CD19 mutant protein and its application

Abstract

The present invention provides a mutated CD19 extracellular domain, wherein the mutated CD19 extracellular domain, compared with the amino acid sequence of the parent CD19 extracellular domain, has a mutation at any one or several of the following amino acid sites corresponding to the amino acid sequence shown in SEQ ID No.1: position 82, position 83, position 29, position 184 or position 234; the amino acid at position 82 mutates to V, the amino acid at position 83 mutates to L, the amino acid at position 29 mutates to G, the amino acid at position 184 mutates to P, and the amino acid at position 234 mutates to W.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a CD19 mutant protein and an application thereof. Background Art

[0002] CAR-T (Chimeric Antigen Receptor T-Cell Immunotherapy) is chimeric antigen receptor T cell immunotherapy. Its main principle is to separate T cells from cancer patients, use genetic engineering technology to introduce a chimeric antibody that can recognize tumor cells and activate T cells at the same time, that is, to prepare CAR-T cells, and then return the amplified CAR-T cells to the patient's body, further amplify them in the patient's body, and kill and eliminate cancer cells by enhancing the patient's own immunity. Among them, CAR, or chimeric antigen receptor, is the core element of this treatment. The basic design of CAR includes a tumor-associated antigen (TAA) binding region (usually derived from the ScFv segment of the monoclonal antibody antigen binding region), an extracellular hinge region, a transmembrane region and an intracellular signal region. Among them, the tumor-associated antigen binding region is responsible for identifying tumor cell surface antigens, which is equivalent to the "GPS navigation" function. As a new type of therapeutic drug, CAR-T has so far shown significant effects in blood tumors such as leukemia, lymphoma, and multiple myeloma. In particular, CAR-T targeting CD19 has a very significant effect in acute lymphoblastic leukemia and non-Hodgkin's lymphoma. Currently, the FDA has approved the marketing of two CAR-T cell drugs, namely Kymriah from Novartis and Yescarta from Gilead. Both drugs target CD19-positive B-cell leukemia and use the same antigen binding region, namely ScFv (single chain antibody fragment) derived from the mouse monoclonal antibody FMC63.

[0003] After being injected into the patient's body, the number of CAR-T cells will increase rapidly in most cases, which is a necessary condition for the treatment effect. Another important indicator is whether there are still residual CAR-T positive cells in the patient's body six months after the CAR-T cells are injected into the patient; usually, there will be a relapse of the disease if there are no residual CAR-T positive cells.

[0004] As a "living drug", CAR-T cells have a complex preparation process and many quality control links. First, the efficiency of virus-infected cells varies with different patients or other factors. Therefore, it is very important to properly control the number of effective transfected cells infused back into the patient. Too few effective cells are ineffective; while too many effective cells can lead to serious side effects such as cytokine storm (with a high mortality rate). Therefore, accurate detection of positive T cells expressing CAR is a key step in the quality control of CAR-T drugs, and is also an important link in clinical patient treatment dose control, process monitoring and companion diagnosis. CAR-T target protein is the most ideal reagent for CAR-T detection, but the affinity of CAR-T target protein binding to its corresponding antibody is low, resulting in low detection sensitivity of clinical samples, which cannot meet clinical needs. Taking CD19 CAR-T as an example, the affinity of CD19 to its antibody and its single-chain antibody is very low, which cannot meet the needs of detection and needs to be greatly improved. At the same time, the stability of CD19 is also poor, and the existing biological characteristics cannot become a stable and efficient flow detection reagent. In addition, CD19 is a highly glycosylated glycoprotein on the surface of B cells, which is more difficult to express in model cells such as Escherichia coli and yeast. We will use the efficient CHO cell evolution platform established in our laboratory to obtain high-affinity, high-specificity, and high-stability mutants with CD19 as a model protein to meet the clinical testing needs of CAR-T.

[0005] The detection of CAR-T expression positivity rate is an important part of CAR-T therapy quality control, and there is currently no standard detection scheme. In both clinical and scientific research, a method that can be used to evaluate or monitor the effectiveness of CAR therapy in subjects is needed. This method can accurately distinguish between positive CAR-T cells and negative CAR-T and the activity level of positive cells (i.e., the number of CARs on a single cell) before and after the reinfusion of the subject, and can be used simultaneously with reagents for detecting other characteristics of CAR-T cells without interfering with each other, thereby providing each subject with accurate and effective treatment, and objectively and accurately evaluating or monitoring the effectiveness of CAR therapy on the subject.

[0006] So far, there are two types of commonly used methods for detecting the CAR-T positivity rate: detecting CAR gene-positive T cells and detecting CAR protein-positive T cells, namely, PCR detection of CAR copy number and flow cytometry detection of CAR-T cells.

