Gene locus related to watermelon leaf yellowing trait and molecular marker, primer pair and application developed based on the gene locus

Abstract

The application belongs to the technical field of molecular markers, and discloses an InDel gene locus related to a watermelon leaf yellowing trait, wherein the InDel gene locus has five, namely InDel-6010, InDel-6030, InDel-6040, InDel-6050 and InDel-6060; a watermelon leaf yellowing homozygous single plant shows deletion of the InDel gene sequence. The InDel molecular marker developed in the application can be used for initial screening of varieties, the detection method is correct and reliable, the purpose of molecular marker assisted breeding is achieved, the breeding period can be greatly shortened, and the application has important theoretical and practical significance.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and relates to a gene locus related to a watermelon leaf yellowing trait, a molecular marker based on the gene locus, a primer pair and application. BACKGROUND

[0002] As an important cucurbitaceae crop, watermelon (Citrullus lanatus) is an important fruit for people to quench thirst in summer and occupies a very important position in the world horticultural crops. China is the world's largest producer and consumer of watermelon, and in production and cultivation, leaf color often mutates, showing white, yellow-green, delayed greening, mottling, and other phenotypes. Leaf color mutants are ideal materials for studying photosynthesis, chlorophyll synthesis, and chloroplast development, and are also important research materials in genetics and breeding.

[0003] In traditional selection breeding, because it is difficult to determine the genotype of offspring, the basis for selection is usually the phenotype of plants rather than the genotype, the selection time is long, and the phenotype is easily affected by environmental factors, leading to inaccurate selection and low efficiency. Molecular marker-assisted breeding uses molecular markers closely linked to target traits as tools to screen target traits, and uses genotypes to screen germplasm resources through molecular markers, which has the advantages of accuracy, speed, and no interference from environmental conditions, avoiding the blindness of trait selection in traditional breeding process and improving breeding efficiency. InDel markers are a kind of molecular markers that analyze amplification products, and have the characteristics of high throughput, simplicity, stability, and high sensitivity, which are the most promising molecular markers in current molecular marker-assisted breeding.

[0004] Watermelon leaf yellowing trait is the most ideal marker trait for identifying the purity of watermelon hybrid seeds at the seedling stage. The leaves of watermelon plants with yellowing trait are yellow throughout the growth period, while the leaves of normal green plants are green throughout the growth period. Therefore, yellowing is significantly different from normal green seedlings or plants, and the earliest identification period is cotyledon emergence, which is 5-8 days after sowing. By identifying the yellowing gene and developing a closely linked molecular marker for initial screening of varieties, the purpose of molecular-assisted breeding can be achieved, which can greatly shorten the breeding cycle and improve the breeding efficiency.

[0005] Watermelon leaf yellowing trait can accurately identify hybrids at the seedling stage, and has the advantages of accuracy, intuition, simplicity, speed, and low cost. However, this trait is recessive and does not appear in the first hybrid generation, which brings great difficulty to breeding. Leaf color is an important agronomic trait of watermelon and is closely related to the photosynthetic capacity of watermelon plants, so it is urgent to conduct in-depth research on watermelon leaf color and develop molecular markers for watermelon breeding to shorten the breeding process and improve breeding efficiency. SUMMARY

[0006] The application aims to provide a gene locus related to the leaf yellowing trait of watermelon, a molecular marker, a primer pair and an application developed based on the gene locus, which can be used for initial screening of watermelon varieties, the detection method is correct and reliable, and the breeding cycle can be greatly shortened.

[0007] To achieve the above-mentioned purpose, the application adopts the following technical solutions:

[0008] The application provides an InDel gene locus related to the leaf yellowing trait of watermelon, and the InDel gene locus comprises five InDel-6010, InDel-6030, InDel-6040, InDel-6050 and InDel-6060.

[0009] The InDel-6010 gene locus is located at the base at 14376440-14376782bp of the 2nd chromosome of the watermelon reference genome 97103V2 version, the length of the InDel-6010 gene sequence is 343bp, and the watermelon leaf yellowing homozygous single plant shows the deletion of the InDel-6010 gene sequence.

[0010] The InDel-6030 gene locus is located at the base at 14494608-14497114bp of the 2nd chromosome of the watermelon reference genome 97103V2 version, the length of the InDel-6030 gene sequence is 2507bp, and the watermelon leaf yellowing homozygous single plant shows the deletion of the InDel-6030 gene sequence.

[0011] The InDel-6040 gene locus is located at the base at 14549766-14550425bp of the 2nd chromosome of the watermelon reference genome 97103V2 version, the length of the InDel-6040 gene sequence is 660bp, and the watermelon leaf yellowing homozygous single plant shows the deletion of the InDel-6040 gene sequence.

[0012] The InDel-6050 gene locus is located at the base at 14550627-14551935bp of the 2nd chromosome of the watermelon reference genome 97103V2 version, the length of the InDel-6050 gene sequence is 1309bp, and the watermelon leaf yellowing homozygous single plant shows the deletion of the InDel-6050 gene sequence.

