A pullulanase PulY103B with detergent resistance and its application

Abstract

The invention discloses a pullulanase PulY103B with detergent resistance, whose amino acid sequence is shown in SEQ ID NO: 1. The pullulanase is type I, has detergent resistance, and can improve the cleaning ability of detergents or detergents. The invention provides a new approach for enhancing the efficiency of detergents, and the pullulanase PulY103B of the invention is simple to prepare and is suitable for industrial production and market promotion applications.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and enzyme engineering, and particularly relates to a pullulanase PulY103B with detergent resistance derived from Bacillus megaterium and an application thereof. Background Art

[0002] Starch is a product of plant photosynthesis. Its structure contains straight-chain starch and amylopectin. As the most primitive energy storage substance, starch is a very important polysaccharide and an indispensable raw material in the food industry. However, since amylopectin in starch contains about 4% to 5% α-1,6-glycosidic bonds, the use of α-amylase (hydrolyzing α-1,4-glycosidic bonds) alone cannot completely hydrolyze starch, which affects the improvement of starch hydrolysis degree.

[0003] Pullulanase is a type of starch debranching enzyme that can specifically hydrolyze the α-1,6-glycosidic bonds in the branch points of glycogen and amylopectin, and cut off the entire side chain of amylopectin to convert it into amylose. According to the different hydrolysis sites, pullulanase can be divided into two types: one is type I pullulanase, which specifically hydrolyzes α-1,6-glycosidic bonds; the other is type II pullulanase, which has the ability to hydrolyze α-1,6-glycosidic bonds and endopolysaccharide α-1,4-glycosidic bonds. Pullulanase is mainly used in the food industry, and also has important applications in the environmental protection, medical and washing industries.

[0004] Because the saccharification reaction process of starch needs to be carried out at a relatively high temperature (50~60℃) and acidic conditions (pH4.5~5.5), the pullulanases reported so far mostly focus on acid and heat resistance, while there are few reports on alkaline pullulanases that have important application value in the detergent industry. Generally speaking, only those pullulanases with alkali stability and detergent resistance can be used in the detergent industry. Among the alkaline-tolerant pullulanases reported so far, there is no enzyme with excellent detergent resistance. Without such characteristics, its activity will be quickly inactivated in the detergent or in the working environment, and its functional characteristics are difficult to be reflected. Therefore, there has been no successful commercialization of pullulanases suitable for detergents. Summary of the invention

[0005] The present invention provides a method for producing a bacterium derived from Bacillus megaterium ( Bacillus megaterium ) Y103 has an alkaline stable pullulanase PulY103B with detergent resistance, whose amino acid sequence is shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 2. The pullulanase is a type I pullulanase.

[0006] The Bacillus megaterium ( Bacillus megaterium) Y103 has been disclosed in non-patent literature before the filing date of this invention, and the applicant guarantees to release the biological material to the public within twenty years from the filing date.

[0007] Another object of the present invention is to use the above-mentioned pullulanase PulY103B with detergent resistance as a detergent additive or a detergent additive. The pullulanase PulY103B has detergent resistance and can improve the decontamination ability of the detergent or the detergent.

[0008] In order to achieve the above-mentioned object of the present invention, the present invention provides the following technical solutions:

[0009] 1. From Bacillus megaterium ( Bacillus megaterium Genomic DNA was extracted from Y103 and used as a template to clone the pullulanase gene using primers Pul-F: GGAATTCCATATGACTGGTGATAATAAGTTTCAGG and Pul-R: CCGCTCGAGCGTTTGAAATAAAATAAGAA. pulY103B , construct the recombinant plasmid PulY103B-PET23b, and construct the recombinant strain Pul Y103B- pET23b- E. coli BL21 (DE3), heterologous expression of the recombinant protein Pul Y103B; protein purification by Ni-IDA affinity chromatography to obtain pullulanase PulY103B;

[0010] 2. Activity analysis of pullulanase PulY103B

[0011] The pullulanase PulY103B of the invention has an optimum reaction pH of 6.5 and an optimum reaction temperature of 40 DEG C. It can exert more than 70% of the enzyme activity at 30 DEG C, has good alkali stability, and exhibits good stability within the pH range of 6.0-8.5. The pullulanase can hydrolyze pullulan, soluble starch, amylopectin, potato starch, wheat starch and sweet potato starch; it has detergent resistance, and Tween 20 with a mass concentration of 10%, Triton X-100 with a mass concentration of 10%, and Tween 80 with a mass concentration of 1% have an obvious promoting effect on the enzyme activity of the pullulanase PulY103B, and the enzyme activity is improved by more than 100%; five commercial detergents, namely Blue Moon, Ariel, Comfort, OMO and Tide, have a promoting effect on the enzyme activity of the pullulanase PulY103B at a concentration of 3.0 g / L.