[0007] The CAR gene integrated into the cell genome and the copy number of the CAR gene are detected by qPCR. This method has high sensitivity and is used for pre- and post-transfusion detection of almost all subjects, and is applicable to all targets. However, this method cannot accurately reflect the positive T cells expressing CAR, cannot determine the ratio of positive cells to negative cells, cannot determine the type and ratio of CAR-positive T cells, cannot determine the density of CAR on a single CAR-positive cell, and cannot determine the density distribution of CAR in the cell population. In addition, due to the particularity of CAR-T therapy itself and the individual differences between patients, the construction process of CAR-T cells and the expansion process after transfusion require simultaneous detection of multiple surface markers of T cells (CD3, CD4, CD8, etc.). Therefore, this method needs to be combined with other flow detection methods, and all indicators cannot be obtained using one test and the same sample.

[0008] For the flow cytometry detection of CAR protein-positive T cells, the existing detection reagents also have various shortcomings, and the detection effect is difficult to be satisfactory. Among them, anti-mouse IgG (Fab') 2 and Protein L are more commonly used, but there are problems such as poor specificity, high background, and low sensitivity. They can only be used for detection when the CAR positive rate is high before reinfusion. In addition, due to the lack of target specificity, when two or more targets are used for CAR-T treatment at the same time, different CAR receptors cannot be distinguished. In clinical and scientific research progress, CAR-T treatment targeting more than two targets has made significant progress. For example, the latest studies have shown that CD19 is not the only effective target of CAR-T cells against B cell malignancies. Targeted therapy for both CD19 and CD22 antigens can reduce the possibility of tumor escape through antigen loss, thereby achieving a higher remission rate.

[0009] Another target protein linked to a tag is the most ideal reagent for detecting CAR-T positive cells. There are reports that the CD19 extracellular region was linked to an Fc tag and expressed in 293T cells. The fusion protein was purified and used to detect the positive rate of CAR-T cells. The results showed that the background of CD19-Fc fusion protein as a detection reagent was lower than that of anti-mouse IgG (Fab') 2 and Protein L, and there was basically no non-specific binding. However, its affinity is low (we used SPR to detect the affinity of CD19-Fc binding to the corresponding antibody, Kd>10 -7M), the sensitivity is not significantly different from that of anti-mouse IgG (Fab') 2 antibody and Protein L, and is even slightly lower, which cannot meet the requirements of high sensitivity for scientific research and clinical testing. The low affinity between ScFv on CAR and the corresponding target molecule is common. There is no clear quantitative relationship between the affinity between ScFv and the corresponding target molecule and the therapeutic effect of CAR-T. For some target molecules, the corresponding ScFv has a high affinity and a good therapeutic effect, while for other target molecules, the corresponding ScFv has a high affinity and a poor therapeutic effect. For CAR-T cells prepared with low-affinity ScFv (such as CD19 and CD22), the use of Fc-coupled targets as detection reagents has low sensitivity and cannot meet clinical needs. Therefore, increasing the affinity between the target protein and its single-chain antibody to improve the detection sensitivity is an effective solution. Summary of the invention

[0010] CD19 is a coreceptor that amplifies signaling cascades in B cells. On the surface of B cells, CD19 binds to CD21, CD81, and Leu-13 to exert its function. The cytoplasmic tail of CD19 has nine conserved tyrosine residues that play a key role in CD19-mediated functions by coupling signaling molecules to the receptor. Mature human CD19 consists of an extracellular domain (ECD) and two Ig-like domains, a transmembrane segment, and a cytoplasmic domain.

[0011] On the one hand, the present invention provides a mutated CD19 extracellular domain, which, compared with the amino acid sequence of the parent CD19 extracellular domain, has a mutation at any one or several of the following amino acid sites corresponding to the amino acid sequence shown in SEQ ID No. 1: position 82, position 83, position 75, position 29, position 184, or position 234.

[0012] In one embodiment, the mutated CD19 extracellular domain has a mutation at the above-mentioned amino acid site 82; further, based on the mutation at the amino acid site 82, it also includes mutations at the above-mentioned amino acid sites 75 and 83.

[0013] In one embodiment, the mutated CD19 extracellular domain has a mutation at the above-mentioned amino acid site 83; further, based on the mutation at the amino acid site 83, it also includes a mutation at the above-mentioned amino acid site 75.

[0014] In one embodiment, the mutated CD19 extracellular domain has mutations at the above-mentioned amino acid positions 29 and 75.

[0015] In one embodiment, the mutated CD19 extracellular domain has mutations at the above-mentioned amino acid positions 75, 151, 184 and 234.

[0016] In one embodiment, the amino acid at position 82 mutates to V, the amino acid at position 83 mutates to L, the amino acid at position 75 mutates to I, the amino acid at position 29 mutates to G, the amino acid at position 184 mutates to P, and the amino acid at position 234 mutates to W.