[0013] The InDel-6060 gene site is located at the base at 14670694-14671707 bp of the 2nd chromosome of the watermelon reference genome 97103V2 version, the InDel-6060 gene sequence length is 1014 bp, and the watermelon leaf yellowing homozygous single plant shows the deletion of the InDel-6060 gene sequence.

[0014] The application also provides a primer pair of the InDel molecular marker developed based on the above-mentioned InDel gene site, and the InDel molecular marker is InDel-6010 molecular marker, InDel-6030 molecular marker, InDel-6040 molecular marker, InDel-6050 molecular marker and InDel-6060 molecular marker, the forward primer sequence of the primer pair for amplifying the InDel-6010 molecular marker is shown in SEQ ID NO. 2, and the reverse primer sequence is shown in SEQ ID NO. 3; the forward primer sequence of the primer pair for amplifying the InDel-6030 molecular marker is shown in SEQ ID NO. 5, and the reverse primer sequence is shown in SEQ ID NO. 6; the forward primer sequence of the primer pair for amplifying the InDel-6040 molecular marker is shown in SEQ ID NO. 8, and the reverse primer sequence is shown in SEQ ID NO. 9; the forward primer sequence of the primer pair for amplifying the InDel-6050 molecular marker is shown in SEQ ID NO. 11, and the reverse primer sequence is shown in SEQ ID NO. 12; and the forward primer sequence of the primer pair for amplifying the InDel-6060 molecular marker is shown in SEQ ID NO. 14, and the reverse primer sequence is shown in SEQ ID NO. 15.

[0015] The application also provides application of the above-mentioned primer pair in identifying whether the watermelon leaf color is yellow.

[0016] The application also provides application of the above-mentioned primer pair in molecular marker assisted breeding of whether the watermelon leaf color is yellow.

[0017] The application also provides a method for identifying whether the watermelon leaf color is yellow by using the above-mentioned primer pair, comprising the following steps: extracting the genomic DNA of a watermelon sample to be tested; performing PCR amplification on the watermelon genomic DNA by using the primer pair; judging the allelic genotype of the watermelon leaf yellowing trait according to the electrophoretic band of the PCR amplification product, if there is no band, the watermelon is a yellowing homozygous single plant, and if there is one band, the watermelon is a normal green homozygous single plant or a normal green heterozygous single plant.

[0018] The application also provides a kit containing the primer pair for amplifying the InDel molecular marker related to the watermelon leaf yellowing trait.

[0019] Compared with the prior art, the application has the beneficial effects that:

[0020] The application identifies the leaf yellowing of F2 population, BC1 separation population and natural population, finds that the InDel site starts from the interval of 11890000-18670000 bp of the 2nd chromosome of the 97103V2 version of the watermelon reference genome, and develops 5 InDel molecular markers related to the watermelon leaf yellowing trait; the specific InDel molecular marker designed by the application can be used for initial screening of varieties, the detection method is correct and reliable, the purpose of molecular marker assisted breeding is achieved, the breeding period can be greatly shortened, and the application has important theoretical and practical significance. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The application InDel-6010 molecular marker electrophoretogram of PCR amplification products of F2 separation population.

[0022] Figure 2 The application InDel-6030 molecular marker electrophoretogram of PCR amplification products of F2 separation population.

[0023] Figure 3 The application InDel-6040 molecular marker electrophoretogram of PCR amplification products of F2 separation population.

[0024] Figure 4 The application InDel-6050 molecular marker electrophoretogram of PCR amplification products of F2 separation population.

[0025] Figure 5 The application InDel-6060 molecular marker electrophoretogram of PCR amplification products of F2 separation population.

[0026] Figure 6 The application InDel-6010 molecular marker electrophoretogram of PCR amplification products of natural population.

[0027] Figure 7 The application InDel-6030 molecular marker electrophoretogram of PCR amplification products of natural population.

[0028] Figure 8 The application InDel-6040 molecular marker electrophoretogram of PCR amplification products of natural population.

[0029] Figure 9 The application InDel-6050 molecular marker electrophoretogram of PCR amplification products of natural population.

[0030] Figure 10This is an electrophoresis diagram of the PCR amplification products of the InDel-6060 molecular marker of the present invention on a natural population. Detailed Implementation

[0031] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of protection of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the test methods in the following embodiments are conventional methods.