[0012] Advantages and technical effects of the present invention:

[0013] The invention provides a new pullulanase, which is a type I pullulanase, has detergent resistance, and can improve the cleaning ability of detergents or detergents. The invention provides a new approach to enhance the efficiency of detergents, and the pullulanase PulY103B of the invention is simple to prepare and is suitable for industrial production and market promotion applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a purification diagram of pullulanase PulY103B, where lane M: high molecular weight protein standard; lane 1: lysate; lane 2: electrophoresis pure PulY103B;

[0015] Figure 2 The results of the determination of the optimum pH and pH stability of pullulanase PulY103B, wherein Figure A is the optimum reaction pH; Figure B is the pH stability (◇ is disodium hydrogen phosphate-citric acid buffer; ■ is disodium hydrogen phosphate-sodium dihydrogen phosphate buffer; △ is 3-(N-morpholino)propanesulfonic acid buffer; ● is glycine buffer);

[0016] Figure 3 The optimum temperature and thermal stability of pullulanase PulY103B are determined, where Figure A is the optimum reaction temperature; Figure B is the temperature stability result;

[0017] Figure 4 It is the hydrolysis product of pullulanase PulY103B, wherein Figure A: thin layer chromatogram of pullulan hydrolysis product; Figure B: thin layer chromatogram of soluble starch hydrolysis product; Figure C: thin layer chromatogram of amylopectin hydrolysis product; lane M in the figure: M1-M7 (M1, glucose; M2, maltose; M3, maltotriose; M4, maltotetraose; M5, maltopentaose; M6, maltohexaose; M7, maltoheptaose; IM6, isomaltohexaose);

[0018] Figure 5 The figure is a schematic diagram of the product results of pullulan hydrolysis by pullulanase PulY103B, wherein Figure A is a HPLC chromatogram of maltooligosaccharide standard; Figure B is a HPLC chromatogram of pullulan product;

[0019] Figure 6 This is a diagram of the washing effect of pullulanase PulY103B as a washing enzyme, where A, dirty cloth; B, washing effect with clean water; C, washing effect with Blue Moon laundry detergent; DH, washing effect after adding different amounts of pullulanase PulY103 (0.1, 0.2, 0.3, 0.4, 0.5 U / mL) to Blue Moon laundry detergent. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below by way of examples, but the content of the present invention is not limited thereto. The methods in the present examples are all operated according to conventional methods unless otherwise specified, and the reagents used are all conventional reagents or reagents prepared according to conventional methods unless otherwise specified.

[0021] In the following embodiments, the artificial starch-stained cloth is prepared by referring to the method in the national standard GB / T 13174-2008, and the commercial white cloth is dyed; the dyeing solution is prepared by mixing equal volumes of protein-oil solution and starch solution. The protein-oil solution is an aqueous solution containing 10.0g / L gum arabic, 1% (v / v) carbon ink, 60.0g / L whole milk powder, 10.0g / L whole egg juice (egg white / egg yolk = 3 / 2), and 5% (v / v) soybean oil. The starch solution is an aqueous solution containing 20.0g / L wheat starch. The dyeing solution is evenly applied to the white cloth and dried at 60°C for 4h. Decontamination value ( R )、Decontamination ratio( P )Definition refers to GB / T 13174-2008, decontamination value R=F 2 – F 1 , where F 2 is the whiteness value of the dirty cloth after washing, F 1 It is the whiteness value of unwashed dirty cloth. P= Ra / Ro , where Ra Defined as the removal value with pullulanase detergent added, Ro It is the stain removal value of detergent without pullulanase.