[0017] In one embodiment, the parent CD19 extracellular domain is a human CD19 extracellular domain.

[0018] In one embodiment, the amino acid sequence of the parent CD19 extracellular domain has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to SEQ ID No.1.

[0019] It is clear to those skilled in the art that the structure of a protein can be changed without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and embodiments of conservative amino acid substitutions are clear to those skilled in the art. Specifically, the amino acid residue can be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., another non-polar amino acid residue can be substituted with a non-polar amino acid residue, another polar non-charged amino acid residue can be substituted with a polar uncharged amino acid residue, another basic amino acid residue can be substituted with a basic amino acid residue, and another acidic amino acid residue can be substituted with an acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by a genetic code. As long as the substitution does not result in the inactivation of the biological activity of the protein, a conservative substitution in which an amino acid is replaced by other amino acids belonging to the same group falls within the scope of the present invention. Therefore, the protein of the present invention may contain one or more conservative substitutions in the amino acid sequence. In addition, the present invention also encompasses proteins that also contain one or more other non-conservative substitutions, as long as the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention.

[0020] Conservative amino acid substitutions can be performed at one or more predicted non-essential amino acid residues. "Non-essential" amino acid residues are amino acid residues that can be changed (deleted, substituted or replaced) without changing biological activity, while "essential" amino acid residues are required for biological activity. "Conservative amino acid substitutions" are substitutions in which amino acid residues are replaced by amino acid residues with similar side chains. Amino acid substitutions can be performed in the non-conserved regions of the above-mentioned Cas mutant proteins. In general, such substitutions are not performed on conserved amino acid residues, or are not performed on amino acid residues located in conserved motifs, where such residues are required for protein activity. However, it will be appreciated by those skilled in the art that functional variants may have fewer conservative or non-conservative changes in conserved regions.

[0021] In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

[0022] The term "AxxB" means that the amino acid A at position xx is changed to amino acid B, for example, E29G means that E at position 29 is mutated to G. When multiple amino acid sites are mutated at the same time, a similar form of M75I+L82V+F83L can be used to express it, for example, M75I+L82V+F83L means that M at position 75 is mutated to I, L at position 82 is mutated to V, and F at position 83 is mutated to L.

[0023] On the other hand, the present invention also provides a gene encoding the above-mentioned mutated CD19 extracellular domain.

[0024] On the other hand, the present invention also provides a CD19 extracellular domain comprising the above mutation, or a vector or cell encoding the above gene.

[0025] On the other hand, the present invention provides the use of the above-mentioned mutated CD19 extracellular domain as an antigen in the preparation of an immune reagent, for example, an anti-CD19 antibody or a CD19-specific immune cell.

[0026] On the other hand, the present invention also provides a composition comprising the above-mentioned mutant CD19 extracellular domain and a detectable label. In one embodiment, the label can be self-detectable, such as radioisotope labeling or fluorescent labeling, or in the case of enzyme labeling, can catalyze the chemical change of a detectable substrate compound or composition.

[0027] On the other hand, the present invention also provides a diagnostic preparation comprising the above-mentioned mutated CD19 extracellular domain.

[0028] On the other hand, the present invention also provides the use of the above-mentioned mutated CD19 extracellular domain in detecting anti-CD19 immune reagents, or in preparing a product for detecting anti-CD19 immune reagents, and the product can be a diagnostic preparation or a diagnostic kit.

[0029] The above-mentioned anti-CD19 immune agent is selected from antibodies, antibody fragments, antibody fusion constructs, bispecific antibodies, trispecific antibodies, immunotoxins, chimeric antigen receptors (CAR), human or non-human (e.g., animal or artificial) cells, such as T cells, NK cells or other immune cells, particularly those cells engineered to express chimeric antigen receptors (CAR).

[0030] In one embodiment, the anti-CD19 immune agent is a CAR-T cell targeting CD19.

[0031] In one embodiment, the anti-CD19 immune agent is an anti-CD19 antibody, for example, FMC63.

[0032] On the other hand, the present invention also provides a method for detecting an anti-CD19 immune agent in a sample, the method comprising the step of detecting the anti-CD19 immune agent in the sample using the above-mentioned mutated CD19 extracellular domain.

[0033] The sample includes, but is not limited to, a sample from a patient or non-human animal (e.g., an animal; for example, a tissue or body fluid, in particular blood, plasma, serum, urine or bone marrow biopsy) and a therapeutic or diagnostic product (e.g., a recombinantly expressed protein, in particular an antibody, an antibody fragment, an antibody fusion construct, a bispecific antibody, a trispecific antibody, an immunotoxin, an engineered alternative binder scaffold, a CAR, a human or non-human (e.g., an animal or artificial) cell, such as a T cell, a NK cell or other immune cell, in particular those cells engineered to express a chimeric antigen receptor (CAR).