[0032] Example 1

[0033] 1) Selected watermelon materials for testing included paternal parents, maternal parents, F1 generation, F2 population, BC1 population, and natural population. The paternal parent was ZK, a watermelon with normal green leaves; the maternal parent was w-yl, a watermelon with yellow leaves, whose leaves remained yellow throughout its growth period; the F1 generation consisted of watermelon materials obtained by crossing the paternal and maternal parents; the F2 population consisted of watermelon materials obtained by self-pollination of the F1 generation; the BC1 population consisted of watermelon materials obtained by crossing the F1 generation with the maternal parent; and the natural population consisted of watermelon materials randomly selected from the resource bank, including watermelon materials with yellow leaves and watermelon materials with normal green leaves, totaling 38 materials, as shown in Table 1. All the above-mentioned test materials were germplasm resources preserved by the Diploid Watermelon Research Group of the Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences.

[0034] Table 1. Watermelon varieties and phenotypes selected from natural populations

[0035]

[0036] 2) Determination of the yellowing trait of the test material leaves.

[0037] The yellowing of leaves in watermelon plants was identified using direct observation. The yellowing trait in watermelon leaves is characterized by yellowing of both new cotyledons and leaves, whereas in normal green plants, both cotyledons and leaves remain green. Therefore, yellowing leaves are clearly distinguishable from those of normal green seedlings and plants.

[0038] The leaf yellowing traits of normal green parent ZK (male parent), yellowing parent (female parent), F1 population, 1834 F2 separation population and 233 BC1 separation population were identified. The results showed that the leaf yellowing traits of the male parent, yellowing parent and F1 were normal green, yellowing and normal green, respectively. The F1 plants were selfed to obtain F2 population, and the leaf yellowing trait identification results showed that among 634 single plants, 480 single plants had normal green leaves and 154 plants showed leaf yellowing, chi-square test x2=0.17, P=0.68, the difference was not significant, which was consistent with the theoretical separation ratio of 3:1. Through the identification of the yellowing traits of the BC1 population, it was found that among 70 single plants, 32 single plants had normal green leaves and 38 plants showed leaf yellowing, chi-square test x2=0.51, P=0.47, the difference was not significant, which was consistent with the theoretical separation ratio of 1:1. Based on the above identification results of the yellowing traits of the parents, F1, 634 F2 separation population and 70 BC1 separation population, it was concluded that the watermelon leaf yellowing gene was a single gene controlled recessive trait.

[0039] 3) Acquisition of candidate InDel gene site.

[0040] The plants with normal green leaves and yellow leaves in the F2 population were constructed into extreme pools for genome sequencing, and the target gene interval was preliminarily located and the candidate InDel gene site was obtained by analyzing the difference in allele frequency; the target interval was located in a 6.78 Mb interval of 11890000-18670000 bp on chromosome 2 of watermelon reference genome 97103V2 version.

[0041] 4) Acquisition of InDel molecular marker

[0042] Using the watermelon reference genome 97103V2 version data published at http: / / cucurbitgenomics.org / , InDel molecular markers were designed for the candidate InDel site, and the candidate InDel gene site was verified in the male parent, female parent, F1 generation and F2 population, and finally 5 InDel molecular markers linked to the watermelon leaf yellowing gene wyl were obtained, which were InDel-6010 molecular marker, InDel-6030 molecular marker, InDel-6040 molecular marker, InDel-6050 molecular marker and InDel-6060 molecular marker.

[0043] The InDel-6010 gene locus linked with the InDel-6010 molecular marker is located at the base of 14376440-14376782 bp of chromosome 2 of the watermelon reference genome 97103V2 version, the InDel-6010 gene sequence length is 343 bp (as shown in SEQ ID NO. 1), and the homozygous single plant of watermelon leaf yellowing shows deletion of the InDel-6010 gene sequence;

[0044] The InDel-6010 gene locus linked with the InDel-6030 molecular marker is located at the base of 14494608-14497114 bp of chromosome 2 of the watermelon reference genome 97103V2 version, the InDel-6030 gene sequence length is 2507 bp (as shown in SEQ ID NO. 4), and the homozygous single plant of watermelon leaf yellowing shows deletion of the InDel-6030 gene sequence.

[0045] The InDel-6010 gene locus linked with the InDel-6040 molecular marker is located at the base of 14549766-14550425 bp of chromosome 2 of the watermelon reference genome 97103V2 version, the InDel-6040 gene sequence length is 660 bp (as shown in SEQ ID NO. 7), and the homozygous single plant of watermelon leaf yellowing shows deletion of the InDel-6040 gene sequence.

[0046] The InDel-6010 gene locus linked with the InDel-6050 molecular marker is located at the base of 14550627-14551935 bp of chromosome 2 of the watermelon reference genome 97103V2 version, the InDel-6050 gene sequence length is 1309 bp (as shown in SEQ ID NO. 10), and the homozygous single plant of watermelon leaf yellowing shows deletion of the InDel-6050 gene sequence.

[0047] The InDel-6010 gene locus linked with the InDel-6060 molecular marker is located at the base of 14670694-14671707 bp of chromosome 2 of the watermelon reference genome 97103V2 version, the InDel-6060 gene sequence length is 1014 bp (as shown in SEQ ID NO. 13), and the homozygous single plant of watermelon leaf yellowing shows deletion of the InDel-6060 gene sequence.