[0022] Example 1: Cloning, expression and preparation of pullulanase PulY103B

[0023] The genomic DNA of Bacillus megaterium Y103 was extracted using the bacterial genome extraction kit (Cat﹟: DP1502) of Biotech Company;

[0024] The upstream and downstream primers Pul-F and Pul-R were designed and synthesized according to the conservative sequence of the pullulanase gene:

[0025] Pul-F: GGAATTCCATATGACTGGTGATAATAAGTTTCAGG;

[0026] Pul-R:CCGCTCGAGCGTTTGAAATAAAATAAGAA;

[0027] PCR amplification was performed using the total DNA of Bacillus megaterium as a template, and the reaction conditions were: pre-denaturation at 95°C for 5 min; 30 cycles of amplification at 94°C for 30 s, 45°C for 30 s, and 72°C for 2 min; and extension at 72°C for 10 min.

[0028] The target fragment was connected to the pET-23b vector and transformed into Escherichia coli by heat shock method. E. coli BL21 (DE3), selected positive clones for sequencing, and obtained a target gene with a full length of 2217 bp, which had a similarity of 97.3% with the pullulanase from Bacillus megaterium P6.

[0029] Take a single BL21 colony containing the recombinant plasmid PulY103B-PET23b, inoculate it into 10mL LB liquid medium containing 50µg / mL ampicillin sodium salt, and culture it at 37℃ with a shaker at 250rpm for 6-7h. Transfer the induced seed liquid to LB liquid medium containing 50µg / mL ampicillin sodium salt at an inoculum of 1%, and culture it at 37℃ with a shaker at 250rpm until the bacterial liquid concentration OD 600 When the growth rate was about 0.8 (logarithmic growth phase), the inducer IPTG was added to make the final concentration reach 0.6mmol / L, and the cells were induced at 16℃ constant temperature shaker at 180rpm for 8 hours.

[0030] The cells in the culture medium were collected by 10000g refrigerated centrifugation for 10 min, and the cell pellet was resuspended in 20mmol, pH 7.4 phosphate buffer containing 10 mmol / L imidazole and 500mmol / L NaCl. The cells were broken by ultrasonication by 10000g refrigerated centrifugation for 10 min, and repeated two to three times. The supernatant was collected by 10000g refrigerated centrifugation for 20 min, which was the crude enzyme solution of pullulanase PulY103B; the activity of pullulanase was determined by DNS method, and SDS-PAGE ( Figure 1 ) The results showed that pullulanase PulY103B was expressed in Escherichia coli; after ultrafiltration concentration and Ni affinity chromatography, the expressed pullulanase was purified 6.82 times and the recovery rate was 53.9%.

[0031] Example 2: Enzymatic properties of pullulanase PulY103B

[0032] 1. Method for determining the activity of pullulanase PulY103B

[0033] The enzyme activity was determined using the 3,5-dinitrosalicylic acid (DNS) method: at pH 6.5 and 40°C, 1.0 mL of the reaction system included 0.5 mL of enzyme solution and 0.5 mL of substrate (1% pullulan), reacted for 10 min, 1.0 mL of DNS was added to terminate the reaction, and the mixture was boiled in boiling water for 10 min; after cooling, the absorbance was measured at 540 nm. Under the above conditions, one pullulanase activity (U) was defined as the amount of enzyme required to produce 1 µmol of glucose per minute.

[0034] 2. Determination of the optimal pH and pH stability of pullulanase PulY103B

[0035] Determination of the optimal pH of pullulanase: Pullulanase PulY103B was reacted with 50 mmol / L of different buffers with pH 5.0-10.0 at 40°C;

[0036] pH stability determination: The enzyme solution was placed in the above buffer, treated at 40°C for 30 min, and then ice-bathed for 30 min. The residual enzyme activity was determined at pH 6.5, with the untreated enzyme solution as the control (as 100%).

[0037] The buffers are: disodium hydrogen phosphate-citric acid buffer (pH 5.0- 6.5), disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 6.0-7.5), 3-(N-morpholino)propanesulfonic acid buffer (pH 6.0-8.0), and glycine buffer (pH 8.0-10.0);

[0038] Results Figure 2 The experimental results showed that the optimum pH of pullulanase PulY103B was 6.5. The enzyme could exert more than 70% of its activity at pH 6.0, and the enzyme showed good stability in the pH range of 6.0-8.5.