[0034] On the other hand, the present invention also provides a pharmaceutical preparation comprising the above-mentioned mutated CD19 extracellular domain, the pharmaceutical preparation also comprising a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers generally include any and all suitable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption delay agents that are physiologically compatible with the antibodies or related compositions or compositions provided by the present invention. Other examples of pharmaceutically acceptable carriers include sterile water, saline, phosphate buffered saline, glucose, glycerol, ethanol, polyethylene glycol, etc., and any combination thereof. According to a specific aspect, the present invention also provides nucleic acid molecules encoding CD19-ECD described herein.

[0035] On the other hand, the present invention also provides a method for producing the above-mentioned mutated CD19 extracellular domain, which comprises the step of expressing a gene encoding the above-mentioned mutated CD19 extracellular domain. SEQUENCE LISTING <110> Haike Molecular (Beijing) Technology Co., Ltd. <120> CD19 mutant protein and its application <130> 11 <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 279 <212> PRT <213> Artificial Sequence <220> <223> CD19 <400> 1 Met Pro Pro Pro Arg Leu Leu Phe Phe Leu Leu Phe Leu Thr Pro Met 1 5 10 15 Glu Val Arg Pro Glu Glu Pro Leu Val Val Lys Val Glu Glu Gly Asp 20 25 30 Asn Ala Val Leu Gln Cys Leu Lys Gly Thr Ser Asp Gly Pro Thr Gln 35 40 45 Gln Leu Thr Trp Ser Arg Glu Ser Pro Leu Lys Pro Phe Leu Lys Leu 50 55 60 Ser Leu Gly Leu Pro Gly Leu Gly Ile His Met Arg Pro Leu Ala Ile 65 70 75 80 Trp Leu Phe Ile Phe Asn Val Ser Gln Gln Met Gly Gly Phe Tyr Leu 85 90 95 Cys Gln Pro Gly Pro Pro Ser Glu Lys Ala Trp Gln Pro Gly Trp Thr 100 105 110 Val Asn Val Glu Gly Ser Gly Glu Leu Phe Arg Trp Asn Val Ser Asp 115 120 125 Leu Gly Gly Leu Gly Cys Gly Leu Lys Asn Arg Ser Ser Glu Gly Pro 130 135 140 Ser Ser Pro Ser Gly Lys Leu Met Ser Pro Lys Leu Tyr Val Trp Ala 145 150 155 160 Lys Asp Arg Pro Glu Ile Trp Glu Gly Glu Pro Pro Cys Leu Pro Pro 165 170 175 Arg Asp Ser Leu Asn Gln Ser Leu Ser Gln Asp Leu Thr Met Ala Pro 180 185 190 Gly Ser Thr Leu Trp Leu Ser Cys Gly Val Pro Pro Asp Ser Val Ser 195 200 205 Arg Gly Pro Leu Ser Trp Thr His Val His Pro Lys Gly Pro Lys Ser 210 215 220 Leu Leu Ser Leu Glu Leu Lys Asp Asp Arg Pro Ala Arg Asp Met Trp 225 230 235 240 Val Met Glu Thr Gly Leu Leu Leu Pro Arg Ala Thr Ala Gln Asp Ala 245 250 255 Gly Lys Tyr Tyr Cys His Arg Gly Asn Leu Thr Met Ser Phe His Leu 260 265 270 Glu Ile Thr Ala Arg Pro Val 275 BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 , construction of CHO-CD19 cell line; A. Flow chart of cell line construction; B. Sorting of CHO-CD19 positive cells; C. Flow cytometer detection of CD19 display rate of sorted cells and its affinity with the ligand antiCD19-ScFv-EGFP protein.

[0037] Figure 2 , CD19 affinity optimization flow chart.

[0038] Figure 3 , the implementation process of affinity optimization of CD19 extracellular region.

[0039] Figure 4 , flow cytometry was used to detect the binding ability of cells sorted after four rounds of evolution with single-chain antibodies.

[0040] Figure 5 , flow cytometry was used to detect the binding ability of CD19 mutants and their single-chain antibodies.

[0041] Figure 6, flow cytometry was used to detect the ability of CD19-wt-mFc and CD19-Mut9-mFc of different concentrations to bind to CAR-positive cells. A and B are the detection results of CD19-wt-mFc and CD19-Mut9-mFc of different concentrations, respectively. Each fusion protein (CD19-wt-mFc, CD19-Mut9-mFc) was diluted in a gradient (0.3, 0.1, 0.03, 0.01, 0.0003, 0ug / 20ul), and 5X10 5 In CD19CAR-T cells, the cells were incubated on ice for 30 min, and the binding intensity was detected using anti-mouse IgG flow cytometry antibody (with APC fluorescence signal).