[0048] 5) Perform PCR amplification reaction on the genomic DNA of the paternal parent, the maternal parent, the F1 generation and the F2 population respectively to obtain the respective PCR amplification products.

[0049] The sequence of the InDel-6010 molecular marker amplification primer pair is as follows:

[0050] wyl-F, i.e. forward primer: 5'-ATGTCCTCAACTTATCCTTGT-3' (SEQ ID NO. 2);

[0051] wyl-R, i.e. reverse primer: 5'-TTAGTGTCGCTGCTTTCTGTC-3' (SEQ ID NO. 3).

[0052] The sequence of the amplification primer pair of the InDel-6030 molecular marker is as follows:

[0053] wyl-F, i.e. forward primer: 5'-ATGGGCGATTGCAGGCCATTG-3' (SEQ ID NO. 5);

[0054] wyl-R, i.e. reverse primer: 5'-TTAGGCAGGAAAACGATCTTC-3' (SEQ ID NO. 6).

[0055] The sequence of the amplification primer pair of the InDel-6040 molecular marker is as follows:

[0056] wyl-F, i.e. forward primer: 5'-ATGGAAGGGGAAATCGAGAGC-3' (SEQ ID NO. 8);

[0057] wyl-R, i.e. reverse primer: 5'-CTACTGACGAGAGAGGGGGAAT-3' (SEQ ID NO. 9).

[0058] The sequence of the amplification primer pair of the InDel-6050 molecular marker is as follows:

[0059] wyl-F, i.e. forward primer: 5'-ATGGGTGTCGACTACTATCGA-3' (SEQ ID NO. 11);

[0060] wyl-R, i.e. reverse primer: 5'-TCAAGCCTGGCCTAAGAGCTTC-3' (SEQ ID NO. 12).

[0061] The sequence of the amplification primer pair of the InDel-6060 molecular marker is as follows:

[0062] wyl-F, i.e. forward primer: 5'-ATGTTCCATACTAATGGATTC-3' (SEQ ID NO. 14);

[0063] wyl-R, i.e. reverse primer: 5'-TCATACCAATAAAATCACTTC-3' (SEQ ID NO. 15).

[0064] The reaction procedure in PCR amplification reaction was as follows: pre-denaturation at 94℃ for 5 min, 30 cycles of 94℃ for 30 s, 58℃ for 30 s / kb, 72℃ for 30 s, and extension at 72℃ for 5 min, and keeping at 4℃.

[0065] In PCR amplification reaction, the PCR amplification reaction system was 20 μL, including 10 μL 2×Taq PCR Master Mix, 2 μL template DNA, 1 μL of forward and reverse primers, and 6 μL ddH2O.

[0066] Polymorphism detection was performed by agarose gel electrophoresis, and the gel imaging system was photographed.

[0067] Figure 1 Figure 2 is an electrophoretogram of PCR amplification products of F2 separation population for InDel-6010 molecular marker, in which lane 1 is a molecular weight marker, lane 2 is a PCR product of yellowing parent, lane 3 is a PCR product of green parent, lane 4 is a PCR product of F1 generation, and other lanes are PCR products of partial strains (33 strains) of F2 separation population. The allelic genotypes of watermelon leaf yellowing traits are judged according to the band type of PCR products, as shown in the figure, the electrophoretic result of watermelon yellowing homozygous single plant has no band, and the electrophoretic result of watermelon normal green homozygous single plant or watermelon normal green heterozygous single plant shows a 343 bp band. The results show that the leaf yellowing identification results and the marker detection results are co-segregated. Figure 1

[0068] Figure 2 Figure 3 is an electrophoretogram of PCR amplification products of F2 separation population for InDel-6030 molecular marker, in which lane 1 is a molecular weight marker, lane 2 is a PCR product of yellowing parent, lane 3 is a PCR product of green parent, lane 4 is a PCR product of F1 generation, and other lanes are PCR products of partial strains (33 strains) of F2 separation population. The allelic genotypes of watermelon leaf yellowing traits are judged according to the band type of PCR products, as shown in the figure, the electrophoretic result of watermelon yellowing homozygous single plant has no band, and the electrophoretic result of watermelon normal green homozygous single plant or watermelon normal green heterozygous single plant shows a 2507 bp band. The results show that the leaf yellowing identification results and the marker detection results are co-segregated. Figure 2

[0069] Figure 3 ​​This is an electrophoresis diagram of PCR amplification products of the InDel-6040 molecular marker against the F2 segregating population. Lane 1 represents the molecular weight marker, lane 2 represents the PCR product of the yellowing parent, lane 3 represents the PCR product of the green parent, lane 4 represents the PCR product of the F1 generation, and the other lanes represent PCR products from some lines (33 plants) of the F2 segregating population. The alleles of the yellowing trait in watermelon leaves were determined based on the banding patterns of the PCR products. Figure 2 As shown, the electrophoresis results of homozygous yellowing watermelon plants showed no bands, while the electrophoresis results of homozygous normal green watermelon plants or heterozygous normal green watermelon plants showed a 660 bp band. The results indicate that the leaf yellowing identification results and the labeling detection results cosegregated.

