Strong promoter derived from fungi and its application

Abstract

The present invention relates to polynucleotides with promoter activity in fungi and their use in producing organic acids and enzyme preparations, transcription expression boxes containing the polynucleotides, recombinant vectors, recombinant host cells, and the use of polynucleotides with promoter activity in enhancing the expression of target genes, thereby, for example, increasing the yield of organic acids and enzyme preparations of strains.

Description

Technical Field

[0001] The present invention relates to the technical field of bioengineering and genetic engineering, and relates to a polynucleotide with promoter activity, a method for enhancing the expression of a target gene by using the polynucleotide with promoter activity, and a method for increasing the yield of organic acid or enzyme preparation of a strain. Background Art

[0002] Fungi are extremely important industrial strains in the field of biological industry and are widely used in industrial production of organic acids, enzyme preparations, etc. Take Aspergillus niger as an example. Aspergillus niger is an extremely important industrial strain in the organic acid and enzyme preparation industry. The annual global production of citric acid produced by Aspergillus niger reaches 2 million tons, with an output value of more than 2 billion US dollars, and it increases at a rate of 5% per year. In 2015, the global output value of fungal enzyme preparations was about 3.5 billion euros.

[0003] It is well known that efficient expression of target genes is the key to achieving high production of organic acids and enzyme preparations in fungi. The factors affecting efficient gene expression mainly include promoter activity, translation efficiency, gene copy number, etc. The increase in gene copy number will reduce the stability of the bacterial genome. Therefore, the level of promoter transcription is a key factor affecting efficient gene expression.

[0004] At present, strong promoters in fungi have been reported in the literature, such as the gpdA promoter of glyceraldehyde 3phosphate dehydrogenase from Aspergillus nidulans and the gdhA promoter of glutamate dehydrogenase from Aspergillus awamori (LeDao, Xu Yang, et al., Application of high-efficiency promoters in Aspergillus protein expression [J], Food Industry Science and Technology, 2013, 34(13): 342-345). Among them, the gpdA promoter from Aspergillus nidulans is the one that has been reported to be commercially well and is generally considered to be a strong promoter in fungi. Xu et al. (Xu Y, Zhou Y, Cao W, Liu H. Improved Production of Malic Acid in Aspergillus niger by Abolishing Citric Acid Accumulation and Enhancing Glycolytic Flux. ACS SynthBiol. 2020.9(6):1418-1425) used this promoter to enhance the glycolysis pathway, thereby increasing the conversion rate of malic acid / glucose from 1.27 mol / mol to 1.64 mol / mol, thereby increasing the production of malic acid.

[0005] However, there is a need to enrich nucleic acid molecules with promoter activity suitable for various uses. For example, developing promoters with higher activity or promoters more suitable for related uses will be beneficial to enhancing the expression of genes related to organic acid synthesis and the expression of enzyme preparations, thus having greater potential for industrial application. Summary of the invention

[0006] The purpose of the present invention is to provide a polynucleotide sequence with strong promoter activity derived from fungi, which can increase the expression intensity of organic acid-related genes and enzyme preparation encoding genes, thereby increasing the yield of organic acids and enzyme preparations, and has more industrial application potential. On this basis, the present invention is completed.

[0007] In one aspect, the present invention provides a polynucleotide having strong promoter activity, wherein the polynucleotide is selected from any one of the following groups consisting of (a)-(e):

[0008] (a) comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1-5;

[0009] (b) comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 54-60;

[0010] (c) comprising a reverse complementary sequence of the nucleotide sequence shown in any one of SEQ ID NOs: 1-5 and SEQ ID NOs: 54-60;

[0011] (d) a sequence that can hybridize with the nucleotide sequence shown in (a) or (b) or (c) under high stringency hybridization conditions and still has promoter activity;

[0012] (e) a sequence that has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99% sequence identity with the nucleotide sequence shown in (a) or (b) or (c), and still has promoter activity.

[0013] Preferably, the polynucleotide having promoter activity is a polynucleotide having a nucleotide sequence as shown in any one of SEQ ID NOs: 1-5 and SEQ ID NOs: 54-60.

[0014] In a second aspect, the present invention provides a transcription expression cassette, wherein the transcription expression cassette comprises the promoter of the first aspect, and optionally, the transcription expression cassette further contains a protein coding gene, and the protein coding gene is operably linked to the polynucleotide having promoter activity.

[0015] In a third aspect, the present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises the nucleotide sequence described in the first aspect or the transcription expression cassette described in the second aspect.

[0016] In a fourth aspect, the present invention provides a host cell, wherein the host cell contains the transcription expression cassette of the second aspect, or the recombinant expression vector of the third aspect; wherein the host cell is a fungus, optionally, the host cell is Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae, Penicillium chrysogenum, Trichoderma reesei, Ustilago maydis, Myceliophthora thermophila, most preferably Aspergillus niger and Aspergillus nidulans.

[0017] In a fifth aspect, the present invention provides the use of the polynucleotide of the first aspect, the transcription expression cassette of the second aspect, the recombinant expression vector of the third aspect, and the host cell of the fourth aspect in at least one of the following:

[0018] (a) for enhancing the transcription level of a gene, or for preparing a reagent or kit for enhancing the transcription level of a gene;

[0019] (b) for preparing a protein, or for preparing a reagent or kit for preparing a protein;

[0020] (c) producing an organic acid, or preparing a reagent or kit for producing an organic acid.

[0021] Optionally, the organic acid includes any one of citric acid, succinic acid and malic acid. The protein is an enzyme preparation, and the enzyme preparation includes any one of glucoamylase, glucose oxidase, catalase and phytase.

[0022] In a sixth aspect, the present invention provides a method for regulating transcription of a target gene, wherein the method comprises operably linking the polynucleotide having promoter activity of the first aspect to the target gene, for example, by introducing a vector in which the polynucleotide having promoter activity is operably linked to the target gene into a recombinant host cell, thereby enhancing the transcription of the target gene in the recombinant host cell.

[0023] In the seventh aspect, the present invention provides a method for preparing a protein, wherein the method comprises using the expression cassette of the second aspect containing the target gene, or the recombinant expression vector of the third aspect containing the target gene, to introduce into a recombinant host cell to express the target gene, or culturing the host cell of the fourth aspect to express the protein.

[0024] The eighth invention provides a method for producing an organic acid or enzyme preparation, wherein the method comprises using the expression cassette of the second aspect or the recombinant expression vector of the third aspect, introducing it into a host cell, culturing the host cell, and collecting the produced organic acid or enzyme, wherein the expression cassette or the recombinant expression vector contains a gene encoding a protein related to the synthesis of the organic acid or enzyme preparation operably linked to the nucleotide described in the first aspect; further, the method comprises the step of separating the organic acid or enzyme preparation from the fermentation broth;

[0025] In a specific embodiment, the host cell is a fungus, optionally, the host cell is Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae, Penicillium chrysogenum, Trichoderma reesei, Ustilago maydis, Myceliophthora thermophila, most preferably Aspergillus niger, Aspergillus nidulans.

[0026] In another specific embodiment, the organic acid comprises any one of citric acid, succinic acid and malic acid. The enzyme preparation comprises any one of glucoamylase, glucose oxidase, catalase and phytase.

[0027] The present invention obtains a series of polynucleotide sequences with strong promoter activity by isolating from Aspergillus niger through research. These polynucleotides with strong promoter activity can be used to efficiently enhance the production of enzyme preparations and organic acids, provide new regulatory elements for the construction of fungal production strains, and have great application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Detection of fluorescent protein expression mediated by different promoters

[0029] Figure 2 It shows that the enhanced expression of citrate transporter mediated by different promoters improves citric acid fermentation. DETAILED DESCRIPTION

[0030] When used in conjunction with the term "comprising" in the claims and / or the specification, the word "a", but may also mean "one or more", "at least one" and "one or more than one". As used in the claims and the specification, the words "comprising", "having", "including" or "containing" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0031] The term "about" herein means that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0032] The term "promoter" used in the present invention refers to a nucleic acid molecule, which is usually located upstream of the target gene coding sequence, provides a recognition site for RNA polymerase, and is located upstream of the 5' direction of the mRNA transcription start site. It is a non-translated nucleic acid sequence, and RNA polymerase initiates the transcription of the target gene after binding to this nucleic acid sequence. In the synthesis of ribonucleic acid (RNA), the promoter can interact with the transcription factors that regulate gene transcription, control the start time and degree of gene expression (transcription), and contains the core promoter region and the regulatory region, which is like a "switch" to determine the activity of the gene and then control which protein the cell starts to produce. The polynucleotide sequence of the promoter of the present invention is shown in SEQ ID: 1-5, SEQ ID: 54-60. The present invention also includes some variants of the above-mentioned nucleic acid molecules with the same function, which have at least 90% or more, preferably at least 95% or more, preferably at least 96% or more, preferably at least 97% or more, preferably at least 98% or more, or preferably at least 99% or more identity with the polynucleotide sequence shown in any one of SEQ ID NO: 1-5, SEQ ID NO: 54-60, and have promoter activity.