[0042] Figure 7 , flow cytometry was used to detect the sensitivity of CD19-Mut9 to CD19CAR-T(+) cells. Different amounts of CD19 CAR+ cells (3x10 5 , 3x10 4 , 3x10 3 , 3x10 2 , 3x10, 0 cells) added to the control 1x10 6 In hPBMC, used as test cells, flow cytometry experiments were performed after adding fluorescent secondary antibodies. When the participation rate was as low as 0.03%, the Mut9 protein could still effectively detect positive cells, while the wild-type CD19 protein could not detect low-concentration positive cells.

[0043] Figure 8 , The detection sensitivity of different detection concentrations on CD19CAR-T(+) cells. Different amounts of CD19 CAR+ cells (3x10 4 , 3x10 3 , 3x10 2 , 0 cells) added to the control 1x10 6 hPBMCs were used as test cells and flow cytometry was performed after adding fluorescent secondary antibodies. The positive rate of CD19CAR-T was detected with 0.3μg and 0.03μg of protein. Mut9 protein was able to maintain high sensitivity and low detection background for cells with different positive rates at different detection concentrations, while CD19-WT protein could not effectively detect samples with low CD19CAR-T positive rates at low concentrations. The horizontal axis is the binding strength of the detection protein to CD19CAR-T cells.

[0044] Fig. 9, Mut9 and CD19-WT protein detection signal comparison. Mut9 protein has a higher detection signal at different detection concentrations. The lower the concentration, the more obvious the advantage over CD19-WT, which can obviously better meet the needs of scientific research and clinical flow cytometry. The horizontal axis is the binding strength between the detection protein and CD19CAR-T cells, and the vertical axis is the number of cells.

[0045] Fig.10 , Comparison of signal-to-noise ratio of Mut9 and CD19-WT protein detection.

[0046] Mut9 protein has a high signal-to-noise ratio at different detection concentrations. The lower the concentration, the more obvious its advantage over CD19-WT, and it can obviously better meet the needs of scientific research and clinical flow cytometry. The horizontal axis is the binding strength between the detection protein and CD19CAR-T cells, and the vertical axis is the number of cells.

[0047] Fig.11 , Comparison of detection signals with different fluorescent markers. Mut9 protein can be used for CD19CAR-T positive cell detection under different fluorescent markers. The horizontal axis is the binding strength between the detection protein and CD19CAR-T cells, and the vertical axis is the number of cells.

[0048] Fig.12 , the effect of simplifying the experimental steps on the flow cytometry results. The horizontal axis is the binding strength between the detection protein and CD19CAR-T cells, and the vertical axis is the number of cells.

[0049] Fig.13 , Mut9 and anti-Fab antibodies were used to compare the sensitivity. Five concentrations of 0.1μg, 0.03μg, 0.01μg, 0.003μg, and 0.001μg were used to detect CD19CAR-T cell samples. The horizontal axis is the binding strength between the detection protein and CD19CAR-T cells, and the vertical axis is the number of cells.

[0050] Fig.14 , Affinity detection. The affinity of Mut9 protein reached 6.6E-09 (M), and the affinity of CD19 wild protein and single-chain antibody FMC63 was too low to be detected by the instrument.

[0051] Fig.15 , CD19-wt, anti-mouse IgG (Fab') (Jackson ImmunoResearch) and CD19-Mut9 flow cytometry results of samples from the same patient before transfusion. A, CD19-wt test results; B, Anti-Fab antibody test results; C, CD19-Mut9 test results. Implementation

[0052] The present invention is further described below in conjunction with the embodiments. The following description is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention falls within the protection scope of the present invention.

[0053] In this embodiment, some of the technologies used can refer to the applicant's prior patent, CN104531623B. In a specific embodiment, the technology involved in the present invention can refer to the following scheme.

[0054] 1. Construction and amplification of replacement plasmid pFRT-CD19-G4S-HA:

[0055] Replace the PuroR gene in the target cell line and stably display CD19-G4S-HA on the cell surface.

[0056] PUC57-CD19-G4S-HA (CD19-G4S-HA sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd. and then linked to the vector PUC57) was used as the amplification template. The template contained the following base sequence, which was linked to G4Slinker and HA Tag at the C-terminus after sequence optimization by Nanjing GenScript.