[0070] Figure 4 This is an electrophoresis diagram of PCR amplification products of the InDel-6050 molecular marker in the F2 segregating population. Lane 1 represents the molecular weight marker, lane 2 represents the PCR product of the yellowing parent, lane 3 represents the PCR product of the green parent, lane 4 represents the PCR product of the F1 generation, and the other lanes represent PCR products from some lines (33 plants) of the F2 segregating population. The alleles of the yellowing trait in watermelon leaves were determined based on the banding patterns of the PCR products. Figure 2 As shown, the electrophoresis results of homozygous yellowing watermelon plants showed no bands, while the electrophoresis results of homozygous normal green watermelon plants or heterozygous normal green watermelon plants showed a 1309 bp band. The results indicate that the leaf yellowing identification results and the labeling detection results cosegregated.

[0071] Figure 5 This is an electrophoresis diagram of PCR amplification products of the InDel-6060 molecular marker in the F2 segregating population. Lane 1 represents the molecular weight marker, lane 2 represents the PCR product of the etiolated parent, lane 3 represents the PCR product of the green parent, lane 4 represents the PCR product of the F1 generation, and the other lanes represent PCR products from some lines (33 plants) of the F2 segregating population. The alleles of the etiolation trait in watermelon leaves were determined based on the banding patterns of the PCR products, such as... Figure 2 As shown, the electrophoresis results of homozygous yellowing watermelon plants showed no bands, while the electrophoresis results of homozygous normal green watermelon plants or heterozygous normal green watermelon plants showed a 1014 bp band. The results indicate that the leaf yellowing identification results and the labeling detection results cosegregated.

[0072] 6) Validation of natural populations using InDel molecular markers

[0073] The linkage between the InDel molecular marker and the watermelon leaf yellowing gene wyl was further verified using a natural population. PCR amplification was performed using genomic DNA from the natural population as a template to obtain PCR-specific fragments; these fragments were then detected by electrophoresis. The specific procedures were the same as in step 5).

[0074] Figure 6 The electrophoretogram of PCR amplification products of the natural population for InDel-6010 molecular marker, lane 1 is molecular weight Marker, lane 2 is the PCR product of yellow parent, lane 3 is the PCR product of green parent, lane 4 is the PCR product of F1 generation, and other lanes are 36 natural population materials.

[0075] Figure 7 The electrophoretogram of PCR amplification products of the natural population for InDel-6030 molecular marker, lane 1 is molecular weight Marker, lane 2 is the PCR product of yellow parent, lane 3 is the PCR product of green parent, lane 4 is the PCR product of F1 generation, and other lanes are 36 natural population materials.

[0076] Figure 8 The electrophoretogram of PCR amplification products of the natural population for InDel-6040 molecular marker, lane 1 is molecular weight Marker, lane 2 is the PCR product of yellow parent, lane 3 is the PCR product of green parent, lane 4 is the PCR product of F1 generation, and other lanes are 36 natural population materials.

[0077] Figure 9 The electrophoretogram of PCR amplification products of the natural population for InDel-6050 molecular marker, lane 1 is molecular weight Marker, lane 2 is the PCR product of yellow parent, lane 3 is the PCR product of green parent, lane 4 is the PCR product of F1 generation, and other lanes are 36 natural population materials.

[0078] Figure 10 The electrophoretogram of PCR amplification products of the natural population for InDel-6060 molecular marker, lane 1 is molecular weight Marker, lane 2 is the PCR product of yellow parent, lane 3 is the PCR product of green parent, lane 4 is the PCR product of F1 generation, and other lanes are 36 natural population materials.

[0079] The results show that the marker detection of 36 natural population materials is consistent with the identification of leaf yellowing, and the coincidence rate of 5 InDel molecular markers for resource identification is 100%. Further confirm that the designed 5 InDel molecular markers are closely linked with the watermelon leaf yellowing gene wyl; it is explained that the InDel site and the 5 InDel molecular markers designed by the InDel site have very high utilization value in identifying watermelon leaf yellowing traits, and can be effectively used in watermelon molecular assisted breeding.