[0033] Preferably, the mutation of the variant occurs in the regulatory region of the promoter, for example, it can be obtained by inserting or deleting the regulatory region, or performing random or site-directed mutation on the regulatory region. In other words, the present invention also includes variants of SEQ ID NO: 1-5, SEQ ID NO: 54-60 that retain the function of the promoter to direct the expression of the target gene, obtained by deleting or mutating one, several or dozens of bases (for example, within 100, or within 80, or within 60, or within 50, or within 40, or within 30, or within 20, or within 15, or within 10, or within 5) on the basis of the polynucleotide sequences shown in SEQ ID NO: 1-5, SEQ ID NO: 54-60. The present invention also includes a fragment of, for example, 15 to 50 bases added to both ends of the polynucleotide shown in SEQ ID NO: 1-5, more preferably a polynucleotide with a length of 15 to 30 bases and having promoter activity. It also includes polynucleotides having promoter activity obtained by adding, for example, fragments of 15 to 50 bases, more preferably fragments of 15 to 30 bases, to both ends of the polynucleotides shown in SEQ ID NOs: 54 to 60.

[0034] The term "polynucleotide" of the present invention refers to a polymer composed of nucleotides. A polynucleotide can be in the form of a separate fragment or a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence separated at least once in quantity or concentration, and can be identified, manipulated, and restored by standard molecular biology methods (e.g., using a cloning vector) and its component nucleotide sequences. When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C), in which "U" replaces "T". In other words, "polynucleotide" refers to a nucleotide polymer removed from other nucleotides (separate fragments or entire fragments), or can be a component or ingredient of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0035] The term "expression" of the present invention includes any steps involved in RNA production and protein production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.

[0036] The term "transcription expression cassette" of the present invention refers to a type of expression element that includes a transcription regulatory element and a target gene, and utilizes the transcription regulatory element to regulate the expression of the target gene. In the present disclosure, the transcription regulatory element includes a promoter, and on this basis, it can also include enhancers, silencers, insulators and other elements. In the present disclosure, the target gene is specifically a protein-coding gene. The target gene and the polynucleotide are "operably linked" to each other, which means that the polynucleotide with promoter activity is functionally linked to the target gene to initiate and mediate the transcription of the target gene. The operably linked method can be any method described by those skilled in the art.

[0037] The term "target gene" of the present invention relates to any gene connected to a polynucleotide having promoter activity in the present invention to regulate its transcription level. In some embodiments, the target gene refers to a gene encoding a target protein in a microorganism. Exemplarily, the target gene is a gene encoding an enzyme associated with the biosynthesis of the target compound, a gene encoding an enzyme associated with reducing power, a gene encoding an enzyme associated with glycolysis or TCA cycle, or a gene encoding an enzyme associated with the release of the target compound, etc.

[0038] The term "target compound" of the present invention can be selected from organic acids, enzyme preparations, and can also be selected from other types of compounds that may be obtained by biosynthesis in the art. In some embodiments, the target compound is an organic acid. The organic acid can be an organic compound with acidity, for example, including those compounds of carboxyl and sulfonic acid groups. Exemplary, the organic acid includes one or more combinations of lactic acid, acetic acid, succinic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, citric acid, propionic acid, hexenoic acid, capric acid, caprylic acid, valeric acid, malic acid, or other types of organic acids in the art. In some embodiments, the target compound is an enzyme preparation, and exemplary, the enzyme preparation includes one or more combinations of glucoamylase, glucose oxidase, catalase and phytase.

[0039] The term "expression vector" of the present invention refers to bacterial plasmids, bacteriophages, yeast plasmids, viruses or other vectors well known in the art. The plasmid can be a linear or closed circular plasmid. In short, any plasmid and vector can be used as long as it can replicate and be stable in the host. The choice of vector generally depends on the compatibility of the vector with the host cell into which the vector is introduced.

[0040] The expression vector generally includes (from 5' to 3' direction): a promoter that guides the transcription of the target gene and the target gene. If necessary, the recombinant vector may also include: a multiple cloning site or at least one restriction site downstream of the promoter, a ribosome binding site for translation initiation, a 3' transcription terminator, a 3' polynucleotide signal, other non-translated nucleic acid sequences, transport and targeting nucleic acid sequences, resistance selection markers, enhancers or operators. The target gene is connected to the suitable multiple cloning site or restriction site, so that the target gene is operably connected to the promoter.

[0041] Various ribosome binding sites for translation initiation, 3' polynucleotide signals, other non-translated nucleic acid sequences, transport and targeting nucleic acid sequences, resistance selection markers, enhancers or operators commonly used in the art can be used in the present invention.

[0042] The vector can be an autonomously replicating vector, i.e., exists as an extrachromosomal entity, and its replication is independent of the vector of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can include any mode for ensuring self-replication. Alternatively, the vector can be a vector that is integrated into the genome and replicated together with the chromosome into which it has been integrated when being imported into the host cell. In addition, a single vector or plasmid or two or more vectors or plasmids, or a transposon, that together contain the total DNA that will be imported into the host cell genome can be used.

[0043] The vectors of the present invention preferably contain one or more selectable markers that allow easy selection of transformed, transfected, transduced, etc. cells. Selectable markers are genes whose products provide resistance to antibiotics or viruses, resistance to heavy metals, prototrophy to auxotrophy, and the like.

[0044] The vector of the present invention preferably comprises elements that allow the vector to be integrated into the host cell genome or the vector to replicate autonomously in the cell independently of the genome. The expression vector may contain more than one copy of the target gene of interest to increase the yield of the gene product. The increase in the number of copies of the target gene can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selection marker gene and the target gene, wherein the cells containing the amplified copy of the selection marker gene and thus containing the additional copy of the target gene can be screened by culturing the cells in the presence of an appropriate selection agent.

[0045] Methods for preparing recombinant expression vectors are well known to those skilled in the art, including in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc.

[0046] The term "exogenous" used in the present invention refers to the inclusion of substances that did not originally exist in a system. For example, if a coding gene that did not originally exist in a strain is introduced into the strain through transformation, the gene is "exogenous" to the strain.

[0047] The term "wild type / endogenous / naturally occurring" as used in the present invention refers to the activity of a polypeptide in an unmodified state in a microorganism, that is, the activity in the natural state.

[0048] The "modification" mentioned in the present invention refers to any genetic manipulation performed on a wild-type strain or a parent strain, including but not limited to various molecular biological methods.

[0049] The terms "sequence identity" and "percentage of identity" of the present invention refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by the following method: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions containing the same nucleotide or amino acid residue in the aligned polynucleotides or polypeptides is scored, and compared with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. The polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or missing nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or two polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or missing amino acids (i.e., amino acid insertions or amino acid deletions in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, the percentage of identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

[0050] The term "complementary" of the present invention refers to hybridization or base pairing between nucleotides or nucleotides, such as between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleotide to be sequenced or amplified.

[0051] The term "high stringency conditions" of the present invention means that for a probe of at least 100 nucleotides in length, prehybridization and hybridization are performed at 42° C. for 12 to 24 hours in 5X SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 micrograms / ml sheared and denatured salmon sperm DNA, and 50% formamide following standard Southern blotting procedures. Finally, the carrier material is washed three times at 65° C. using 2X SSC, 0.2% SDS for 15 minutes each time.

[0052] The "host cell" of the present invention has the meaning generally understood by those of ordinary skill in the art, that is, a cell capable of importing the expression cassette mediated by the promoter of the present invention, which is referred to as a recombinant host cell after importing. In other words, the present invention can utilize any host cell as long as the promoter sequence of the present invention is contained in its cell. The host cell of the present invention can be a eukaryotic cell, including but not limited to Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae, Penicillium chrysogenum, Trichodermareesei, Ustilago maydis, Myceliophthora thermophila and other strains, preferably Aspergillus niger, Aspergillus nidulans, Aspergillus oryzae, Trichodermareesei, most preferably Aspergillus niger, and a mutant or strain producing enzyme preparations and organic acids prepared by the above-mentioned strains.

[0053] Recombinant host cells are specifically achieved, for example, by transformation. Here, "transformation" has the meaning generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The method of transformation includes any method of introducing nucleic acid into a cell, including but not limited to electroporation, calcium phosphate precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0054] In the present invention, the host cells can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0055] Example

[0056] Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples (although representing specific embodiments of the present invention) are given for illustrative purposes only, because after reading the detailed description, various changes and modifications made within the spirit and scope of the present invention will become apparent to those skilled in the art.