[0057] atgccccctccaaggctgctgttctttctgctgttcctgaccccaatggaggtgcggcca (signal peptide)

[0058] gaggagccactggtggtgaaggtggaggagggcgacaacgctgtgctgcagtgcctgaagggcacatctgatggccccacccagcagctgacatggtctagagagtcccctctgaagccatttctgaagctgtccctgggactgcctggactgggcatccacatgcgcccactggctatctggctgttcatcttcaacgtgtcccagcagatgggaggcttctacctgtgccagccaggaccacctagcgagaaggcttggcagcctggatggaccgtgaacgtggagggaagcggagagctgtttaggtggaacgtgtccgacctgggaggactgggatgtggcctgaagaaccggtccagcgagggaccctcttccccttccggcaagctgatgagcccaaagctgtacgtgtgggctaaggatagaccagagatctgggagggagagccaccatgcctgcctccacgcgacagcctgaatcagagcctgtctcaggatctgaccatggcccccggctctacactgtggctgtcctgtggagtgccacctgactccgtgagcaggggccctctgtcttggacacacgtgcatccaaagggccccaagagcctgctgtctctggagctgaaggacgataggcctgcccgggacatgtgggtcatggagaccggcctgctgctgccaagagccacagctcaggatgctggcaagtactattgtcaccgcggcaacctgaccatgtccttccatctggagatcacagcccggcctgtg

[0059] ggtggtggtggttct(linker)

[0060] tatccatatgatgttccagattatgct(HATag)

[0061] The primer sequences are as follows:

[0062] hCD19-SP-EcoRI-F:

[0063] atacgcgaattcatgccccctccaaggctgctgttctttctgctgttcctgacccc

[0064] hCD19-HA-G4S-XhoI-R:

[0065] ctgtcctcgagagcataatctggaacatcatatggataagaaccaccacca cccacaggccgggctgtgatctccagatggaa gg

[0066] The specific experimental steps are as follows:

[0067] The CD19-G4S-HA sequence was connected to the pFRT-SP-HA-TM-Loxp vector by the following steps to replace the PuroR gene sequence in the CHO / dhFr--PuroR-TK-12 cell:

[0068] (1) PCR amplification: The target gene (synthesized by GenScript) was amplified by PCR using Pyrobest high-fidelity amplification enzyme (Takara). (Primers were hCD19-SP-EcoRI-F and hCD19-HA-G4S-XhoI-R, and the template was PUC57-optiPD1-G4S-HA). The PCR conditions were: annealing at 56°C, extension at 72°C for 1 min, and 35 cycles.

[0069] (2) Gel recovery of PCR products: The PCR products completed in the previous step were purified according to the instructions of the DNA gel kit (QIAGEN).

[0070] (3) Enzyme digestion of target gene fragment and vector plasmid: The PCR product and vector (pFRT-SP-HA-TM-Loxp, stored in this laboratory) obtained after recovery in step (2) were cut with nucleases (EcoRI, XhoI, NEB) and recovered using a DNA gel kit (QIAGEN).

[0071] (4) The recovered digested fragments and vector were connected with T4 ligase (NEB), and the target plasmid was transformed and amplified: The plasmid digested in step (3) and the PCR product fragment were connected with T4 ligase to obtain the target plasmid pFRT-optiCD19-G4S-HA. The amplified plasmid was transferred into TOP10 competent cells (Transgen Biotech) for amplification (the transformation step was carried out according to the Transgen Biotech CD101 product manual).

[0072] (5) Sequencing identification: The positive single clones transformed with the target fragment were selected (six clones were randomly selected, and the plasmids were extracted and digested with EcoRI and XhoI. The clones with a 900 bp fragment were analyzed by agarose gel electrophoresis and were considered positive clones) and sequenced (Beijing Ruibo Xingke Biotechnology Co., Ltd.).

[0073] 2. Construction of Anti-Human CD19 scFv GFP expression vector:

[0074] In order to improve the affinity between CD19 and its ligand anti-hCD19 scFv, it is necessary to construct a plasmid capable of expressing anti-hCD19 scFv. We coupled the EGFP green fluorescent protein sequence to the C-terminus of anti-hCD19 scFv and expressed it in 293-F cells.

[0075] We inserted two His tags in series at the C-terminus of EGFP green fluorescent protein for subsequent protein purification.

[0076] PUC57-antiCD19-scFv-EGFP (the antiCD19-scFv-EGF sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd. and then linked to the vector PUC57) was used as the amplification template. The template contains the following base sequence:

[0077] atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatcccagacatccagatgacacagactacatcctccctgtctgcctctctgggagacagagtcaccatcagttgcagggcaagtcaggacattagtaaatatttaaattggtatcagcagaaaccagatggaactgttaaactcctgatctaccatacatcaagattacactcaggagtcccatcaaggttcagtggcagtgggtctggaacagattattctctcaccattagcaacctggagcaagaagatattgccacttacttttgccaacagggtaatacgcttccgtacacgttcggaggggggactaagttggaaataacaggctccacctctggatccggcaagcccggatctggcgagggatccaccaagggcgaggtgaaactgcaggagtcaggacctggcctggtggcgccctcacagagcctgtccgtcacatgcactgtctcaggggtctcattacccgactatggtgtaagctggattcgccagcctccacgaaagggtctggagtggctgggagtaatatggggtagtgaaaccacatactataattcagctctcaaatccagactgaccatcatcaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatttactactgtgccaaacattattactacggtggtagctatgctatggactactggggtcaaggaacctcagtcaccgtctcctca(anti-hCD19 ScFv)

