Aptamer specifically recognizing aflatoxin M1, screening method and application thereof

Abstract

The present invention relates to an aptamer specifically recognizing aflatoxin M1, a screening method thereof and an application thereof. The specific method of the present invention is as follows: a structured sequence is inserted into the random region in the middle of a three-segment library to form a five-segment library with a stable stem-loop structure. Using the designed five-segment sequence as the initial library, GO-SELEX technology is applied to screen aflatoxin M1. After six rounds of repeated screening and analysis and verification of affinity and specificity tests, two nucleic acid aptamers capable of recognizing aflatoxin M1 are obtained, and both of them have good affinity and specificity. The two nucleic acid aptamers have broad application prospects in accurately, rapidly and sensitively detecting aflatoxin M1 in foods.

Description

Technical Field

[0001] The present invention relates to the field of food safety biotechnology, and particularly to an aptamer specifically recognizing aflatoxin M1, a screening method thereof, and an application thereof. Background Art

[0002] Aflatoxin (AF) is a class of secondary metabolites produced by Aspergillus fungi such as Aspergillus flavus, Aspergillus parasiticus, and Aspergillus nomius, and is widely distributed in nature. Currently, more than 20 kinds of aflatoxins have been discovered, among which six are more studied, namely aflatoxin B1, aflatoxin B2, aflatoxin G1, aflatoxin G2, aflatoxin M1, and aflatoxin M2. Aflatoxin M1 (AFM1) is a hydroxylated derivative of aflatoxin B group (AFB1 and AFB2), and they mainly exist in milk and dairy products, eggs, moldy grains, dried fruits containing oil, and animal muscles, urine, milk, blood, etc. When animals ingest AFB1 in feed, AFM1 will be produced through in vivo circulation metabolism under the action of liver microsomal enzymes in the animals and exist in their muscles, milk, and urine. Aflatoxin M1 has a wide source, is difficult to monitor, and has strong toxicity. Its toxicity is far higher than that of cyanide, arsenide, and organic pesticides, and it is one of the most toxic chemical carcinogens currently recognized. The International Agency for Research on Cancer of the World Health Organization has classified AFB1 and AFM1 as Group 1 carcinogens. Therefore, achieving accurate, rapid, and sensitive detection of aflatoxin M1 in food is of extremely important significance for preventing the infection of aflatoxin M1, ensuring food safety, and protecting human health.

[0003] Currently, the main AFM1 detection methods include thin-layer chromatography (TLC), high-performance liquid chromatography (HPLC), high-performance liquid chromatography-mass spectrometry (HPLC-MS / MS), and immunoassay based on antigen-antibody immune recognition, etc. The operation steps of thin-layer chromatography are relatively cumbersome, with low sensitivity and specificity, and can no longer meet the needs of modern detection. For the commonly used chromatographic analysis methods, the sample pretreatment methods are complex and cumbersome, and require proficient mastery of instrument operation techniques, which is not convenient for promotion at the grass-roots level. Although the immunoassay for detecting mycotoxins has the advantages of high sensitivity and strong specificity, the preparation process of small molecule antigens is cumbersome and time-consuming, costly, there are differences in antibodies between different batches, and the storage and use conditions are harsh, resulting in a high false positive rate and poor repeatability.

[0004] Aptamers are a cluster of small molecule DNA or RNA fragments that specifically bind to target substances, which are screened from in vitro synthesized random oligonucleotide libraries by the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology. Aptamers are similar to antibodies. However, compared with antibodies, aptamers have the advantages of short in vitro synthesis cycle, high temperature resistance, reusable and long-term preservation, low price, easy synthesis and modification. These unique advantages make aptamers have broad application prospects in the fields of disease treatment, drug development, environmental detection and food safety detection. Graphene oxide-SELEX (GO-SELEX) is a convenient and efficient screening method, which realizes the separation of oligonucleotide chains bound to the target from unbound oligonucleotide chains by the rapid adsorption of single-stranded DNA (ssDNA) by graphene oxide. The separation efficiency is a key step affecting the aptamer screening efficiency. In recent years, while paying attention to the efficiency of the separation step, the research also pays more attention to the influence of library complexity on the aptamer screening efficiency. The more complex the structure of the aptamer is, the higher the affinity of its binding to the target is. It is believed that designing the initial library can increase the probability of the appearance of aptamers with complex structures. The commonly used aptamer screening libraries are mostly three-segment type, that is, the middle is a random region and the two ends are fixed base regions. The five-segment library has been proven to be easier to fold into a complex structure than the three-segment library. Therefore, aptamer screening based on the combination of library design and separation technology has become a current research hotspot. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the present invention provides an aptamer that specifically recognizes aflatoxin M1, and its screening method and application. The purpose of the present invention is to provide a molecular biology detection method for small molecule targets of toxins, especially a method for rapidly and accurately detecting aflatoxin M1 by using aptamer technology.