[0057] The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0058] Example 1 Identification of DNA fragments with promoter activity

[0059] 1. Construction of expression vector mediated by DNA fragment with promoter activity

[0060] The transcriptome sequencing of Aspergillus niger strain M202 (purchased from the strain resource library of Shanghai Institute of Microorganisms and Technology Co., Ltd., with public accession number M202) was performed. Through the analysis of the transcriptome data, it was found that 5 genes had high expression levels. Therefore, the gene structure of these 5 highly expressed genes was carefully analyzed, and it was assumed that the partial DNA fragments upstream of the genes were their respective promoter regions. In order to identify the function of each DNA fragment, the present invention designed upstream and downstream primers of each DNA fragment (Table 1) to construct expression vectors mediated by each DNA fragment. Using the upstream and downstream primers of each DNA fragment, the genome of Aspergillus niger strain M202 was used as a template, and PCR amplification was performed to obtain the DNA fragments of SEQ ID NO: 1-5. At the same time, primers were designed to obtain the promoter of glyceraldehyde-3-phosphate dehydrogenase (P gpdA ) sequence was used as a control, and this promoter is a strong fungal promoter currently widely used and recognized in the commercial market. The specific primer sequences are shown in Table 1.

[0061] Table 1 Primers for constructing expression vectors mediated by different promoters

[0062]

[0063]

[0064] The PCR reaction system was 10 μL of 5×FastPfu buffer, 1 μL of 10 mM dNTPs, 2.5 μL of upstream / downstream primers, 0.5 μL of DNA template, 1.5 μL of FastPfu (TransGene), and 32 μL of ultrapure water.

[0065] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 2 min, 35 cycles; and final extension at 72°C for 10 min.

[0066] After the PCR product was purified, it was recombined with the plasmid pSilent-1 (GenBank: LT827033.1) digested with restriction endonucleases SpeI and XholI using the Novozymes ligase-independent single fragment rapid cloning kit (Cat. No. C112-01), and then transformed into Escherichia coli Trans-T1. After extracting the corresponding recombinant plasmid, it was verified by restriction digestion and sequencing to obtain expression vectors pP16, pP51, pP52, pP60 and pP67 of SEQ ID NO: 1-5. In addition, the glyceraldehyde 3-phosphate dehydrogenase promoter (P gpdA )-mediated expression vector pP gpdA As a control.

[0067] 2. Detection of promoter activity of the above DNA fragments

[0068] In order to identify whether the above selected DNA fragment has the function of a promoter, the present invention first uses green fluorescent protein GFP as a reporter protein for testing. First, the upstream and downstream primers of the gfp gene are used, and the plasmid pMF272 (GenBank: AY598428.1) containing the gfp gene is used as a template to perform PCR amplification of the green fluorescent protein gene fragment. The specific primer sequences are shown in Table 2.

[0069] Table 2 Primers for construction of green fluorescent protein reporter vector

[0070]

[0071]

[0072] The PCR reaction system and PCR reaction conditions were the same as above.

[0073] After the PCR product was purified, it was digested with restriction endonucleases SnaBI and BglII to form plasmids pP16, pP60, pP67 and pP gpdA , or plasmids pP51 and pP52 digested with restriction endonucleases SphI and KpnI, were recombined using the Novozymes ligase-independent single fragment rapid cloning kit (Cat. No. C112-01), and then transformed into E. coli Trans-T1. After extracting the corresponding recombinant plasmids, restriction digestion and sequencing were used to verify the green fluorescent protein reporter vectors pP16-GFP, pP51-GFP, pP52-GFP, pP60-GFP, pP67-GFP and pP mediated by different DNA fragments. gpdA -GFP, where pP gpdA -GFP served as a control.

[0074] Fresh spores of Aspergillus niger M202 were suspended in 100 mL CMA liquid medium (glucose 20 g / L, malt extract 20 g / L, peptone 1 g / L). The final concentration of the spore suspension was 1 × 10 5 / mL, cultured at 30℃, 200r / min for 12-16h. Collect the cells with sterile Micro-cloth filter cloth under sterile conditions, rinse once with solution A (K2HPO4 5mM, KH2PO4 5mM, MgSO4 96.31g / L, pH 5.8, filter sterilized), transfer them to 20mL lysis solution (0.4g lysis enzyme in 20mL solution A) with a sterile cotton swab, and lyse for about two hours at 37℃, 75r / min. Filter the above lysis solution with sterile Micro-cloth filter cloth, collect the protoplasts with two 50mL sterile centrifuge tubes, and rinse with solution B (Tris-HCl 10mM, CaCl2 5.54g / L, D-sorbitol 218.64g / L, pH 7.5, filter sterilized) to make each tube about 25mL. Centrifuge at 2000r / min for 5min and discard the supernatant. Resuspend the precipitate twice with 20mL solution B. Resuspend the precipitate in 10mL solution B and count the protoplasts using a hemocytometer. Centrifuge and resuspend once with an appropriate amount of solution B according to the counting results. Add 100μL of protoplast suspension to a pre-cooled 15mL centrifuge tube on ice, and then add 5μg of each DNA fragment-mediated green fluorescent protein reporter vector pP16-GFP, pP51-GFP, pP52-GFP, pP60-GFP, pP67-GFP and pP gpdA -GFP, add 1mL solution C (Tris-HCl 10mM, CaCl2 5.54g / L, PEG600050% (w / v), pH 7.5, filter sterilized) ice bath for 10min, 2mL solution B and mix. After mixing with the preheated upper culture medium MMSH containing hygromycin, spread it on the lower culture medium MMSH plate. The plate was cultured in a 30℃ incubator for 3-5 days to obtain fluorescent protein reporter strains mediated by each DNA fragment, which were named AnP16-GFP, AnP51-GFP, AnP52-GFP, AnP60-GFP, AnP67-GFP and AnP gpdA-GFP. The obtained strains and fresh spores of the starting strain M202 were suspended in 50 ml CMA liquid culture medium and cultured at 30°C and 200 r / min for 24 hours. Fluorescence confocal microscopy was used to observe the expression of fluorescent protein in the cultures of each strain at 480 nm. The results showed that compared with the starting strain M202, the expression of fluorescent protein was detected in each strain, indicating that the DNA fragments of SEQ ID NO: 1-5 obtained by the present invention can initiate the transcription of downstream genes and have promoter activity. The expression of fluorescent protein in each strain is shown in Figure 2. Figure 1 shown.

[0075] Example 2 Effects of different promoters on the expression of glucose oxidase

[0076] 1. Construction of glucose oxidase expression vectors mediated by different promoters

[0077] The upstream primer and downstream primer of the glucose oxidase encoding gene goxC were used to amplify the glucose oxidase gene fragment by PCR using the genome of Aspergillus niger M202 strain as a template. The specific primer sequences are shown in Table 3.

[0078] Table 3 Primers for constructing the Aspergillus niger glucose oxidase expression vector

[0079] Primer name Primer sequences Sequence number P16-GoxC-F tttcgttcatcacagccgtctcgagATGCAGACTCTCCTTGTGAGCT SEQ ID NO: 25 P51-GoxC-F ccaattctccaaacgtcaaactcgagATGCAGACTCTCCTTGTGAGCT SEQ ID NO: 26 P52-GoxC-F cataactcatccccctccagctcgagATGCAGACTCTCCTTGTGAGCT SEQ ID NO: 27 P60-GoxC-F cctactagccgccctcatcctcgagATGCAGACTCTCCTTGTGAGCT SEQ ID NO: 28 P67-GoxC-F tcagaaccaccacaaaccactcgagATGCAGACTCTCCTTGTGAGCT SEQ ID NO: 29 <![CDATA[P gpdA -GoxC-F]]> ttaccccgccacatagacactcgagATGCAGACTCTCCTTGTGAGCT SEQ ID NO: 30 GoxC-R cacaggccttagcatgcgaagatctTCACTGCATAGAAGCGTAGTCC SEQ ID NO: 31

[0080] The PCR reaction system and reaction conditions were the same as those in Example 1.

[0081] After the PCR product was purified, it was digested with restriction endonucleases SnaBI and BglII to form plasmids pP16, pP60, pP67 and pP gpdA , or plasmids pP51 and pP52 digested with restriction endonucleases SphI and KpnI, were recombined using the Novozymes ligase-independent single fragment rapid cloning kit (Cat. No. C112-01), and then transformed into E. coli Trans-T1. After extracting the corresponding recombinant plasmids, restriction digestion and sequencing were used to verify the glucose oxidase expression vectors pP16-GoxC, pP51-GoxC, pP52-GoxC, pP60-GoxC, pP67-GoxC and pP gpdA -GoxC, where pP gpdA -GoxC served as a control.

[0082] 2. Construction of a recombinant strain of Aspergillus niger with enhanced expression of glucose oxidase

[0083] According to the method of Example 1, the glucose oxidase expression vectors pP16-GoxC, pP51-GoxC, pP52-GoxC, pP60-GoxC, pP67-GoxC and pP gpdA -GoxC was transformed into Aspergillus niger M202 strain to obtain Aspergillus niger strains with enhanced expression of glucose oxidase mediated by each promoter, which were named AnP16-GoxC, AnP51-GoxC, AnP52-GoxC, AnP60-GoxC, AnP67-GoxC and AnP gpdA -GoxC.