[0039] 3. Determination of the optimum temperature and thermal stability of pullulanase PulY103B

[0040] Determination of the optimal temperature: The reaction was carried out at 30-50°C in 3-(N-morpholino)propanesulfonic acid buffer at pH 6.5;

[0041] Determination of enzyme thermal stability: After the enzyme solution was treated at the above temperatures for 30 minutes, the residual enzyme activity was measured at pH 6.5 and 40°C, with the untreated enzyme solution as the control (as 100%); the results are shown in Figure 3 , the figure shows that its optimum temperature is 40℃, and it can exert more than 70% of the enzyme activity at 30℃. The enzyme remains stable below 40℃.

[0042] 4. Effects of different metal ion chemical reagents on PulY103B enzyme activity

[0043] Add 5mmol / L of metal ions or chemical reagents of different concentrations (1%-30%) to the enzymatic reaction system to study their effects on enzyme activity. The enzyme activity was measured at 40℃ and pH 6.5.

[0044] The results are shown in Table 1. The results show that the metal ion Mg 2+ , Ca 2+ , Fe 2+ It has a significant promoting effect on the activity of pullulanase PulY103B, while C O 2+ 、Zn 2+ and Cu 2+ It has a significant inhibitory effect on its enzyme activity.

[0045] Among the chemical reagents, urea (1%), Tween 80 (1%), Tween 20 (10%) and Triton X-100 (10%) had 100% activation effect on the enzyme. Triton X-100 still had 50% activation effect on the enzyme activity at a concentration of 20%. Mercaptoethanol (1%), SDS (1%) and EDTA (10 mM) had a significant inhibitory effect on the enzyme activity.

[0046] Table 1 Effects of different metal ions and compounds on pullulanase PulY103B

[0047]

[0048] a The experimental values ​​were all repeated three times.

[0049] 5. Pullulanase PulY103B substrate specificity experiment

[0050] The enzyme solution was reacted with 1% mass concentration of pullulan, soluble starch, amylopectin, amylose, wheat starch, potato starch, sweet potato starch, glycogen, dextrin and cyclodextrin (α-cyclodextrin, β-cyclodextrin, γ-cyclodextrin) in a water bath at 40°C and pH 6.5. The reaction system was the same as the enzyme activity determination system. The substrate with the highest enzyme activity was taken as 100% to calculate the relative enzyme activity of other substrates. The results are shown in Table 2. The results show that the enzyme cannot hydrolyze substrates such as amylose and glycogen, but has the highest activity in hydrolyzing pullulan. It can effectively hydrolyze soluble starch, amylopectin, wheat starch, potato starch and sweet potato starch, showing a wide range of substrate specificity. Based on its substrate specificity, it can be seen that pullulanase PulY103B is a type I pullulanase.

[0051] Table 2 Substrate specificity of pullulanase PulY103B

[0052]

[0053] a The experimental values ​​were all repeated three times.

[0054] 6. Experiment on the hydrolysis performance of pullulanase PulY103B

[0055] 1.0U / mL enzyme solution was reacted with 1% pullulan, soluble starch and amylopectin at 40℃ and pH6.5, respectively. Samples were taken at 0 min, 15 min, 30 min, 1 h, 2 h and 4 h, respectively. The enzyme solution was inactivated in a boiling water bath for 5 min. Thin layer chromatography and high performance liquid chromatography were used for analysis. The results are shown in Table 1. Figure 4 , 5 The results in the figure show that the main products of pullulan hydrolysis by the enzyme are maltotriose and maltohexaose. PulY103B hydrolyzes soluble starch and amylopectin to maltotetraose as the main product. Its wide substrate specificity combined with the above characteristics indicates that the enzyme is suitable for treating starch stains.