[0078] ggatctggaagttcaggaagcggctcaagtgggtctggaagctca(G4Slinker)

[0079] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag(EGFP)

[0080] The primer sequences are as follows:

[0081] Cd19ScFv-SP-HindIII-F: atacgc aagctt gccaccatgctgctgctggtgacctccctgctgctgtgcg

[0082] His2-G4S-opti-BH IR: atacgc ggatcc cta gtgatgatga tgatgatggtgatgatgatg atgatg agaaccacca ccacc cttgtacagc tcgtccattc cc

[0083] The above base sequence antiCD19-ScFv-EGFP sequence was connected to the pCEP4 vector through the following steps to express the antiCD19-ScFv-EGFP gene sequence:

[0084] (1) PCR amplification: The target gene (synthesized by GenScript) was amplified by PCR using Pyrobest high-fidelity amplification enzyme (Takara). (Primers were Cd19ScFv-SP-HindIII-F: and His2-G4S-opti-BH IR, and template was PUC57-optiPD1-G4S-HA). The PCR conditions were: annealing at 56°C, extension at 72°C for 2 min, and 35 cycles.

[0085] (2) Gel recovery of PCR products: The PCR products completed in the previous step were purified according to the instructions of the DNA gel kit (QIAGEN).

[0086] (3) Enzyme digestion of target gene fragment and vector plasmid: The PCR product and vector (pCEP4, stored in our laboratory) obtained after recovery in step (2) were digested with nuclease (HindIII, BamHI, NEB) and recovered using a DNA gel kit (QIAGEN).

[0087] (4) The recovered digested fragments and vector were connected with T4 ligase (NEB), and the target plasmid was transformed and amplified: The plasmid digested in step (3) and the PCR product fragment were connected with T4 ligase to obtain the target plasmid pCEP4-antiCD19-ScFv-EGFP. The amplified plasmid was transferred into TOP10 competent cells (Transgen Biotech) for amplification (the transformation step was carried out according to the Transgen Biotech CD101 product manual).

[0088] (5) Sequencing identification: Select positive single clones transformed with the target fragment (randomly select six clones, extract the plasmid, and digest with EcoRI and XhoI. The clones with a 1600 bp fragment analyzed by agarose gel electrophoresis are positive clones) and sequence them (Beijing Ruibo Xingke Biotechnology Co., Ltd.).

[0089] The correctly sequenced pCEP4-antiCD19-ScFv-EGFP plasmid was extracted using an endotoxin-free plasmid extraction kit (Tiangen endotoxin-free plasmid extraction kit, specific operations were performed according to the instructions) and transfected into 293-F cells. The 293-F cell culture and transfection process was referred to FreeStyle TM MAX 293 Expression System (ThermoScientific, Catalog No.: K900010).

[0090] The plasmid constructed above was purified and transfected into 293-F cells. After antiCD19-ScFv-EGFP-his was expressed in 293-F cells, it was purified using a nickel column. The steps are as follows:

[0091] (1) After transfection, the culture was continued on a shaker for 6 days, and the cells were removed by centrifugation at 200 g for 3 minutes, and impurities in the culture medium were removed by centrifugation at 10,000 g for 10 minutes;

[0092] (2) Use a 10 kd concentrator tube to concentrate at 3800 rpm and 4°C to about one tenth of the original volume;

[0093] (3) Add the supernatant to a chromatography column filled with nickel sulfate (NiSO4) Sepharose High Performance (Amersham Bioscience);

[0094] (4) Elution with phosphate buffer containing 30, 60, 90, 120, and 250 mM imidazole, respectively, collecting the eluate, and concentrating the eluate using an ultrafiltration tube to obtain the product.

[0095] 3. Construction of cells displaying the extracellular domain of CD19 (CHO-CD19):

[0096] Using the existing CHO cell system (see our prior patent CN104531623B), a CHO cell line that displays the extracellular region of CD19 on the cell surface was constructed. We previously used the recombinase-mediated cassette replacement technology to establish a cell line PuroR-14 containing only one copy of the recombination replacement site. The cell line is the PuroR-14 cell line constructed in CN104531623B, which is deposited in the China General Microbiological Culture Collection Center (CGMCC), numbered CGMCC No. 9717, address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing. The plasmid pCI-Flp-2A-Cre (constructed in this laboratory, containing recombinase) and the plasmid pFRT-CD19-G4S-HA constructed in Example 1 were co-transfected into the cell line, and CD19 was successfully displayed on the cell surface through the action of the recombinase Flp and Cre. The transfected CHO cells were cultured for 48 hours and the cells were collected after trypsin digestion. After the CD19 extracellular region was displayed on the surface of CHO cells, the display efficiency could be detected by anti-HA flow cytometry tag antibody because its C-terminus was tagged with HA. The cells were labeled with APC rabbit anti-HA antibody (1:100 dilution, Cayman, catalog number: 13406), and the positive cells displaying the CD19 extracellular region were sorted by flow cytometry for the affinity evolution experiment of the CD19 extracellular region. The cells sorted by flow cytometry that displayed the CD19 extracellular region with HA tag on the surface were named CHO-CD19, and the CD19 display rate of the sorted cells and their affinity with the ligand antiCD19-ScFv-EGFP protein were detected by flow cytometry.