[0084] 3. Detection of enzyme activity of Aspergillus niger glucose oxidase expression-enhanced strains mediated by different promoters

[0085] The Aspergillus niger glucose oxidase expression enhanced strains AnP16-GoxC, AnP51-GoxC, AnP52-GoxC, AnP60-GoxC, AnP67-GoxC and AnP gpdA -GoxC were inoculated on PDA medium and cultured at 30°C for 5 days, then spores were collected with 0.9% saline and counted using a hemocytometer. 6 / mL of inoculum was inoculated into Aspergillus niger protein fermentation medium (2% glucose, 2% maltose, 1.5% ammonium sulfate, 4% trypsin-digested soybean culture fluid, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate), cultured at 34°C, 250r / min for 96h, and then the fermentation supernatant was separated by suction filtration to obtain the crude enzyme solution.

[0086] Glucose oxidase activity determination: Dilute the crude enzyme solution directly with buffer to the appropriate concentration. Take 4 test tubes, add 2mL buffer, 0.3mL glucose, 0.4mL phenol, 0.1mL 4-aminoantipyrine, 0.1mL horseradish peroxidase, and preheat at 30℃ for 5min. Add 0.1mL distilled water to one of the tubes as a blank zero. Add 0.1mL sample solution to the sample tube, start timing at this time, vortex and mix immediately, and use a 1cm colorimetric cup at a wavelength of 500nm. Read the absorbance value A0 at 0.5min, and after reacting for 1min, read the absorbance value A1, and obtain ΔA500=A1-A0. The enzyme activity calculation formula is ΔA500×enzyme solution dilution multiple×reaction solution volume×1000 / (887×reaction time×sample volume×thickness of the cuvette)=33.82×ΔA500×enzyme solution dilution multiple. The reaction volume is 3 mL, 1000 is the extinction coefficient unit conversion factor, and 887 is the extinction coefficient (L·mol -1 cm -1); reaction time is 1min; sample volume is 0.1mL; cuvette thickness is 1cm. The enzyme activity unit is defined as the amount of enzyme required to oxidize 1μmol of β-D-glucose into D-gluconic acid and hydrogen peroxide per minute under pH 6.0 and 30℃, which is defined as 1 enzyme activity unit (U). The relative crude enzyme activities of glucose oxidase of all strains finally obtained are shown in Table 4. The results show that the DNA fragments of SEQ ID NO: 1-5 obtained in Example 1 not only have promoter activity, but also have strong promoter activity, which is generally considered to be a strong promoter in current commercial applications. gpdA Compared with the control group, the enzymatic activity of glucose oxidase mediated by the five promoters was significantly improved, especially the enzymatic activity of glucose oxidase mediated by P51 promoter was gpdA The enzyme activity of glucose oxidase mediated by the promoter was 1.3 times that of the promoter, and the effect was very significant, indicating that the five promoters of the present invention had strong promoter activity and were strong promoters of Aspergillus niger.

[0087] Table 4 Relative crude enzyme activity of glucose oxidase mediated by different promoters

[0088]

[0089]

[0090] Example 3 Effects of different promoters on catalase expression

[0091] 1. Construction of catalase expression vectors mediated by different promoters

[0092] The upstream primer and downstream primer of the catalase encoding gene catR were used to amplify the gene fragment of catalase by PCR using the genome of Aspergillus niger M202 strain as a template. The specific primer sequences are shown in Table 5.

[0093] Table 5 Primers for the construction of catalase expression vector

[0094] Primer name Primer sequences Sequence number P16-CatR-F tttcgttcatcacagccgtctcgagATGCGTCATTTCTGGCTTTTG SEQ ID NO: 32 P51-CatR-F ccaattctccaaacgtcaaactcgagATGCGTCATTTCTGGCTTTTG SEQ ID NO: 33 P52-CatR-F cataactcatccccctccagctcgagATGCGTCATTTCTGGCTTTTG SEQ ID NO: 34 P60-CatR-F cctactagccgccctcatcctcgagATGCGTCATTTCTGGCTTTTG SEQ ID NO: 35 P67-CatR-F tcagaaccaccacaaaccactcgagATGCGTCATTTCTGGCTTTTG SEQ ID NO: 36 <![CDATA[P gpdA -CatR-F]]> ttaccccgccacatagacactcgagATGCGTCATTTCTGGCTTTTG SEQ ID NO: 37 CatR-R cacaggccttagcatgcgaagatctCTACTCATCCAGCGCAAACCGGTC SEQ ID NO: 38

[0095] The PCR reaction system and reaction conditions were the same as those in Example 1.

[0096] After the PCR product was purified, it was digested with restriction endonucleases SnaBI and BglII to form plasmids pP16, pP60, pP67 and pP gpdA, or plasmids pP51 and pP52 digested with restriction endonucleases SphI and KpnI, were recombined using the Novozymes ligase-independent single fragment rapid cloning kit (Cat. No. C112-01), and then transformed into E. coli Trans-T1. After extracting the corresponding recombinant plasmids, restriction digestion and sequencing were used to verify the expression of catalase under different promoters, pP16-CatR, pP51-CatR, pP52-CatR, pP60-CatR, pP67-CatR and pP gpdA -CatR, where pP gpdA -CatR served as a control.

[0097] 2. Construction of a recombinant strain of Aspergillus niger with enhanced catalase expression

[0098] According to the method of Example 1, catalase expression vectors pP16-CatR, pP51-CatR, pP52-CatR, pP60-CatR, pP67-CatR and pP gpdA -CatR was transformed into Aspergillus niger M202 strain to obtain Aspergillus niger strains with enhanced catalase expression mediated by each promoter, which were named AnP16-CatR, AnP51-CatR, AnP52-CatR, AnP60-CatR, AnP67-CatR and AnP gpdA -Cat R.

[0099] 3. Detection of enzyme activity of Aspergillus niger catalase expression-enhanced strains mediated by different promoters

[0100] The method of Example 2 was used to culture the Aspergillus niger catalase expression enhanced strains AnP16-CatR, AnP51-CatR, AnP52-CatR, AnP60-CatR, AnP67-CatR and AnP gpdA -CatR, and the crude enzyme solution was prepared by the method of Example 2.

[0101] Catalase activity determination: dilute the crude enzyme solution directly with buffer to the appropriate concentration. 50mM phosphate buffer (0.27% potassium dihydrogen phosphate, 0.53% potassium dihydrogen phosphate, pH7.0), hydrogen peroxide substrate: add 0.1mL of 30% hydrogen peroxide solution to 50ml of 50mM phosphate buffer so that its absorbance at 240nm is between 0.53-0.55. Take 1 test tube and add 2.9mL of phosphate buffer and 0.1mL of enzyme solution as blank zero adjustment. Take 3 test tubes, mix 0.1mL of enzyme solution with 2.9mL of hydrogen peroxide substrate buffer, and then measure the time T used for the absorbance of the reaction system at 240nm to drop from 0.45 to 0.40. The time used must be between 0.27-0.40min. Enzyme activity calculation method: The time taken for the absorbance at 240nm to drop from 0.45 to 0.40 corresponds to the degradation of 3.45μmol hydrogen peroxide in 3mL solution. The calculation formula for catalase is 3.45×D / (T×0.1mL enzyme solution volume)=34.5×D / T. Where D is the enzyme solution dilution factor, and T is the time taken for the absorbance at 240nm to drop from 0.45 to 0.40. The enzyme activity unit is defined as 1 enzyme activity unit (U) under pH 7.0 and 30°C conditions. The results showed that with the strong promoter P gpdA In comparison, the enzymatic activity of catalase mediated by the five promoters provided by the present invention is significantly improved.

[0102] Example 4 Effects of different promoters on the transformation of citric acid strains

[0103] 1. Construction of Aspergillus niger expression vectors mediated by different promoters

[0104] The upstream primers and downstream primers of the citric acid efflux protein encoding gene cexA were used to amplify the gene fragment of the citric acid efflux protein by PCR using the genome of the Aspergillus niger M202 strain as a template. The specific primer sequences are shown in Table 6.

[0105] Table 6 Primers for the construction of citric acid efflux protein Aspergillus niger expression vector

[0106]

[0107]

[0108] The PCR reaction system and PCR reaction conditions were the same as those in Example 1. After the PCR product was purified, it was digested with the plasmids pP16, pP60, pP67 and pP gpdA, or plasmids pP51 and pP52 digested with restriction endonucleases SphI and KpnI, and then transformed into Escherichia coli Trans-T1 using the Novozymes ligase-independent single fragment rapid cloning kit (Cat. No.: C112-01). After extracting the corresponding recombinant plasmids, restriction digestion and sequencing were used to verify the expression of citric acid efflux protein vectors pP16-CexA, pP51-CexA, pP52-CexA, pP60-CexA, pP67-CexA and pP gpdA -CexA, where pP gpdA -CexA served as a control.

[0109] 2. Construction of a recombinant strain of Aspergillus niger with enhanced expression of citric acid efflux protein

[0110] According to the method of Example 1, the citric acid efflux protein expression vectors pP16-CexA, pP51-CexA, pP52-CexA, pP60-CexA, pP67-CexA and pP gpdA -CexA was transformed into Aspergillus niger M202 strain to obtain Aspergillus niger strains with enhanced expression of citric acid efflux protein mediated by each promoter, which were named AnP16-CexA, AnP51-CexA, AnP52-CexA, AnP60-CexA, AnP67-CexA and the control strain AnP gpdA -CexA.