[0006] The purpose of the present invention is achieved by the following technical solutions:

[0007] The first purpose of the present invention is to provide an aptamer that specifically recognizes aflatoxin M1, and the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID No.1 and SEQ ID No.2.

[0008] SEQ ID No.1: cctctctatg ggcagtcggt gatcctaagg gacttttgtc tctctgtgtcttttgccgctatggcagtgt gtagggagaatgaggaaccc agtgcag

[0009] SEQ ID No.2: cctctctatg ggcagtcggt gatttactgatgattttgtc tctctgtgtctttttgaacgtctaccctgc cccaggagaa tgaggaaccc agtgcag

[0010] The second object of the present invention is to provide a single-stranded DNA library for screening aptamers specifically recognizing aflatoxin M1. The single-stranded DNA library is based on 5'-CCTCTCTATGGGCAGTCGGTGAT-N51-GGAGAATGAGGAACCCAGTGC AG-3', and a sequence fragment 5'-TTTTGTCTCTCTGTGTCTTTT-3' capable of forming a stem-loop structure is inserted into the random region of N51 to form a five-segment initial ssDNA library; N51 represents a sequence composed of 51 arbitrary nucleotide bases linked together.

[0011] In one embodiment of the present invention, the structure of the single-stranded DNA library is 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3'; N10 represents a sequence composed of 10 arbitrary nucleotide bases linked together, and N20 represents a sequence composed of 20 arbitrary nucleotide bases linked together.

[0012] The third object of the present invention is to provide the application of the single-stranded DNA library in screening aptamers specifically recognizing aflatoxin M1.

[0013] A method for screening aptamers specifically recognizing aflatoxin M1 includes the following steps:

[0014] (1) Incubating the random single-stranded DNA library with the target

[0015] Add aflatoxin M1 to the random single-stranded DNA library, mix and incubate to allow the random single-stranded DNA library to fully bind to aflatoxin M1 to form an incubation mixture; mix graphene oxide with the incubation mixture, and after incubation, separate the solid and liquid phases and take the supernatant to obtain ssDNA bound to the target.

[0016] (2) PCR amplification

[0017] Use the ssDNA obtained in step (1) as a template for PCR amplification.

[0018] (3) Preparation of single-stranded

[0019] Prepare the amplification product of step (2) into single-stranded DNA to obtain the next round of screening library;

[0020] (4) Multiple rounds of screening

[0021] Replace the random single-stranded DNA library in step (1) with the next round of screening library described in step (3), and repeat multiple rounds of screening according to steps (1)-(3);

[0022] (5) High-throughput sequencing

[0023] After the screening is completed, perform high-throughput sequencing analysis on the screening library obtained in the last round of screening in step (3) to detect the affinity and specificity of the obtained sequence with aflatoxin M1, and obtain an aptamer for specifically recognizing aflatoxin M1.

[0024] In one embodiment of the present invention, in step (4), the multiple rounds of screening increase the screening pressure by reducing the library concentration.

[0025] The fourth object of the present invention is to provide a kit including the aptamer described above.

[0026] The fifth object of the present invention is to provide the application of the kit in detecting aflatoxin M1.

[0027] The sixth object of the present invention is to provide the application of the aptamer in detecting aflatoxin M1.

[0028] In one embodiment of the present invention, a functional group or molecule is connected to the 5' end or 3' end of the nucleic acid aptamer sequence.

[0029] In one embodiment of the present invention, the functional group or molecule is selected from fluorescein, biotin, amino group, mercapto group, digoxin, radioisotope, enzyme label or nano luminescent material.

[0030] The method of the present invention uses a five-segment sequence inserted with a structured fragment as the initial library, screens aflatoxin M1 by GO-SELEX technology, and finally obtains an aptamer with high affinity and high specific binding to the target. The obtained aptamer can be converted into a detection probe by fluorescence group labeling method for detecting aflatoxin M1 in environmental samples and foods, achieving the purpose of rapid and accurate diagnosis.

[0031] The technical solution of the present invention has the following advantages:

[0032] (1) Compared with antibodies, aptamers can be screened in vitro, with a short screening period, convenient synthesis, easy to label various functional groups and reporter molecules, stable properties, and can be stored and used for a long time.