[0080] The above-described embodiments are only preferred embodiments of the present application, merely used to explain the present application, and not intended to limit the scope of the present application. For those skilled in the art, other embodiments can be easily obtained by substitution or change based on the technical content disclosed in the present specification. Therefore, any changes and improvements made on the principles of the present application shall be included in the scope of the present application. SEQUENCE LISTING <110> CHINA AGRICULTURAL UNIVERSITY, ZHENGZHOU FRUIT TREE RESEARCH INSTITUTE <120> GENE LOCUS RELATED TO WATERMELON LEAF YELLOWING CHARACTER, MOLECULAR MARKER, PRIMER PAIR BASED ON THE GENE LOCUS AND APPLICATION <130> 2022 <160> 15 <170> PatentIn version 3.3 <210> 1 <211> 343 <212> DNA <213> Artificial sequence (InDel-6010) <400> 1 atgtcctcaa cttatccttg tgtgtttaaa ttttcaccag aggaaccaga tgcttacatg 60 ccatacttcc ttagttacac aaatctggat gtaagtaaca atgtctgtgg tggttgtttg 120 gtggatgggc tttcattgcc cttttaatga agtctgttaa cttctgttgt caccagatat 180 tagaaccatt attatgtaca ctccttttct gtggttttgg atgtatatat tgctgtgctt 240 cagtatttaa cagtttgggc tgttacagga gaagaatcca aggtttcgga agagtggcga 300 ttctgatgaa gaggatgacg atgacagaaa gcagcgacac taa 343 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence (InDel-6010 Forward Primer) <400> 2 atgtcctcaa cttatccttg t 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence (InDel-6010 Reverse Primer) <400> 3 ttagtgtcgc tgctttctgt c 21 <210> 4 <211> 2507 <212> DNA <213> Artificial Sequence (InDel-6030) <400> 4 atgggcgatt gcaggccatt gggtttcttg ttggggctgc catttgcctt ggttgcctta 60 gttttatctg tacttggggc agtcatctgg atcattgggt gagttttttt tttttttttt 120 ttaatttttt ttaatttttt taattttgaa gtgattaaaa gtgacaagta ctgaactggg 180 ttggggctgt gtttttctgt ttctattgca gatctgtgct gagttgcctg tgtccgtgtt 240 gcgtgtgctt tgcggggatt gcaaatttgg cggtggggct tgtcaaactg ccggtcaagg 300 tgctccgatg gttcactcat caaataccct gttgattcct tcgctttttt tatttgtttt 360 ttttttaata atttaatttc cattattcaa tccattattc caagtttcct agttgtagat 420 tatttgggat gttttaatta gttgatgtgt atttgtaata atgccatatt tttcaacatt 480 gattctttga ttggttgcct ttgttgacct caaacctgtt tccgcgtgga atctcgctcc 540 actgtcgctc aacgtggggt gtgggctggg gtcatatctc taccgtttac tctttaattt 600 tttaatatgt ttttaattga atgggtttta caatgtaatt taatttcttt gggataccat 660 tcttatagaa atttcgacca ataatagaat aggtcaaacc taacattgaa tttgtgcata 720 ttattgtttt tctttctttt gaaagtaatg cgtaattgta gttacatgtt aatggttaat 780 caaaaatcaa tatcttatgg gtgttacaat tctaggttgt ttttggatct ttacattaat 840 taaatttgta ttcatttatt ttatttccta aacaaatagt tatcatattt gcaagtatca 900 tcaaggcact atgtaaatct gcatattcac tacaataaaa gtgagtttcc atgacataag 960 ggtatagccg gattgagggg agagaaaaaa caatgtcata aatgaaaaaa aaaaattgct 1020 gtttttttct agcaacttta ggtttttttt tttttttttc atgacatttt gcaatgtcat 1080 cgatttatga catttattaa ttatcattaa ataaatttaa ttatttactt tttaaagaaa 1140 ttcaaaatac atgctttaaa aaagaggaaa agaaaggaaa attgccaaaa ataacaccct 1200 taagttttca tattagaaaa ttagcaccct ttttgaaaat tcgttcaaag agtttttctc 1260 atgccatctc gctcgagatc gagccttgag attgatttaa aaatatgaaa aatataaggg 1320 ataacaacat agaagaccct aataaatgcc ctatatttca ataatgtcca ctttttttat 1380 tattatttta aaaatgtcca tgaaggtttc ttaattacac ataaattagg gtctaattac 1440 cttttagtcc caaaactaca attaattaaa aactacaatt aattaaaaat atttaaagga 1500 aaatttgtac gaatgaccta aattgaaggg cctaaataaa atttggcctc cccctagatt 1560 ttcaatgaaa tatggcattt tgatagttga ctttctagac aatactgctc tcgctccttg 1620 gctctcgtct ctcgatactc gcgctcccga ctctcataag ttggcactca accgttcaac 1680 cattgctaga tttgaaaagt ggggtaccat ataaaatctc tcgaccaatt gtacaattct 1740 taatgtctct cgattctttc ttctctcaca cttgacctac tgacgaacac ctactggacg 1800 atcgactctt cgatgattga ctattcaatt ttctcttgca caacttcaga ttgttagttg 1860 tcatttatcg aacaaaggtg tgcctttatt tcgcgttcgt ttgcgtttta gtctggggta 1920 tgattcgttt gctttcgttt gcaacttttt tgttgcatgt gctggtgtta gggtttgtag 1980 aagtgcccaa attgttcaat agattagggt ttagaagatt aggggactga ggcacgagag 2040 aatgcactaa gattgagtgt aggagatgag agtattttgg agattgtggg agacgatatt 2100 tgtttgctct cgactctcgg ttttcttttg catgtgctga tgtagatggt tgtgtgggtg 2160 ctcttggtgg atggtcgaga gtagaaagtc gagatatcga gacctagggt tctagacaaa 2220 ccgagagtcg agagtactga gagcgagggt actgagagca agagtactga gagcgagagt 2280 actgagagcg agggtactga gagcaagagt actgagagcg agggtactga gagcaagagt 2340 actgagagcc gagagtcgtg agcgagaatc aagagtcgag agcgagagtt taacataatg 2400 cattttttgt ttaatctgtt tattttcttt tatctaatca tgttttttta ttgcacttgt 2460 agacgaccaa cttcaagatt gttgctgaag atcgttttcc tgcctaa 2507 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence (InDel-6030 