[0056] Example 3: Application of pullulanase PulY103B in Blue Moon detergent

[0057] The dyed dirty cloths were randomly divided into groups, and the control group was washed with tap water. Tap water was added to the Blue Moon detergent to a final concentration of 3.0 g / L, and then different amounts of pullulanase PulY103B were added as the treatment group. The addition amounts of pullulanase PulY103B in each treatment group were 0 U / mL, 0.1 U / mL, 0.2 U / mL, 0.3 U / mL, 0.4 U / mL, and 0.5 U / mL, respectively. The washing conditions were room temperature and rotation and vibration treatment at 150 rpm for 30 min.

[0058] After washing, the dirty cloth was rinsed with tap water and air-dried. The whiteness value was tested with a whiteness meter. The stain removal value and stain removal ratio were used to represent the ability of the detergent to remove stains. The addition of pullulanase can significantly improve the stain removal ability of Blue Moon, and the stain removal effect increases with the amount of pullulanase added. The stain removal value of Blue Moon detergent is 29.02, and the stain removal value of Blue Moon detergent with 0.1U / mL pullulanase added is 33.98, which is 17.09% higher than that of detergent alone; the stain removal values ​​of Blue Moon detergent with pullulanase added at 0.2U / mL and 0.3U / mL are 38.70 and 46.23, respectively, which are 33.36% and 59.30% higher, respectively. When the enzyme addition amount reached 0.4U / mL, the growth rate of the decontamination value of Blue Moon detergent gradually slowed down, and its decontamination ratio also had the same trend of change; the decontamination values ​​of the two groups of Blue Moon detergents with addition amounts of 0.4 / mL and 0.5 / mL were 54.85 and 56.27, and the decontamination ratios were 1.89 and 1.94, respectively; the washing effect was as follows Figure 6 shown.

[0059] Example 4: Application of pullulanase in Unilever Omo

[0060] The washing system control group and experimental group were set up the same as in Example 3, and the washing conditions were the same as in Example 3. The decontamination value of Omo detergent was 31.23; compared with the use of Omo detergent alone, the decontamination value of Omo detergent with 0.1U / mL pullulanase increased by 8.87%. The decontamination values ​​of Omo detergent with addition amounts of 0.2U / mL and 0.3U / mL increased by 15.53% and 21.58% respectively; the decontamination values ​​of Omo detergent with addition amounts of 0.4 / mL and 0.5 / mL increased by 25.90% and 31.86% respectively, and the decontamination ratio was also directly proportional to the amount of pullulanase, which were 1.26 and 1.32 respectively.

[0061] Example 5: Application of pullulanase in Unilever Gold Spinning

[0062] The washing system control group and experimental group were set up the same as in Example 3, and the washing conditions were the same as in Example 3. Compared with the use of gold spinning alone, the addition of pullulanase improved the washing effect of gold spinning. The decontamination value of gold spinning detergent was 31.40. Compared with the use of gold spinning detergent alone, the decontamination value of gold spinning detergent with the addition of 0.1U / mL pullulanase increased by 6.94%. The decontamination values ​​of gold spinning detergents with addition amounts of 0.2U / mL and 0.3U / mL increased by 17.83% and 24.52%, respectively. After the addition amount reached 0.4U / mL, the growth rate of the decontamination value of gold spinning detergent also gradually slowed down, and its decontamination ratio also had the same trend of change. The decontamination values ​​of the two groups of gold spinning detergents with addition amounts of 0.4 / mL and 0.5 / mL were 41.53 and 42.72, respectively, and the decontamination ratios were 1.32 and 1.36, respectively.

[0063] Example 6: Application of pullulanase in P&G Ariel detergent

[0064] The washing system control group and the experimental group are set up in the same way as in Example 3, and the washing conditions are the same as in Example 3. The decontamination value of the single use of Ariel detergent is 37.80. After adding pullulanase, the decontamination ability of Ariel detergent is further improved. The decontamination values ​​of Ariel detergent with 0.1-0.5U / mL pullulanase are increased by 11.56%, 14.47%, 22.62%, 33.28%, and 39.21%, respectively. The decontamination ratio is also proportional to the amount of pullulanase added. The decontamination ratios of the five Ariel experimental groups with pullulanase added are 1.12, 1.14, 1.23, 1.33, and 1.39, respectively. The Ariel detergent with 0.5U / mL pullulanase has the best decontamination ability, and its decontamination value reaches 52.62. With the increase of the amount of pullulanase added, the cost of detergent is also gradually rising, and the improvement of detergent effect is also gradually slowing down.