[0111] 3. Citric acid fermentation of Aspergillus niger citric acid efflux protein expression-enhanced strains mediated by different promoters

[0112] The expression of citric acid efflux protein in Aspergillus niger strains AnP16-CexA, AnP51-CexA, AnP52-CexA, AnP60-CexA, and AnP67-CexA were compared with the control strain AnP gpdA -CexA were inoculated on PDA medium and cultured at 30°C for 5 days, then spores were collected with 0.9% saline and counted using a hemocytometer. 6 The inoculum size of 1 mL was inoculated into citric acid fermentation medium (corn starch medium, total sugar content 12%) and cultured at 34°C and 250 r / min for 96 h.

[0113] The fermentation supernatant was collected by rapid filtration, diluted 10 times, heated and boiled for 10 minutes, filtered through a filter membrane, and then the citric acid content was detected by HPLC. The specific detection conditions were: using a chromatographic column Aminex HPX-87H (300mm X 7.8mm X 9μm, BioRad), Shimadzu UFLC high performance liquid chromatograph (equipped with Shimadzu LC-20AD infusion pump, SPD-20A UV detector, CTO-20A / AC column oven, SIL-20ACHT UFLC specification automatic sampler, Shimadzu LCsution workstation), mobile phase A was ultrapure water, mobile phase B was 2.75mM H2SO4, flow rate was 0.6mL / min, injection volume was 10uL, column temperature was 50℃, and UV detection wavelength was 210nm. gpdA Compared with the control strain mediated by the promoter, the citric acid fermentation levels of the strains mediated by the five promoters provided by the present invention were significantly improved, among which the citric acid production of the strains mediated by P16, P52 and P60 was increased by 15.25%, 25.42% and 42.37% compared with the control strain, and the effect was very significant. In particular, the citric acid fermentation levels of the strains mediated by P51 and P67 were increased by 62.71% and 86.44% respectively, and the effect was extremely significant ( Figure 2 ).

[0114] Example 5 Application effect of truncated promoter in transformation of citric acid strains

[0115] 1. Construction of Aspergillus niger expression vectors mediated by promoters of different lengths

[0116] In order to verify whether nucleic acid sequences of different lengths still have promoter activity, pP16-CexA, pP51-CexA, pP52-CexA, pP60-CexA, and pP67-CexA were used as templates, and reverse amplification was performed with upstream primers of promoter fragments of different lengths and downstream primers of the vector to construct citrate efflux protein expression vectors mediated by promoters of different lengths. The specific primer sequences are shown in Table 7.

[0117] Table 7 Primers for the construction of citric acid efflux protein Aspergillus niger expression vector

[0118] Primer name Primer sequences Sequence number P16-m1-F <h2 style=";text-align:left;direction:ltr">cacacaggaaacagctatgacGTTGCCTGGGCCAGCATTAG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 46 <h2 style=";text-align:left;direction:ltr"> P51-m1-F <h2 style=";text-align:left;direction:ltr"> cacacaggaaacagctatgacTTCGTCCGCGCTACTAGGAA <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 47 <h2 style=";text-align:left;direction:ltr"> P51-m2-F <h2 style=";text-align:left;direction:ltr"> cacacaggaaacagctatgacAAGGAATTGCGCTCCAACC <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 48 <h2 style=";text-align:left;direction:ltr"> P51-m3-F <h2 style=";text-align:left;direction:ltr"> cacacaggaaacagctatgacTGCATCCCCGGTTTTAGTCG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 49 <h2 style=";text-align:left;direction:ltr"> P52-m1-F <h2 style=";text-align:left;direction:ltr"> cacacaggaaacagctatgacAAGAAGTAGCCTGTAGCAAG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 50 <h2 style=";text-align:left;direction:ltr"> P60-m1-F <h2 style=";text-align:left;direction:ltr"> cacacaggaaacagctatgacTTCACTACCGATGCAGTACC <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 51 <h2 style=";text-align:left;direction:ltr"> P67-m1-F <h2 style=";text-align:left;direction:ltr"> cacacaggaaacagctatgacACTAGGGATAACGGATGATAC <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 52 <h2 style=";text-align:left;direction:ltr"> Rev-R <h2 style=";text-align:left;direction:ltr"> GTCATAGCTGTTTCCTGTGTG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO: 53

[0119] The PCR reaction system and PCR reaction conditions are the same as in Example 1. After the PCR product is purified, the homology arms on the primers are used to perform a recombination reaction using the Novagen non-ligase-dependent single fragment rapid cloning kit (Cat. No.: C112-01), and then transformed into Escherichia coli Trans-T1. After extracting the corresponding recombinant plasmid, sequencing verification was used to obtain citric acid efflux protein expression vectors pP16-m1-CexA, pP51-m1-CexA, pP51-m2-CexA, pP51-m3-CexA, pP52-m1-CexA, pP60-m1-CexA and pP67-m1-CexA mediated by promoters of different lengths. The promoter information in the expression vector after the promoter is truncated to different lengths is shown in Table 8 of SEQ ID NO:54-60.

[0120] Table 8 Information of promoter fragments after truncation of each promoter

[0121]

[0122]

[0123] 2. Construction of recombinant Aspergillus niger strains with truncated promoter

[0124] According to the method of Example 1, the citric acid efflux protein expression vectors pP16-m1-CexA, pP51-m1-CexA, pP51-m2-CexA, pP51-m3-CexA, pP52-m1-CexA, pP60-m1-CexA, and pP67-m1-CexA were transformed into the Aspergillus niger M202 strain to obtain Aspergillus niger strains with enhanced expression of citric acid efflux proteins mediated by each promoter, which were named AnP16-m1-CexA, AnP51-m1-CexA, AnP51-m2-CexA, AnP51-m3-CexA, AnP52-m1-CexA, AnP60-m1-CexA, and AnP67-m1-CexA, respectively.

[0125] 3. Citric Acid Fermentation of Recombinant Aspergillus Niger Strain with Truncated Promoter

