based on the sheep genome reference sequence.

[0035] 3. Primer Design

[0036] A pair of primers was designed based on the sheep CCN5 gene DNA sequence (gene ID number: XM_027977228.2). The primer sequences are as follows, and the target fragment length is 745 bp:

[0037] CCN5 gene exon5 upstream primer: 5'-AACGGAGGGAAGGACATCAAAT-3'

[0038] CCN5 gene exon5 downstream primer: 5'-AGCGGCTGACATAGAGTTTCCA-3'

[0039] The primers were synthesized by Suzhou Jinweizhi Biological Co., Ltd.

[0040] 4. PCR Amplification

[0041] The genomic DNA was extracted from the blood samples of Small Tail Han sheep and used as a template to determine the optimal experimental temperature using gradient PCR.

[0042] Add the PCR reaction system to a 200 μL PCR centrifuge tube: 10 μL 2×Master Mix, 0.5 μL (10 μmol / L) of upstream primer, 0.5 μL (10 μmol / L) of downstream primer, 1 μL (about 50 ng / μL) of genomic DNA, and make up to 20 μL with ddH2O.

[0043] Place the PCR centrifuge tube in the PCR instrument and set the reaction conditions as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; gradient annealing at 55°C-65°C for 30 s; extension at 72°C for 16 s, and 35 cycles starting from the second step; extension at 72°C for 8 min after the cycle ends; and storage at 4°C.

[0044] Take 5 μL of PCR product and run electrophoresis on 2% agarose gel in 1×TBE for 20 min. Determine the final annealing temperature based on the brightness and clarity of the bands.

[0045] After determining the final annealing temperature, use the full-form gold blood PCR kit, take the collected sheep blood sample as a template, and amplify the target fragment according to the following PCR reaction system:

[0046] 2×Master Mix 10μL, 10μmol / L upstream and downstream primers 0.4μL each, blood volume 1μL, add ddH2O to make up to 20μL.

[0047] The PCR reaction system was prepared on ice and placed in a PCR instrument after being fully mixed. The final PCR reaction conditions were: 94°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 16 s, for a total of 35 cycles; 72°C for 8 min.

[0048] After the reaction, take 5 μL of PCR product and perform electrophoresis on it in 2% agarose gel in 1×TBE. Figure 1 shown.

[0049] 5. Fragment Sequencing and Sequence Analysis

[0050] The product of the 745 bp target fragment amplified by PCR was recovered and then directly subjected to Sanger sequencing.

[0051] See also Figure 2 The sample sequencing results were compared with the reference genome sequence (gene ID number: XM_027977228.2), and a mutation site (position chr.13:7625253) in the 5th exon of the CCN5 gene was determined. A CG mutation occurred, that is, the coding sequence changed from the original GTA to CTA, and a missense mutation was formed (the encoded amino acid valine mutated to leucine). The mutant sequence / wild-type sequence is shown below:

[0052] GACCCCAGTTTTCTGGCTTTGTCGCTCCCCAGCCCCTGGCGTCTCCTGCCCGGAATGGAGCACCGCCTGGGGTCCCTGCTCGACCACCTGCGGCCTGGGCGTGGCCACCCGAGTGTCCAATCAGAACCGTTTCTGCCGCCTGGAGACCCAGCGCCGCCTGTGC(C / G)TACTGGGGCCCTGCCCACCCGCCAGGGGGCCACGGCCCAAGGAGCAGAGCCTTTTAG

[0053] (III) Analysis of sheep CCN5 gene polymorphism

[0054] After Sanger sequencing, two results will appear after alignment. In the overall sequence alignment result ( Figure 2 ) If different genotypes appear, then use Figure 3 The results shown in the figure were checked to clarify the specific sequence (genotype) of the individual. The results showed that the fifth exon of the CCN5 gene produced three genotypes, CC, CG, and GG, in the small-tailed Han sheep population collected. Among them, there were 36 GG genotypes, 12 CC genotypes, and 48 CG genotypes, with G being the dominant allele.

[0055] Further analysis results showed (Table 1) that the mutation site in exon 5 of the CCN5 gene was a SNP site.

[0056] Table 1. Gene frequencies, genotype frequencies and genetic indices of CCN5 gene in Small-tailed Han sheep

[0057]

[0058] (IV) Association analysis between genetic variation of sheep CCN5 gene and meat quality traits

[0059] Meat quality trait data: The pH value, shear force, meat color, water retention rate, tenderness and intramuscular fat content of the longissimus dorsi muscle of the above 96 6-month-old Small Tail Han sheep were tested.