Forward Primer) <400> 5 atgggcgatt gcaggccatt g 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence (InDel-6030 reverse primer) <400> 6 ttaggcagga aaacgatctt c 21 <210> 7 <211> 660 <212> DNA <213> Artificial Sequence (InDel-6040) <400> 7 atggaagggg aaatcgagag ccagattcag caggtggcgc ccggcgaagg gctgctgcaa 60 aagatccagc agccactact ggaaaatgcc atactaatgg cctcgaagcc aacaaaaaca 120 ccagcccaaa aagccattag aaagacgttc aaaggaacag cgcatttagc caatctcctt 180 cccacaggca ccgttctcgg cttccaaatt ttgtccccaa ttgttacaca ccaaggtcat 240 tgccacaccc atgtcagcca aaccaccacc ctcggccttg tcttgttctg tgctttctcc 300 tgttttttcc tcctcttcac tgacagtttc agagacgaac gtggcaaagt ccgatacggg 360 gtcgctacat ttcaaggcct atgggttatt gatggctcaa taacccttcc caaagaagaa 420 gctgctaaat acaggcttcg gttcatcgat ttctttcatg ccttcgcttc tcttttggtt 480 tttatagctg ttgctttgtt tgatgaaaat gtggtcaagt gtttctatcc aacgccgtct 540 gatgaaacaa gggagctcgt ggttgtgttg cctgttggaa ttggtgtctt gtgcagctgc 600 ttgtttattg tttttcccac taaacgacat ggcgttggat tccccctctc tcgtcagtag 660 <210> 8 <211> twenty one <212> DNA <213> Artificial sequence (InDel-6040 forward primer) <400> 8 atggaagggg aaatcgagag c 21 <210> 9 <211> twenty two <212> DNA <213> Artificial sequence (InDel-6040 reverse primer) <400> 9 ctactgacga gagaggggga at 22 <210> 10 <211> 1309 <212> DNA <213> Artificial sequence (InDel-6050) <400> 10 atgggtgtcg actactatcg aattttgcag gtcgataaga atgcttccga cgatgatttg 60 aagaaggcct atagaaaact cgccatgaaa tggcatccag acaagaaccc taataacaaa 120 agagaagctg aagctaaatt taagcaaatt tctgaagctt atgaggtatc aacaaataac 180 CCTCTTTCAATCTTCTATTT CATAGGGGTT TCTGTTCTTT TCTCTTTTTC GTTCCGTTTA 240 GTTGCGATTT GTTAATCAAA TGAATCTTTG TGCCTCTGTT TTTCTCTGTT TTTGTTTGCA 300 ATTCTTTTCA TCTTTGATTC TTGTTCCTTG GGGGAATTTT TTTTTAGTTT CTCAGTGAC 360 CCCCAAAAAA GAGCAATCTA TGATCAATAC GGTGAAGATG GCCTGAAAGG TCAGGTGCCA 420 CCTCCGGATG CCAGAGGTCC AGGCAGGCCA CTTCTTCTCC ACCGGAGATG GACCAACG 480 ACGTTTCGGT TCAATCCCCG AAACGCGAAC GATATTTCCT CTGAATTCTT TGGATTTTCA 540 AGCCCATTTG GCAGATGGGT GGAAGAGGAC AAAGATTCTC ATCAAGTATT TTCGCTGAT 600 GATATATTTG CATCCTTCGG CGGTGGCGAC GGCGAAAGCG TTGGCGGTTC CATGTACCGA 660 CATGCTTCTC GTAAGCACCT CCAATCGATA GACAATTACC ATGTAACCTC GAAGAATTA 720 TACAAAGGAA CCACCAAGAA GATGAAAATT CTAGACAAGT TACTGACGTT CGTGGGTAAG 780 GCAAAACATA AAACAAAAAC CCCATAATTT TATTTCCTGT TCTTTTCCCT TTC AAAATCCA 840 ACCTTTTTGT TTACTTCATT GAATCAGAAA AACGATGAAA ACAGAGGAGA TTTTAACGAT 900 caacataaag cccgggtgga aaaaaggaac aaagatcaca ttcccagaga aaggaaacga 960 ggagcccgac attataccat cagatattgt ttttgtgatc gatgagaagc ctcacagcgt 1020 attcactcgc gatggaaacg atttaattgt cactcaaaag atatctctgg cggaggcctt 1080 gacagggtgc tctgttcatc ttacaacctt agacggcaga aatctcagtt tcccaattac 1140 taatgtaatc actccaaatt acgaggaagt gattccatca gaaggaatgc ctctccaaaa 1200 agaccccatc aagaaaggga atttgagaat caaattcgac atcaaattcc caaccatact 1260 cacttccgag cagaaggctg gcattaggaa gctcttaggc caggcttga 1309 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence (InDel-6050 forward primer) <400> 11 atgggtgtcg actactatcg a 21 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence (InDel-6050 reverse primer) <400> 12 tcaagcctgg cctaagagct tc 22 <210> 13 <211> 1014 <212> DNA <213> Artificial Sequence (InDel-6060) <400> 13 atgttccata ctaatggatt cggttccata accatgggtt ccaatgtacg agatcttgta 60 gcacttacca atgaggccct atcgattagt attacgcaga agaaatcaat tatagacact 120 aatataatta gatctgctct tcatagacaa acttgggatt tgcgatccca ggtaagatcg 180 gttcaggatc atgggatcct tttctatcag ataggaaggg ctgttgcaca aaatgtactt 240 ctaagtaatt gctccataga tcctatatct atctatatga agaagaaatc atgtaacgaa 300 gggggttctt atttgtacaa atggtacttc gaacttggaa cgagcatgaa gaaattaacg 360 atacttcttt atcttttgag ttgttctgcc ggatcggtcg ttcaagacct ttggtctcta 420 cccggacccg atgaaaaaaa tgggatcact tcttatggac tcgttgagaa tgattctgat 480 ctagttcatg gcctattaga agtagaaggc gctctgttgg gatcctcacg gacagaaaaa 540 gattgcagtc gatttgataa tgatcgagtg acattgcttc ttcggcccga acccaggaat 600 cccttagata tgatacaaaa tggatcttgt tctatcgttg atcagagatt tctctatgaa 660 caatacgaat cggagtttga agaaggggaa ggagaaggag tcctcgaccc gcaacagata 720 gaggaggatt tattcaatca catagtttgg gctcctagaa tatggcgccc ttggggcttt 780 ctatttgatt gtatcgaaag gcccaatgaa ttgggatttc cctattgggc taggtcattt 840 cggggcaagc ggatcattta tgatgaagag gatgagcttc aagagaatga ttcggagttc 900 ttgcagagtg gaaccgtgca gtaccagaca cgagatagat cttccaaaga acaaggcttt 960 tttcgaataa gtgaattcat ttgggattta aaagaagtga ttttattggt atga 1014 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence (InDel-6060 Forward Primer) <400> 14 atgttccata ctaatggatt c 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence (InDel-6060 Reverse Primer) <400> 15 tcataccaat aaaatcactt c 21