[0065] Example 7: Application of pullulanase in P&G Tide detergent

[0066] The washing system control group and the experimental group are set up in the same way as in Example 3, and the washing conditions are the same as in Example 3. The addition of pullulanase can significantly improve the decontamination ability of Tide, and the more pullulanase is added, the better the decontamination effect. Compared with the use of Tide detergent alone to treat dirty cloth, the use of pullulanase improves the removal rate of stains, and the decontamination value of Tide detergent with 0.1U / mL pullulanase is increased by about 16%. The decontamination value of the treated cloth in the treatment group with an addition of 0.2U / mL and 0.3U / mL is also significantly improved, which is consistent with the application effect of pullulanase in the other four detergents. After the addition reaches 0.4U / mL, the growth rate of the cleaning effect of Tide and pullulanase combined on the dirty cloth begins to slow down, which has a better washing effect than the addition of 0.3U / mL. The decontamination values ​​of the two groups of Blue Moon detergents with an addition of 0.4 / mL and 0.5 / mL are 50.72 and 52.18 respectively, and the decontamination ratios are 1.38 and 1.42 respectively. Sequence Listing <110> Kunming University of Science and Technology <120> A pullulanase PulY103B with detergent resistance and its application <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 739 <212> PRT <213> Bacillus megaterium Y103 <400> 1 Met Thr Gly Asp Asn Lys Phe Gln Ala Tyr Leu Asp Gln Ile Asp Arg 1 5 10 15 Ile Thr Leu Leu Val Pro Thr Ser Tyr His Glu Gly Gln Ile Asp Phe 20 25 30 Phe Val Ile Lys Ser Thr Gln Met His Gly Thr Ile Ser Ile Glu Asn 35 40 45 Val His Glu Leu Glu Gly Phe Ile Lys Tyr Glu Gly Lys Val Ala Gly 50 55 60 Ser Ile Glu Ile Gly Gln Ser Tyr Val Ile Cys Asp Asn Tyr Gly Glu 65 70 75 80 Lys Val Pro Leu Gln Val Gly Ala Val Ile Arg Thr Lys Glu Phe Asp 85 90 95 Glu Arg Phe Tyr Tyr Asn Gln Asn Asp Leu Gly Ala Ala Phe Tyr Ser 100 105 110 Asp His Ile Met Ile Lys Ile Trp Ala Pro Thr Ala Ser Ala Val Val 115 120 125 Leu Lys Leu Ile His Ala Asn Ser Gly Lys Glu Glu Leu Tyr Val Met 130 135 140 Thr Arg Gln Lys Lys Gly Val Trp Glu Lys Glu Leu Ser Leu Asp Lys 145 150 155 160 Glu Gly Tyr Tyr Tyr Arg Phe Leu Ile Asp Val Asn Gly Arg Thr Asn 165 170 175 Glu Ala Val Asp Pro Tyr Ala Val Ala Ala Thr Ala Asn Ser Glu Tyr 180 185 190 Gly Val Leu Ile Asn Leu His Thr Ala Tyr Val His Leu His Glu Lys 195 200 205 Pro Pro Phe Leu Gln Pro Thr Asp Ala Val Ile Tyr Glu Met His Val 210 215 220 Arg Asp Phe Ser Ile His Pro Ser Ser Gly Ile Glu Lys Lys Gly Thr 225 230 235 240 Tyr Leu Ala Val Ile Glu Ser Ser Gly His Pro Gly Lys Thr Thr Gly 245 250 255 Leu His Tyr Leu Lys Glu Leu Gly Val Thr His Leu