[0033] (2) The screening method of the present invention can significantly improve the screening rate of aptamers. By designing the library to enrich the diversity of sequence structures in the initial library pool, aptamer sequences with good recognition performance can be obtained. The separation efficiency in the screening process is improved by using the separation method introducing graphene oxide material, and the screening period required is shortened.

[0034] (3) This sequence is an aptamer sequence with relatively strong affinity and specificity selected from two aptamer sequences with significant structures and different affinities for binding aflatoxin M1, and can specifically recognize aflatoxin M1 present in the environment and food.

[0035] (4) The present invention uses a five-segment sequence inserted with a structured sequence as the initial library, and screens out oligonucleotide aptamers that can specifically recognize aflatoxin by using the GO-SELEX technology. It has the characteristics of high stability, convenient synthesis, easy labeling of functional groups, etc., and will be widely used in the rapid detection of aflatoxin in food. Description of the Drawings

[0036] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to the specific embodiments of the present invention in combination with the drawings, wherein

[0037] Figure 1 is the schematic diagram of screening aflatoxin M1 nucleic acid aptamer based on the combination of library design and GO-SELEX technology of the present invention;

[0038] Figure 2 is the phylogenetic tree analysis of the first fifty candidate aptamer sequences after screening and sequencing in Example 1 of the present invention;

[0039] Figure 3 is the secondary structure diagram of aptamer 2 and aptamer 9 of aflatoxin M1 in Example 1 of the present invention; wherein Figure 3-(a) is the secondary structure diagram of aptamer 2; Figure 3-(b) is the secondary structure diagram of aptamer 9;

[0040] Figure 4 is the affinity saturation binding curve of aptamer 2 and aptamer 9 of aflatoxin M1 in Example 2 of the present invention;

[0041] Figure 5 is the specificity diagram of aptamer 2 and aptamer 9 of aflatoxin M1 in Example 3 of the present invention. Detailed Embodiments

[0042] The following further illustrates the present invention in combination with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.

[0043] The following is the screening of high-affinity and high-specificity aflatoxin M1 nucleic acid aptamers based on the combination of library design and GO-SELEX technology (as Figure 1 shown) and its application in the rapid detection of aflatoxin M1.

[0044] Example 1

[0045] 1. Design of the initial library

[0046] The initial three-segment sequence is

[0047] 5'-CCTCTCTATGGGCAGTCGGTGAT-N51-GGAGAATGAGGAACCCAGTGC AG-3', where the fixed sequences at both ends of the initial three-segment sequence refer to the literature published by Qu, H. et al. (Qu, H., Csordas, A.T., Wang, J., Oh, S.S., Eisenstein, M.S., and Soh, H.T. (2016). Rapid and Label-Free Strategy toIsolateAptamers forMetal Ions. Acs Nano 10, 7558-7565. 10.1021 / acsnano.6b02558.), and N51 represents a sequence composed of 51 arbitrary nucleotide bases. On the basis of the initial three-segment sequence, the sequence fragment (5'-TTTTGTCTCTCTGTGTCTTTT-3') that can form a stem-loop structure is inserted into the random region of N51 to construct a five-segment initial ssDNA library.

[0048] 2. Synthesis of the random single-stranded DNA library and primers (synthesized by Shanghai Sangon Biotech Co., Ltd.)

[0049] Random single-stranded DNA library:

[0050] 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3'

[0051] 5' upstream primer: 5'-CCTCTCTATGGGCAGTCGGTGAT-3'

[0052] 5' phosphorylated downstream primer: 5'-P-CTGCACTGGGTTCCTCATTCTCC-3'

[0053] Among them, N10 represents a sequence composed of 10 arbitrary nucleotide bases connected together, and N20 represents a sequence composed of 20 arbitrary nucleotide bases connected together. The random single-stranded DNA library and the primer are both prepared into a 100 μM stock solution with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20 °C for later use.

[0054] 3. Screening of Aflatoxin M1 Aptamer

[0055] (1) Incubation of the random ssDNA library with the target: In the first round of screening, the input amount of the random ssDNA library is 1 nmol. The library is heat-denatured at 95 °C for 5 min and then cooled on ice for 10 min. Aflatoxin and the library are mixed at a molar ratio of 1:2 and incubated at 25 °C for 2 h to allow the random ssDNA library to fully bind to aflatoxin M1.

[0056] (2) Separation of the bound and unbound ssDNA: Take graphene oxide with a mass ratio to the library of 300:1, centrifuge at 13000 rpm for 10 min, and remove the supernatant. Transfer the incubation mixture to the graphene oxide precipitate, vortex and sonicate until dissolved, and incubate at 25 °C for 1 h. Centrifuge at 13000 rpm at 4 °C for 15 min, collect the supernatant, and obtain the ssDNA bound to the target.