[0126] The culture method of the Aspergillus niger citric acid efflux protein expression enhanced strain AnP16-m1-CexA, AnP51-m1-CexA, AnP51-m2-CexA, AnP51-m3-CexA, AnP52-m1-CexA, AnP60-m1-CexA, and AnP67-m1-CexA and the detection method of citric acid are the same as those in Example 4. The results show that compared with the respective full-length promoters, the truncated promoters in this example can still initiate the expression of citric acid efflux proteins, and the citric acid production is equivalent to the fermentation level of the expression strain mediated by the full-length promoter, indicating that the truncated nucleic acid sequence still has the activity of a strong promoter, that is, as long as the truncated nucleic acid sequence is contained, the function of a strong promoter can be fully possessed. Sequence Listing <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> Strong promoter derived from fungi and its application <160> 58 <170> PatentIn Version 3.1 <210> 1 <211> 805 <212> DNA <213> Aspergillus niger <400> 1 agcgcgaagg tgtggactcc aagaaaacgc tttggttcgg tcaagacggg gaaatggggag 60 aggaatggat atcttacgaa gccgaattac ggagaaaggg cccaaacatg taaattatgg 120 cctgtaggtc aatcagcaaa gggccgagcg gtgattgcga gtacaccgat cggtagacta 180 cggaagggat gaaaaagaca ggaaaatagc gagagctaca tgccgtttca gaggctatcg 240 aaatgatatt ccaaagtatc accagtagcc ataaccacta taataaagga cgaagatgag 300 agtgccttcg ttctctttga ccagaattc actcatagta tcaaagggta tttcccaata atgtcagcgg tcggagttgg ttactggcgc gatcgggaga tatcggctct tcgttgcctg 420 ggccagcatt agcgccggggt ccaggtttttt tttttgcaaa tttttttttc ttttcctggc 480 tatgtttttt ttcgttcccc ctaacaatgg gaggacctc cctactccgt accgggccaa ccaatccggc caatggaac tgggccgggga cgcccatcgc cgccgctgcc actgcaaatt caggccagcg aaaaacccaa caggcgtccta gcgtctccgc tcgcttcttc ccgcttacaa gagcccttcg ctcgctattt tttcttccct cccttccctt ctctcttctt ttctttccat 720 cccctttgaa gtgtcctgtt tgactggcac tatcatccat ctcctctctt tctttcctta 780 gttttcgttc atcacagccg tcaaa 805 <210> 2 <211> 1171 <212> DNA <213> Aspergillus niger <400> 2 60. atctagtata gtactacgga gtactaacct tgtactatac tctttccatc ccaacctgcg cccctcccct aattgcttat cattcgccca caaggcttgg acgaagcttg ttgtgcctgc 120 gccggtgccg cttccctccc ctcctcccct gccttttcgg gcgacgccat ccgcgcacta 180 accctccacg tattccaata taccaaatct gcccaaagcg ccagccagct tcctcaagcc 240 ttgcggtcag ataaggccct gtacctagct agttgccgct gctcccggcg ctgggccaag 300 ccgtcggacg tccgtcccccc ctctttcccc ctcctctccc ctctccactg gtggaacgat 360 gtctggctgt tgccatcgtt ctcagaagca acgccccctg gatcgggtgg ctgtcgtact 420 attgcatgtt cgtccgcgct actaggaaag tttttttccc acccggagta tccgtgttta 480 gtccgcgggc tggctgaccg gctagctggc cgtgccagtt gggtaaggtt ccaagggagg 540 accttactag gtagaaacgg gatccaacaa tgagggaaa agggcggata tggcttgccg 600 ggggttcatt gcggcctgga cgaagaaagg gagatgatca ctaatgcaac acaatcttgg 660 cttgcaagga attgcgctcc aaccagaatg tctctgcgta gggatgccaa ttcgtgcggg 720 ccatgctgga tggatagtac gctgctccac tctcgctcga ccttttgcag tccacaatcg 780 tttccccgta tcgttgggcg ggggcgtttt tctgcagcta tggttgctgc tgccccgacg 840 gtgaaccttt ctgcatcccc ggttttagtc gatttagtt ggcggggcctg gagattaac 900 tccgtcggac gaagaggagc agtggtgtca tcgtcggcgg attgcatgct atcggaagg 960 catggaagg ggaaaacatc aacttcattt gcaaacgct cgagcataa taggaggctg 1020 gattccgccg ttctgtgtc ttttctt catccagcat cgcaagctc catcagcatcg 1080 cctggttcgt tcttctcact cttccaccac cagccttgtc ataagttag ctcttcatct 1140 tttcgaagaa accaattctc caacgtcaa a 1171 <210> 3 <211> 1056 <212> DNA <213> Aspergillus niger <400> 3 gtgcggattg agttgtgtgg aaaggagggg ttactgcgc ctacttacag gtggcaggat 60 gcatctgcga tctgtatcag aagcatcatt actgtcatac cagctttagc cgtggcccag 120 gccgggaaga agacatggaa agaggagcca tggagcatcg tcaccccgt cctgagtagc 180 aacaccccgcc ttaccccgag ggatgcgga agatctcgct ggggaggta gcagtcgaag 240 cagcttcagc cagcgagagc agcgacagat gctggctgcc ccaccattcc cttggaaaga 300 ttcggaggac gagaccgtga gctttcccgg ggcacgcctt tgggggagtt tttggctcga 360 gcttacaaga agtagcctgt agcaagtctg tggtcgtgtt tattatttat ctactacttc 420 cccctcctcc ctcctcctct tgtgttaaga gtactctcaa aaaaagcctt tcttagatag 480 tacaaccacc atcttcaagg tcctgtaagt atgacttgtc ccatatactc attttatcac 540 ccctcccatc tttctctgtc catttcatcc tcctcttctt cctcttagct gctagtcatg 600 accccgccat catcccacca tgttgtgctt gacccctcca tctatccatc catccatcct 660 cctgtctata tgccatcact ccatcctgtc tgtctatcaa tgatctggca tctccggatt 720 tagcaccaag tcccattgat tagttgatca tttgggaaac ttggctgtgc cgagcctggt 780 ctatttgatg gatcggacct ctccacctct aattcccccc ccgtccttcc cttctccgtc 840 actcatccgc catccgctca ttctttttgg gtcctcggtg aacactcacc accttccccc 900 ccgctgctgc tagtgcacac cgaaacagca agtccggagc gcttacattt ttgcctcctc 960 cgttttttcc tatatctggg ccatgttctc cctttgccat ctttgttttc tcccagtttc 1020 actgatccat aactcatccc cctccagtcc atcaac 1056 <210> 4 <211> 1215 <212> DNA <213> Aspergillus niger <400> 4 gtgtgtgaca ggtccgagat gagaattggc agagcgacct ccgaagaggc atatatggtc 60 ggggaacagc cattgttgga gtaaattgag ttggctgatc tgccaaagat caggtggtgc 120 caggtattgc gcctgtcgag aatcaaccgg tccttgttcc ctccgagctc cacctatggt 180 ctagagccag tagtgggtag ggatttggta atggaggaat cgttcagatc atcggctccg 240 aggcacagta tgggaccacc tgcggcctca atattccgga atgtcgtgag gatatgaacc 300 tgtttgcacg gtttgctatg attgttgagt ttgtctgggt ttgggacccg gccggctga 360 gataagcatt ttgcatggtt tgctgggcta ccacccctgg gtccgaacat ccccaggcag 420 cagcacaaca tcaagcgggg ttgctccagg agtgaagaaa tgtgtcagtt actagcggag 480 tagattcaac tacgttactt ggcagatatt gaacgatctg agtcactcaa gaccagtcac 540 tagattggta gagtgtagaa ggtgtgggtg ctgcaccgag cggtagacag taatcattct 600 agcatggga accccataat ctaggcgctg atcctaagtg gaggctggag gcaacgcccg ccgagctacc acttcactac cgatgcagta ccgcgaaggc ggcccagctc gatgataacc agacggtatc atccgcattg gtcatttgga tgagtgcacg acatccacgt gccagaatga 780 cgacaggaac tgccctgacg gactggcttt cgatatccgg aagatgatcg aatgtgcttc 900. 900. 900. 900. 900. 900. 900. 900 ccgtgatcca cgcttgcctg gcggccttat cagccgtgga agccgttccc tcaccaaatg 960 acgcggggct gtcgccttca actctctcta caactgccat cctgctcacc ttttgtcatc atccatctat ctctctatct ctccatccat cctcctcca tccatcgtcc atctcaacct 1080 tttgtctgtt atctcttagc ttccatctag tctctgttac cctttttact cctcttcgtc tatttcgtca cttatctccc cccttaaggg acccgtcgga ccagacctac tagccgccct catctactta tcaaa <210> 5 <211> 869 <212> DNA <213> Aspergillus niger <400> 5 agggagaagg ggacaattta tatgtaagga aagaatgaag ggagggaccc gtagagacaa 60 gacaagaatg tttttttctc tccttttgt gacgacacga gggaaaaaag gaattgaacg 120 gaagggatcg gttcatacaa gtgtaaaata cacacacgac tacggaataa tcccatcaga 180 tgcagcaatg ggttatctga aggggagaga gatgtgtgag tgaatgagag agtaagccaa 240 tgctccatcg cggaccagca cggtcaggtg aagaccctga aaccattggc tgtaccagta 300 gtaactcccc tggttacccc catcccgaat gatcccgaag ggtgtgtatg tgtgtatgtg 360 tacacagtat gtgtaaggaa gtgtggtaag tgtgtatgtg cggtggaatg cccactgctt 420 tcccggggga aggaaaaagg atgatgagcc aaaaacgagg cgccaaacac ggtgtaaggg 480 aaaaagaagg gaaaaggataa actagggata acggatgata ccaaagacag acacaaacag 540 gaaaaaacagg aacaatacaa tacaaacaaa cggtgccaaa acaccaaaca aaaaagtagg 600 tagggctttt tttctggtc ccaacaaagc gcactaacac ccgacgggg ggctggggtgg 660 gaaaagggca aaaaaccgcg aaaatttagc gggagagtat ttatgtcccg gggggccttc 720 tgttgtcact tttcctccag ctttttcctc cagaaaagtt ctccttcctt ctttcccttc 780 ccaatcccat cattttctag agaaactcct ctctcagaac caccacaaac cactcgaggt 840 acgtacaagc ttatggtgag caagggcga 869 <210> 6 <211> 45 <212> DNA <213> Artificial sequence <400> 6 gggttgcggc cgctctagaa ctagtgttgc ctgggccagc attag 45 <210> 7 <211> 44 <212> DNA <213> Artificial sequence <400> 7 ccagcaagct tgtacgtacc tcgagacggc tgtgatgaac gaaa 44 <210> 8 <211> 44 <212> DNA <213> Artificial sequence <400> 8 gggttgcggc cgctctagaa ctagtcggag tactaacctt gtac 44 <210> 9 <211> 45 <212> DNA <213> Artificial sequence <400> 9 ccagcaagct tgtacgtacc tcgagtttga cgtttggaga attgg 45 <210> 10 <211> 45 <212> DNA <213> Artificial sequence <400> 10 gggttgcggc cgctctagaa ctagtcggat tgagttgtgt ggaaa 45 <210>11 <211> 45 <212>DNA <213>Artificial sequence <400>11 ccagcaagct tgtacgtacc tcgagctgga gggggatgag ttatg 45 <210>12 <211> 45 <212>DNA <213>Artificial sequence <400> 12 gggttgcggc cgctctagaa ctagttgtga caggtccgag atgag 45 <210>13 <211> 45 <212>DNA <213>Artificial sequence <400> 13 ccagcaagct tgtacgtacc tcgaggatga gggcggctag taggt 45 <210>14 <211> 45 <212>DNA <213>Artificial sequence <400> 14 gggttgcggc cgctctagaa ctagtaggga gaaggggaca attta 45 <210>15 <211> 45 <212>DNA <213>Artificial sequence <400>15 ccagcaagct tgtacgtacc tcgagtggtt tgtggtggtt ctgag 45 <210>16 <211> 45 <212>DNA <213>Artificial sequence <400> 16 gggttgcggc cgctctagaa ctagtctcag gaggcgaata gataa 45 <210> 17 <211> 45 <212> DNA <213> Artificial sequence <400> 17 ccagcaagct tgtacgtacc tcgagtgtct atgtggcggg gtaat 45 <210> 18 <211> 47 <212> DNA <213> Artificial sequence <400> 18 tttcgttcat cacagccgtc tcgagatgca gactctcctt gtgagct 47 <210> 19 <211> 47 <212> DNA <213> Artificial sequence <400> 19 ccaattctcc aaacgtcaaa ctcgagatgg tgagcaaggg cgaggag 47 <210> 20 <211> 47 <212> DNA <213> Artificial sequence <400> 20 cataactcat ccccctccag ctcgagatgg tgagcaaggg cgaggag 47 <210> twenty one <211> 46 <212> DNA <213> Artificial sequence <400> twenty one cctactagcc gccctcatcc tcgagatggt gagcaagggc gaggag 46 <210> twenty two <211> 46 <212> DNA <213> Artificial sequence <400> twenty two tcagaaccac cacaaaccac tcgagatggt gagcaagggc gaggag 46 <210> twenty three <211> 46 <212> DNA <213> Artificial sequence <400> twenty three ttaccccgcc acatagacac tcgagatggt gagcaagggc gaggag 46 <210> twenty four <211> 45 <212> DNA <213> Artificial sequence <400> twenty four cacaggcctt agcatgcgaa gatctttact tgtacagctc gtcca 45 <210> 25 <211> 47 <212> DNA <213> Artificial sequence <400> 25 tttcgttcat cacagccgtc tcgagatgca gactctcctt gtgagct 47 <210> 26 <211> 48 <212> DNA <213> Artificial sequence <400> 26 ccaattctcc aaacgtcaaa ctcgagatgc agactctcct tgtgagct 48 <210> 27 <211> 48 <212> DNA <213> Artificial sequence <400> 27 cataactcat ccccctccag ctcgagatgc agactctcct tgtgagct 48 <210> 28 <211> 47 <212> DNA <213> Artificial sequence <400> 28 cctactagcc gccctcatcc tcgagatgca gactctcctt gtgagct 47 <210> 29 <211> 47 <212> DNA <213> Artificial sequence <400> 29 tcagaaccac cacaaaccac tcgagatgca gactctcctt gtgagct 47 <210> 30 <211> 47 <212> DNA <213> Artificial sequence <400> 30 ttaccccgcc acatagacac tcgagatgca gactctcctt gtgagct 47 <210> 31 <211> 47 <212> DNA <213> Artificial sequence <400> 31 cacaggcctt agcatgcgaa gatcttcact gcatagaagc gtagtcc 47 <210> 32 <211> 46 <212> DNA <213> Artificial sequence <400> 32 tttcgttcat cacagccgtc tcgagatgcg tcatttctgg cttttg 46 <210> 33 <211> 47 <212> DNA <213> Artificial sequence <400> 33 ccaattctcc aaacgtcaaa ctcgagatgc gtcatttctg gcttttg 47 <210> 34 <211> 47 <212> DNA <213> Artificial sequence <400> 34 cataactcat ccccctccag ctcgagatgc gtcatttctg gcttttg 47 <210> 35 <211> 46 <212> DNA <213> Artificial sequence <400> 35 cctactagcc gccctcatcc tcgagatgcg tcatttctgg cttttg 46 <210> 36 <211> 46 <212> DNA <213> Artificial sequence <400> 36 tcagaaccac cacaaaccac tcgagatgcg tcatttctgg cttttg 46 <210> 37 <211> 46 <212> DNA <213> Artificial sequence <400> 37 ttaccccgcc acatagacac tcgagatgcg tcatttctgg cttttg 46 <210> 38 <211> 49 <212> DNA <213> Artificial sequence <400> 38 cacaggcctt agcatgcgaa gatctctact catccagcgc aaaccggtc 49 <210> 39 <211> 46 <212> DNA <213> Artificial sequence <400> 39 tttcgttcat cacagccgtc tcgagatgtc ttcaaccacg tcttca 46 <210> 40 <211> 47 <212> DNA <213> Artificial sequence <400> 40 ccaattctcc aaacgtcaaa ctcgagatgt cttcaaccac gtcttca 47 <210> 41 <211> 47 <212> DNA <213> Artificial sequence <400> 41 cataactcat ccccctccag ctcgagatgt cttcaaccac gtcttca 47 <210> 42 <211> 46 <212> DNA <213> Artificial sequence <400> 42 cctactagcc gccctcatcc tcgagatgtc ttcaaccacg tcttca 46 <210> 43 <211> 46 <212> DNA <213> Artificial sequence <400> 43 tcagaaccac cacaaaccac tcgagatgtc ttcaaccacg tcttca 46 <210> 44 <211> 46 <212> DNA <213> Artificial sequence <400> 44 ttaccccgcc acatagacac tcgagatgtc ttcaaccacg tcttca 46 <210> 45 <211> 44 <212> DNA <213> Artificial sequence <400> 45 cacaggcctt agcatgcgaa gatctctagt tgccgttggc tttg 44 <210> 46 <211> 41 <212> DNA <213> Artificial sequence <400> 46 cacacaggaa acagctatga cgttgcctgg gccagcatta g 41 <210> 47 <211> 41 <212> DNA <213> Artificial sequence <400> 47 cacacaggaa acagctatga cttcgtccgc gctactagga a 41 <210> 48 <211> 40 <212> DNA <213> Artificial sequence <400> 48 cacacaggaa acagctatga caaggaattg cgctccaacc 40 <210> 49 <211> 41 <212> DNA <213> Artificial sequence <400> 49 cacacaggaa acagctatga ctgcatcccc ggttttagtc g 41 <210> 50 <211> 41 <212> DNA <213> Artificial sequence <400> 50 cacacaggaa acagctatga caagaagtag cctgtagcaa g 41 <210> 51 <211> 41 <212> DNA <213> Artificial sequence <400> 51 cacacaggaa acagctatga cttcactacc gatgcagtac c 41 <210>52 <211> 42 <212>DNA <213>Artificial Sequence <400> 52 cacacaggaa acagctatga cactagggat aacggatgat ac 42 <210>53 <211> 21 <212>DNA <213>Artificial Sequence <400> 53 gtcatagctg tttcctgtgt g 21 <210>54 <211>393 <212>DNA <213>Artificial Sequence <400> 54 gttgcctggg ccagcattag cgccgggtcc aggttttttt tttgcaaatt tttttttctt 60 ttcctggcta tgtttttttt cgttccccct aacaatggga aggacctccc tactccgtac 120 cgggccaacc aatccggcca atggaaactg ggccgggacg cccatcgccg ccgctgccac 180 tgcaaattca ggccagcgaa aaacccaaga gcgtcctagc gtctccgctc gcttcttccc 240 gcttacaaga gcccttcgct cgctattttt tcttccctcc cttcccttct ctcttctttt 300 ctttccatcc cctttgaagt gtcctgtttg actggcacta tcatccatct cctctctttc 360 tttccttagt tttcgttcat cacagccgtc aaa 393 <210>55 <211>743 <212>DNA <213>Artificial Sequence <400> 55 ttcgtccgcg ctactaggaa agtttttttc ccacccggag tatccgtgtt tagtccgcgg 60 gctggctgac cggctagctg gccgtgccag ttgggtaagg ttccaaggga ggaccttact 120 aggtagaaac gggatccaac aatgagggga aaagggcgga tatggcttgc cgggggttca 180 ttgcggcctg gacgaagaaa gggagatgat cactaatgca acacaatctt ggcttgcaag 240 gaattgcgct ccaaccagaa tgtctctgcg tagggatgcc aattcgtgcg ggccatgctg 300 gatggatagt acgctgctcc actctcgctc gaccttttgc agtccacaat cgtttccccg 360 tatcgttggg cgggggcgtt tttctgcagc tatggttgct gctgccccga cggtgaacct 420 ttctgcatcc ccggttttag tcgattttag ttggcgggcc tggagattaa actccgtcgg 480 acgaagagga gcagtggtgt catcgtcggc ggattgcatg ctatcggaag agcatggaag 540 agggaaaaca tcaacttcat ttgcaaaacg ctcgagcata aatagaggcc tggattccgc 600 cgttctggtg tcttttcttc ttcatccagc atcgcaagtc tctcaagcat cgcctggttc 660 cgttctggtg tcttttcttc ttcatccagc atcgcaagtc tctcaagcat cgcctggttc 660 gttcttctca ctcttccacc accagccttg tcaataagtt agctcttcat cttttcgaag 720 gttcttctca ctcttccacc accagccttg tcaataagtt agctcttcat cttttcgaag 720 aaaccaattc tccaaacgtc aaa 743 aaaccaattc tccaaacgtc aaa 743 <210>56<210>56 <211>506<211>506 <212>DNA<212>DNA <213>人工序列<213>Artificial sequence <400> 56<400> 56 aaggaattgc gctccaacca gaatgtctct gcgtagggat gccaattcgt gcgggccatg 60 aaggaattgc gctccaacca gaatgtctct gcgtagggat gccaattcgt gcgggccatg 60 ctggatggat agtacgctgc tccactctcg ctcgaccttt tgcagtccac aatcgtttcc 120 ctggatggat agtacgctgc tccactctcg ctcgaccttt tgcagtccac aatcgtttcc 120 ccgtatcgtt gggcgggggc gtttttctgc agctatggtt gctgctgccc cgacggtgaa 180 ccgtatcgtt gggcgggggc gtttttctgc agctatggtt gctgctgccc cgacggtgaa 180 cctttctgca tccccggttt tagtcgattt tagttggcgg gcctggagat taaactccgt 240 cctttctgca tccccggttt tagtcgattt tagttggcgg gcctggagat taaactccgt 240 cggacgaaga ggagcagtgg tgtcatcgtc ggcggattgc atgctatcgg aagagcatgg 300 cggacgaaga ggagcagtgg tgtcatcgtc ggcggattgc atgctatcgg aagagcatgg 300 aagagggaaa acatcaactt catttgcaaa acgctcgagc ataaatagag gcctggattc 360 aagagggaaa acatcaactt catttgcaaa acgctcgagc ataaatagag gcctggattc 360 cgccgttctg gtgtcttttc ttcttcatcc agcatcgcaa gtctctcaag catcgcctgg 420 cgccgttctg gtgtcttttc ttcttcatcc agcatcgcaa gtctctcaag catcgcctgg 420 ttcgttcttc tcactcttcc accaccagcc ttgtcaataa gttagctctt catcttttcg 480 ttcgttcttc tcactcttcc accaccagcc ttgtcaataa gttagctctt catcttttcg 480 aagaaaccaa ttctccaaac gtcaaa 506 aagaaaccaa ttctccaaac gtcaaa 506 <210>57 <211>320 <212>DNA <213>Artificial sequence <400> 57 tgcatccccg gttttagtcg attttagttg gcgggcctgg agattaaact ccgtcggacg 60 aagaggagca gtggtgtcat cgtcggcgga ttgcatgcta tcggaagagc atggaagagg 120 gaaaacatca acttcatttg caaaacgctc gagcataaat agaggcctgg attccgccgt 180 tctggtgtct tttcttcttc atccagcatc gcaagtctct caagcatcgc ctggttcgtt 240 cttctcactc ttccaccacc agccttgtca ataagttagc tcttcatctt ttcgaagaaa 300 ccaattctcc aaacgtcaaa 320 <210>58 <211>690 <212>DNA <213>Artificial sequence <400> 58 aagaagtagc ctgtagcaag tctgtggtcg tgtttattat ttatctacta cttccccctc 60 ctccctcctc ctcttgtgtt aagagtactc tcaaaaaaag cctttcttag atagtacaac 120 caccatcttc aaggtcctgt aagtatgact tgtcccatat actcatttta tcacccctcc 180 catctttctc tgtccatttc atcctcctct tcttcctctt agctgctagt catgaccccg 240 cctcatccc accatgttgt gcttgacccc tccatctatc catccatcca tcctcctgtc 300 fathergccat cactccatcc tgtctgtcta tcaatgatct ggcatctccg gatttagcac caagtcccat tgattagttg atcatttggg aaacttggct gtgccgagcc tggtctattt 420 gatggatcgg acctctccac ctctaattcc ccccccgtcc ttcccttctc cgtcactcat 480 ccgccatccg ctcattcttt ttgggtcctc ggtgaacact caccaccttc ccccccgctg 540 ctgctagtgc acaccgaaac agcaagtccg gagcgcttac atttttgcct cctccgtttt ttcctatatc tgggccatgt tctccctttg ccatctttgt tttctcccag tttcactgat 660 690. tccccctc gtccatcac <210> 59 <211> 543 <212> DNA <213> The snowstorm <400> 59 ttcactaccg atgcagtacc gcgaaggcgg cccagctcga tgataaccag acggtatcat ccgcattggt catttggatg agtgcacgac atccacgtgc cagaatgacg acaggaactg ccctgacgga ctggctttcg atatccgga gatgatcgga tgtgcttcga atcgagccag cacatgaccc ggcctgactc acgtgtgggg ccgctcaccg cctccacccc gtgatccacg 240 cttgcctggc ggccttatca gccgtggaag ccgttccctc accaaatgac gcggggctgt 300 cgccttcaac tctctctaca actgccatcc tgctcacctt ttgtcatcat ccatctatct 360 ctctatctct ccatccatcc atcctccatc catcgtccat ctcaaccttt tgtctgttat 420 ctcttagctt ccatctagtc tctgttaccc tttttactcc tcttcgtcta tttcgtcact 480 tatctccccc cttaagggac ccgtcggacc agacctacta gccgccctca tctacttatc 540 aaa 543 <210>60 <211>369 <212>DNA <213> Aspergillus niger <400> 60 actagggata acggatgata ccaaagacag acacaaacag gaaaaacagg aacaatacaa 60 tacaaacaaa cggtgccaaa acaccaaaca aaaaagtagg tagggctttt ttttctggtc 120 ccaacaaagc gcactaacac ccgacggggg ggctgggtgg gaaaagggca aaaaaccgcg 180 aaaatttagc gggagagtat ttatgtcccg gggggccttc tgttgtcact tttcctccag 240 ctttttcctc cagaaaagtt ctccttcctt ctttcccttc ccaatcccat cattttctag 300 agaaactcct ctctcagaac caccacaaac cactcgaggt acgtacaagc ttatggtgag 360 caagggcga 369