[0060] Genotype data: Genotypes (CC, CG or GG) of the CCN5 gene of the above 96 6-month-old Small-Tail Han sheep.

[0061] Table 2. Results of significance test for meat quality traits of each genotype of CCN5 gene in Small Tail Han sheep

[0062]

[0063] Note: Different letters on the shoulders represent significant differences, which are statistically significant (P<0.05).

[0064] See Table 2. After a joint analysis of the genotypes and actual meat quality traits in the Small Tail Han Sheep population, it was found that the intramuscular fat content of individuals with the CG and CC genotypes in the population was significantly greater than that of individuals with the GG genotype, indicating that the meat tenderness of individuals with the C allele is significantly higher than that of the homozygous wild type (GG) individuals. In addition, the experimental and analytical results show that this SNP site of the CCN5 gene is not significantly correlated with other tested meat quality traits except for the tenderness of the meat.

[0065] Combined with the above association analysis results, it can be inferred that: due to the mutation in the 5th exon of the sheep CCN5 gene producing different amino acids, the conformation of the secondary structure and tertiary structure of the protein changes, and thus different genotypes produce differences in meat quality traits, that is, differences in meat tenderness.

[0066] In summary, the present invention analyzes the genetic polymorphism of the sheep CCN5 gene through Sanger sequencing technology and combines it with meat quality trait data for correlation analysis, revealing the candidate gene related to the tenderness of sheep meat, namely the CCN5 gene, at the molecular level, and can perform early selection of sheep populations with superior meat tenderness based on the polymorphic sites on the CCN5 gene, thereby providing a theoretical basis and scientific basis for the breeding of high-quality sheep. <110> Jilin Academy of Agricultural Sciences <120> A detection method and application of gene polymorphic loci related to sheep meat tenderness <160> 3 <210> 1 <211> twenty two <212> DNA <213> Synthesis <400> 1 aacggaggga aggacatcaa at 22 <210> 2 <211> twenty two <212> DNA <213> Synthesis <400> 2 agcggctgac atagagtttc ca 22 <210> 3 <211> 221 <212> DNA <213> Reference sequence of the region near the SNP site in exon 5 of sheep CCN5 gene <400> 3 gaccccagtt ttctggcttt gtcgctcccc cagcccctgg cgtctcctgc ccggaatgga 60 gcaccgcctg gggtccctgc tcgaccacct gcggcctggg cgtggccacc cgagtgtcca 120 atcagaaccg tttctgccgc ctggagaccc agcgccgcct gtgcgtactg gggccctgcc 180 cacccgccag gggccacggc ccaaggagca gagcctttta g 221

Claims

1. Sheep CCN5 The application of a gene single nucleotide polymorphism detection method in sheep meat quality trait molecular marker assisted selection breeding is characterized by: In the detection method, sheep CCN5 A partial gene fragment, the nucleotide sequence of which is a mutant sequence and / or a wild-type sequence as shown below: Mutant sequence: GACCCCAGTTTTCTGGCTTTGTCGCTCCCCCAGCCCCTGGCGTCTCCTGCCCGGAATGGAGCACCGCCTGGGGTCCCTGCTCGACCACCTGCGGCCTGGGCGTGGCCACCCGAGTGTCCAATCAGAACCGTTTCTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACTGGGGCCCTGCCCACCCGCCAGGGGCCACGGCCCAAGGAGCAGAGCCTTTTAG; wherein the base C at position 165 is a mutant base; Wild type sequence: GACCCCAGTTTTCTGGCTTTGTCGCTCCCCCAGCCCCTGGCGTCTCCTGCCCGGAATGGAGCACCGCCTGGGGTCCCTGCTCGACCACCTGCGGCCTGGGCGTGGCCACCCGAGTGTCCAATCAGAACCGTTTCTGCCGCCTGGAGACCCAGCGCCGCCTGTGCGTACTGGGGCCCTGCCCACCCGCCAGGGGGCCACGGCCCAAGGAGCAGAGCCTTTTAG; The sheep is small-tail Han sheep, and the meat quality trait is the intramuscular fat content.

2. The use according to claim 1, characterized in that: The individuals whose genotype at position 165 is CG or CC are superior in meat quality traits.

Images