[0057] (3) PCR amplification: Use the supernatant obtained after the first round of screening as the template for PCR amplification. The PCR system is 1 μL of template, 1 μL each of the upstream and downstream primers with a concentration of 5 μM, 1 μL of dNTP containing Mg 2+ with a concentration of 5 mM, 5 μL of 10×PCR buffer, 0.5 μL of Taq enzyme, and make up to 50 μL with sterile ultrapure water. PCR amplification first undergoes denaturation at 94 °C for 5 min, then denaturation at 94 °C for 30 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s. After cycling with the optimal number of cycles optimized for PCR, extend at 72 °C for 2 min, and finally cool at 4 °C.

[0058] (4) Verification by polyacrylamide gel electrophoresis: The PCR products are electrophoresed on an 8% non-denaturing polyacrylamide gel. The digested products are electrophoresed on an 8% denaturing polyacrylamide gel (containing 7 M urea), imaged using a gel imager, and observe whether the electrophoresis bands are single and bright and whether the bands are at the position of 97 bp.

[0059] (5) Purification and digestion of PCR products: The obtained PCR products were purified using a PCR product purification kit (centrifugal column type) to remove other substances in the PCR reaction system. The purified nucleic acid concentration was measured using a NanoDrop-2000 micro ultraviolet-visible spectrophotometer to determine the approximate digestion time required. Take the purified product, add 1 / 10 volume of digestion buffer and an appropriate amount of exonuclease, mix well, and react at 37 °C until digestion is complete. After digestion, inactivate the enzyme at 75 °C for 10 min to stop the digestion reaction.

[0060] (6) Purification of digested products: Add 1 / 10 volume of 3 mol / L NaAC to the digested products and mix well, then add 2 volumes of absolute ethanol and mix well. Place it in a -20 °C refrigerator to precipitate overnight. The precipitated solution was centrifuged at 14000 rpm for 15 min at 4 °C. After discarding the supernatant, add 200 μL of 70% ethanol to the system, mix well, and centrifuge at 14000 rpm for 15 min at 4 °C, then discard the supernatant. Place it in a 50 °C oven for drying, and add 50 μL of 1×TE buffer to dissolve it as the library for the next round of screening.

[0061] As the number of screening rounds increases, the screening pressure is gradually increased to obtain aptamer sequences with good affinity and specificity. Except for the library addition amount in the first round of screening being 1 nmol, starting from the second round of screening, as the number of screening rounds increases, the library addition amount gradually decreases by 20 pmol.

[0062] 4. Cloning and sequencing

[0063] The PCR amplification products of the ssDNA aptamers obtained from the sixth round of screening were sent to Shanghai Sangon Biotech Co., Ltd. for high-throughput sequencing, and approximately 60,000 aptamer sequences were obtained. The MEGA11 software was used to analyze the homology information of the first fifty sequences. The phylogenetic tree analysis diagram of the first fifty candidate aptamer sequences is as Figure 2 shown. The M-fold online website was used to simulate the secondary structure of the candidate aptamer sequences. Combining the sequence occurrence frequency, family homology, secondary structure, number of bases, and Gibbs free energy △G, two sequences with stable structures and lower free energies were selected. The aptamers labeled with FAM at the 5' end were synthesized by Shanghai Sangon Biotech Co., Ltd., and these two aptamer strands were named aptamer 2 (△G = -11.41 kcal / mol) and aptamer 9 (△G = -11.30 kcal / mol) for affinity and specificity analysis. The secondary simulated structures of aptamer 2 and aptamer 9 are shown in Figure 3-(a) and Figure 3-(b).

[0064] Example 2 Aptamer affinity analysis

[0065] The aptamers 2 and 9 were each prepared into a 100 μM solution with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20 °C for later use. A series of aptamer solutions with a fluorescent group (FAM) at different concentration gradients (25 nM, 50 nM, 100 nM, 150 nM, 200 nM) were incubated with 2 μM aflatoxin M1 at 25 °C for 1 h. Then, graphene oxide solution (1 mg / mL) was added, and the mass ratio of graphene oxide solution to library single-stranded DNA was 100:1. The mixture was incubated at 25 °C for 30 min and mixed evenly. The mixture was transferred to a black microplate to measure the fluorescence polarization value, denoted as FP1. The mixed system without the target was used as a blank control, and its fluorescence polarization value was recorded as FP0. The experiment was repeated three times. Using GraphPad Prism 8.0 software, with the aptamer concentration as the abscissa and △FP (△FP = FP1 - FP0) as the ordinate, its saturation binding curve was plotted (as Figure 4 shown). From Figure 4 the results, the dissociation constant Kd values of aptamer 2 and aptamer 9 were 135.7 nM and 109.1 nM, respectively. The dissociation constants (Kd values) of aptamer 2 and aptamer 9 for aflatoxin M1 were both at the nanomolar level, showing good affinity. The smaller the Kd value, the better the affinity. The Kd value of aptamer 9 was smaller than that of aptamer 2, indicating that aptamer 9 had a better affinity for aflatoxin M1.