Claims

1. A polynucleotide having promoter activity, characterized in that: The nucleotide sequence of the polynucleotide is shown in any one of SEQ ID NO: 2 and SEQ ID NO: 55-57.

2. A transcription expression cassette, characterized in that: Comprising the polynucleotide of claim 1.

3. The transcription expression cassette according to claim 2, characterized in that The transcription expression cassette also includes a protein encoding gene operably linked to the polynucleotide having promoter activity.

4. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the polynucleotide according to claim 1, or the transcription expression cassette according to claim 2 or 3.

5. A recombinant host cell, characterized in that Containing the transcription expression cassette of claim 3, or the recombinant expression vector of claim 4; the recombinant host cell is a non-animal or plant species.

6. The recombinant host cell according to claim 5, characterized in that The host cell is a fungus.

7. The recombinant host cell according to claim 6, characterized in that The host cell is Aspergillus niger ( Aspergillus niger ), Aspergillus nidulans ( Aspergillus nidulans ), Aspergillus oryzae ( Aspergillus oryzae ), Penicillium chrysogenum ( Penicilliumchrysogenum ), Trichoderma reesei ( Trichoderma reesei ), Ustilago maydis ( Ustilagomaydis ) or Myceliophthora thermophila ( Myceliophthora thermophila ).

8. Use of the polynucleotide of claim 1, the transcription expression cassette of claim 2 or 3, the recombinant expression vector of claim 4, or the host cell of any one of claims 5 to 7 in at least one of the following: (a) for enhancing the transcription level of a gene, or for preparing an agent for enhancing the transcription level of a gene; (b) for use in the preparation of proteins, or in the preparation of reagents for the preparation of proteins; (c) producing an organic acid or preparing a reagent for producing an organic acid.

9. The use according to claim 8, characterized in that The organic acid is selected from at least one of citric acid, succinic acid and malic acid.

10. A method for enhancing transcription of a target gene, characterized in that: The method comprises operably linking the polynucleotide of claim 1 to a target gene.

11. A method for preparing a protein, characterized in that: The method comprises the step of expressing the protein using the expression cassette according to claim 2 or 3, the recombinant expression vector according to claim 4, or the host cell according to any one of claims 5 to 7.

12. A method for producing an organic acid or enzyme preparation, characterized in that: Cultivate the host cell according to any one of claims 5 to 7 to produce an organic acid or an enzyme preparation, and collect the produced organic acid or enzyme preparation.

13. The production method according to claim 12, characterized in that The method also includes the step of separating the organic acid or enzyme preparation from the fermentation broth.

14. The production method according to claim 12 or 13, characterized in that The host cell is a fungus.

15. The production method according to claim 14, characterized in that The host cell is Aspergillus niger ( Aspergillus niger ), Aspergillus nidulans ( Aspergillus nidulans ), Aspergillus oryzae ( Aspergillus oryzae , Penicillium chrysogenum ( Penicilliumchrysogenum ), Trichoderma reesei ( Trichoderma reesei ), Ustilago maydis ( Ustilagomaydis ) or Myceliophthora thermophila ( Myceliophthora thermophila ); The organic acid is any one of citric acid, succinic acid and malic acid; the enzyme preparation is any one of glucoamylase, glucose oxidase, catalase and phytase.

Images