Glu Phe Leu Pro 260 265 270 Ile Asn Asp Phe Gly Gly Val Asp Glu Leu Asn Pro His Ala Ser Tyr 275 280 285 Asn Trp Gly Tyr Asn Pro Leu Leu Phe Asn Val Pro Glu Gly Ser Tyr 290 295 300 Ser Ala Asp Pro Ser Asn Pro Ala Thr Arg Ile Ala Glu Val Lys Gln 305 310 315 320 Leu Ile Ser Thr Leu His Gln Gln Gly Phe Arg Val Ile Ile Asp Val 325 330 335 Val Tyr Asn His Val Phe Val Arg Glu Glu Ser Pro Phe Glu Lys Ile 340 345 350 Val Pro Gly Tyr Tyr Phe Arg His Asp Glu Phe Gly Met Pro Ser Asn 355 360 365 Gly Thr Gly Val Gly Asn Asp Phe Ala Ser Glu Arg Lys Met Val Gln 370 375 380 Lys Phe Ile Ile Asp Ser Val Leu Phe Trp Ile Lys Glu Tyr Asp Val 385 390 395 400 Asp Gly Phe Arg Phe Asp Leu Met Gly Ile Leu Asp Ile Glu Thr Met 405 410 415 Asn Ile Ile Arg Glu Lys Ile Asn Glu Ile Asp Ser Thr Ile Leu Ala 420 425 430 Phe Gly Glu Gly Trp Asp Leu Asn Thr Pro Leu Ser Tyr Asn Gln Asn 435 440 445 Ala Ile Met Ala Asn Ala Arg Gln Thr Pro Gln Ile Gly Tyr Phe Asn 450 455 460 Asp Arg Phe Arg Asp Ser Val Lys Gly Ser Thr Phe Asp Val Tyr Glu 465 470 475 480 Lys Gly Phe Ile Ser Gly Asn Ile His Gln Lys Glu Ala Ala Gln Ser 485 490 495 Val Ile Ala Gly Ser Ile Leu Asp Lys Glu Asp Asn Arg Ala Leu Phe 500 505 510 Ile Asn Leu Ala Gln Ser Val Asn Tyr Val Glu Ser His Asp Asn His 515 520 525 Thr Leu Trp Asp Lys Leu Thr Asn Ser Asn Gly Glu Glu Asp Glu Asp 530 535 540 Thr Arg Arg Ser Arg His Arg Leu Ala Thr Ala Ile Val Leu Leu Ser 545 550 555 560 Gln Gly Ile Pro Phe Leu His Ser Gly Gln Glu Phe Tyr Arg Thr Lys 565 570 575 Gln Gly Val Glu Asn Ser Tyr Asn Ser Pro Asp Asp Ile Asn Ala Leu 580 585 590 Asp Trp Asn Arg Arg Ile Lys Phe Ser Arg Asp Val Asn Trp Val Gln 595 600 605 Glu Leu Ile Arg Ile Arg Lys Gln His Gly Ala Phe Arg Leu Gly Asp 610 615 620 Ala Ser Ala Ile Arg Gln His Val Ser Phe Leu Asn Thr Pro Gln Ser 625 630 635 640 Val Ile Gly Tyr Cys Leu Ser Asn Val Leu Ala Tyr Gly Pro Trp Lys 645 650 655 Asn Ile Ile Val Phe Phe Asn Gln Gly Leu Met Glu Glu Lys Ile Val 660 665 670 Leu Pro Glu Gly Pro Trp Lys Ile Ala Leu Asp His Cys Lys Val Tyr 675 680 685 Lys Asn Gly Tyr Pro Thr Ile Glu Asn Asn Ala Ile Asn Val Ser Lys 690,695,700 Leu Ser Val Leu Ile Leu Phe Gln Thr Leu Glu Ile Lys Arg Ala Ser 705,710,715,720 Gln Pro Glu Leu Ala Pro Glu Asp Pro Glu Asp Val Glu His His His 725 730 735 His His His <210> 2 <211> 2217 <212> DNA <213> Bacillus megaterium Y103 <400> 2 atgactggtg ataataagtt tcaggcttat ttagatcaaa tagatcgtat tactctttta 60 gttccaactt cttatcatga aggtcaaatt gatttttttg tgattaaaag tacacaaatg 120 catgggacca tctctattga aaacgtacat gaattagaag gtttatcaa atatgaaggc 180 aaggttgcag gtagcataga aattggacag tcgtacgtta tctgtgataa ttacggggag 240 aaagttccgc tgcaggtagg ggctgttata cgaaccaaag agtttgatga gagattttat 300 tataatcaaa atgatttggg tgcagccttt tattcagatc atattatgat aaaaatttgg 360 gctccaactg catcagcagt ggttttaaaa ttatacatg caatagcgg