[0066] Example 3 Specificity analysis of aptamers

[0067] The specificities of aptamer 2 and aptamer 9 were analyzed. The steps were as follows: 50 nM aptamer solutions with a fluorescent group were respectively mixed with aflatoxin M1, zearalenone (ZEN), ochratoxin (OTA), T2 toxin (T2), and deoxynivalenol (DON), and incubated at 25 °C for 1 h. Then, an appropriate volume of GO solution (1 mg / mL) was added to the system, vortexed and mixed evenly, and placed in a black microplate to measure the fluorescence polarization value, denoted as FP2. The mixed system without the target was used as a blank control, and its fluorescence polarization value was recorded as FP0. The experiment was repeated three times. Using different candidate aptamers as the abscissa and relative fluorescence polarization (△FP / △FPm) as the ordinate, the specificity curve of the candidate aptamers was plotted (as Figure 5 shown), where △FP is the fluorescence polarization difference measured among the positive screening target, reverse screening substances, and the blank group, and △FPm is the value with the largest fluorescence polarization difference from the blank group among the positive screening targets. From Figure 5The results showed that the binding rates of aptamer 2 with aptamer 9 and aflatoxin M1 were between 85% and 95%, while the binding rates with the reverse screening substances ZEN, OTA, T2, and DON were all less than 35%. Among them, the binding rates of aptamer 2 with the reverse screening substances ZEN, OTA, T2, and DON were 33%, 34%, 6%, and 15% respectively. The binding rates of aptamer 9 with the reverse screening substances ZEN, OTA, T2, and DON were 30%, 14%, 7.8%, and 8.8% respectively. The binding rates of aptamer 2 and aptamer 9 with aflatoxin M1 were both above 85%, indicating that both aptamers had strong binding ability with aflatoxin M1.

[0068] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention. SEQUENCE LISTING <110> Jiangnan University <120> Aptamer Specific for Aflatoxin M1, Its Screening Method and Application <130> 2 <160> 2 <170> PatentIn version 3.3 <210> 1 <211> 97 <212> DNA <213> (Synthetic) <400> 1 cctctctatg ggcagtcggt gatcctaagg gacttttgtc tctctgtgtc ttttgccgct 60 atggcagtgt gtagggagaa tgaggaaccc agtgcag 97 <210> 2 <211> 97 <212> DNA <213> (Synthetic) <400> 2 cctctctatg ggcagtcggt gatttactga tgattttgtc tctctgtgtc tttttgaacg 60 tctaccctgc cccaggagaa tgaggaaccc agtgcag 97

Claims

1. An aptamer that specifically recognizes aflatoxin M1, characterized in that, The nucleotide sequences of the aptamers are shown in SEQ ID No.1 and SEQ ID No.

2.

2. Screen the single-stranded DNA library of aptamers for specifically recognizing aflatoxin M1, characterized in that, The structure of the single-stranded DNA library is 5'-CCTCTCTATGGGCAGTCGGTGAT-N10-TTTTGTCTCTCTGTGTCTTTT-N20-GGAGAATGAGGAACCCAGTGCAG-3'; N10 represents a sequence composed of 10 arbitrary nucleobases linked together, and N20 represents a sequence composed of 20 arbitrary nucleobases linked together.

3. Use of the single-stranded DNA library according to claim 2 in screening for aptamers for specifically recognizing aflatoxin M1.

4. A kit, characterized in that, Comprising the aptamer according to claim 1.

5. Use of the aptamer according to claim 1 or the kit according to claim 4 in detecting aflatoxin M1 in food.

6. The application according to claim 5, wherein A functional group or molecule is linked to the 5'-end or 3'-end of the aptamer sequence.

7. The application according to claim 6, wherein The functional group or molecule is selected from fluorescein, biotin, amino group, mercapto group, digoxin, radioisotope, enzyme label or nano-luminescent material.

Images