Claims

1. The application of primer pairs for the InDel molecular marker, developed based on the InDel gene locus associated with yellowing traits in watermelon leaves, in identifying whether watermelon leaves are yellowing, characterized in that... The InDel gene locus is InDel-6050, located at bases 14550627-14551935 bp on chromosome 2 of the watermelon reference genome version 97103V2. The InDel-6050 gene sequence is 1309 bp in length. Homozygous watermelon plants with yellowing leaves exhibit the deletion of the InDel-6050 gene sequence. The forward primer sequence for amplifying the InDel-6050 molecular marker is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.

12.

2. A method for identifying whether watermelon leaves are yellowing using the primer pair with the InDel-6050 molecular marker as described in claim 1, characterized in that, Includes the following steps: Genomic DNA was extracted from the watermelon samples to be tested. The watermelon genomic DNA was amplified by PCR using primers with the InDel-6050 molecular marker. The allelic genotype of the yellowing trait in watermelon leaves was determined based on the electrophoretic bands of the PCR amplification products. If no band was observed, the watermelon was a homozygous yellowing plant; if one band was observed, the watermelon was either a homozygous or heterozygous normal green plant. The forward primer sequence of the primer pair for amplifying the InDel-6050 molecular marker is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.

12. The gene locus of the InDel-6050 molecular marker is located at bases 14550627-14551935 bp on chromosome 2 of the watermelon reference genome version 97103V2. The InDel-6050 gene sequence is 1309 bp in length.

Images