gaagaggaa 420 ctgtacgtca tgactcgtca aaaaaaaggc gtatgggaa aggactttc cttagataaa 480 gaagggtatt attatcgatt tttaatagat gtaaacggcc ggacaatga agcggtggac 540 ccttatgccg tgcagctac agcaatagt gatacggag tctgataa tcttcataca 600 gcctatgttc atctccatga aaagccgcct ttccttcagc caacggatgc cgttatttac 660 gaaatgcacg ttcgagactt ttctattcat ccttcaagcg ggatagaaaa aaaagtacg 720 tacctagctg ttattgaatc aagcggggcat ccaggcaaa cacaggcct tcattattta 780 aaagagctag gagtgaccca ccttgaattt cttcctatta acgactttgg cggagtagat 840 gattaaatc ctcatgcttc ttatattgg gggtataatc cattgttgtt taatgtacca 900 gaaggaagct actccgctga cccttcaaat cctgccactc gtattgctga agtgaaacaa 960 ttaatatcaa cccttcatca acaggttc cgtgttatta tagagtagt ttaatcac 1020 gtatttgtac gagaagaatc accttttgaa aaattgttc caggctatta ttttcgacat 1080 gatgagtttg ggatgccttc gaacggaacg ggagtaggaa atgattttgc ttctgaacgg 1140 aaaatggtgc aaaagtttat tatcgattca gtattatttt ggataaaaga gtacgatgtt 1200 gatgggtttc gctttgacct catggggatt ttagatatag aaacgatgaa catcattcgg 1260 gaaaaaataa atgaaattga ttctactatt ttggcttttg gcgaaggctg ggatttaaat 1320 actcctctct cctacaatca aaacgcaatt atggcgaatg ctcgccaaac gcctcaaatc 1380 ggctatttta atgaccgctt tcgagattct gtaaaaggaa gcacgtttga tgtgtatgaa 1440 aaaggtttta tcagcggaaa tattcatcaa aaagaggcag cgcaatctgt gatagcgggg 1500 agcattctgg ataaagaaga caaccgggct ttatttataa atctagcaca atcagttaat 1560 tacgttgaat cacatgataa tcatacgctg tgggataagt taacgaattc aaatggagaa 1620 gaagacgaag acactcgtag aagtcgtcac cgccttgcta ctgctattgt gcttctttcg 1680 caaggcatac cgtttcttca tagtggtcaa gagttttacc gcactaaaca aggcgtagag 1740 aacagctata attcacccga tgatattaat gcacttgatt ggaatcgacg gatcaaattt 1800 tctcgtgatg tgaattgggt tcaagagctg attcgtattc gcaaacagca cggtgcattt 1860 cgcttgggag atgcttcagc gattaggcag catgtctctt tcctaaacac gccgcaatcc 1920 gttattggct attgcttatc aaacgtattg gcttacggtc cttggaagaa tattatcgtg 1980 ttttttaatc aaggcctaat ggaagaaaaa atagttttgc cagaaggacc atggaaaata 2040 gcacttgatc attgtaaagt atataaaaat gggtatccta ctatagagaa taatgctata 2100 aacgtttcaa agcttagcgt tcttatttta tttcaaacgc tcgagatcaa acgggctagc 2160 cagccagaac tcgccccgga agaccccgag gatgtcgagc accaccacca ccaccac 2217 <210> 3 <211> 35 <212> DNA <213> Artificial sequence <400> 3 ggaattccat atgactggtg ataataagtt tcagg 35 <210> 4 <211> 29 <212> DNA <213> Artificial sequence <400> 4 ccgctcgagc gtttgaaata aaataagaa 29

Claims

1. A detergent-resistant pullulanase PulY103B, whose amino acid sequence is shown in SEQ ID NO:

1.

2. A gene encoding the pullulanase PulY103B according to claim 1, wherein the nucleotide sequence thereof is shown in SEQ ID NO:

2.

3. Use of the pullulanase PulY103B according to claim 1 as a detergent additive or a detergent additive, characterized in that: Pullulanase PulY103B has detergent resistance and can improve the cleaning ability of detergents or detergents.

Images