[0097] 4. Artificial evolution of the affinity between the CD19 extracellular region and antiCD19-ScFv-EGFP protein

[0098] Somatic hypermutation (SHM) combined with activation-induced cytidine deaminase (AID) technology can induce changes in the amino acid sequence of the target protein during cell proliferation, thereby improving the properties of the target protein such as affinity, stability or specificity (see our patent CN104531623B). Through this technology, the affinity of the CD19 extracellular region displayed on the surface of CHO-CD19 cells and its ligand antiCD19-ScFv-EGFP molecule is artificially evolved. The method of transferring AID into CHO-CD19 cells and performing artificial evolution of the target molecule can be referred to CN104531623B, as follows:

[0099] AID was transferred into the CHO-CD19 cell line prepared in Example 3: about 2×10 5 CHO-CD19 cells were transfected with pCEP4-Ig-Ek-NEO-mAID plasmid (stored in our laboratory). This plasmid expresses the AID gene and carries the neo gene. It is resistant to G418. Adding G418 to the culture medium can maintain the continuous expression of the AID gene.

[0100] CHO-CD19 cells transformed with pCEP4-Ig-Ek-NEO-mAID plasmid were cultured in a medium containing G148 antibiotic for 7 days (cell proliferation reached about 2×10 8 As the cells proliferate, the transferred AID randomly mutates the gene sequence of the CD19 extracellular region, producing a large number of randomly mutated CD19 extracellular region molecules and displaying them on the cell surface). After trypsin digestion, all cells were collected and stained with anti-HA tag antibody (Rabbit Anti-HA tag IgG: Cells were co-labeled with APC rabbit anti-HA antibody (1:100 dilution, Cayman, Cat. No. 13406) and anti-CD19-ScFv-EGFP fusion protein at 4°C.

[0101] The cells with the highest affinity were selected by flow cytometry (accounting for about 0.02-0.05% of the total cells). The selected cells were cultured in a medium without G418 antibiotics for 3 days and the cells were expanded to about 2x10 5 When there are more than 10 cells, the pCEP4-Ig-Ek-NEO-mAID plasmid is re-transfected for the next round of evolution, and the remaining cells are used to verify the effect of this round of evolution.

[0102] 5. Identification of CD19 extracellular domain mutants and construction and detection of CD19-Fc fusion protein:

[0103] The genomes of typical cells from the S1 to S4 generations after each round of evolution were extracted, and the sequence structures of the CD19 extracellular region mutants after evolution were detected. The cells in the P3 region sorted after each round of evolution were amplified in a medium without G418 and the whole genome was extracted. The DNA was extracted using the Genomic DNA Purification Kit (Promega) and the specific operation was carried out according to the instructions. The genome was used as a template and the primers were:

[0104] hcd19-sp-nhei-f:atacgcgctagcatgccccctccaaggctgctgttctttctgctgttcctgacccc

[0105] hcd19-ha-g4s-xhoi-r:ctgtcctcgagagcataatctggaacatcatatggataagaaccaccacca cc cacaggccgggctgtgatctccagatggaagg

[0106] The transferred CD19 extracellular domain sequence was amplified, recovered after digestion with nucleases (NheI, XhoI, NEB), and connected to the pCDNA3.1(+) plasmid. Clones were randomly selected for sequencing and compared with the wild-type CD19 base sequence to detect whether mutations occurred.

[0107] In this implementation manner, specific embodiments include the following:

[0108] Example 1. Construction of a cell line displaying the extracellular domain of CD19

[0109] A CHO cell line displaying the extracellular region of CD19 on the cell surface was constructed using a CHO cell system (see the applicant's prior patent CN104531623B) (the construction process is as follows Figure 1 The wild-type CD19 extracellular region amino acid sequence is shown in SEQ ID No. 1.

[0110] We previously used recombinase-mediated cassette replacement technology to establish a cell line PuroR-14 containing only one copy of the recombination replacement site. The cell line is the PuroR-14 cell line constructed in CN104531623B and is deposited in the China General Microbiological Culture Collection Center (CGMCC), numbered CGMCC No.9717, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. The construction process is as follows Figure 1As shown in A, through the action of recombinase Flp and Cre, CD19 replaces the PuroR gene, so that the cells express CD19 ( Figure 1 B). After the CD19 extracellular region is displayed on the surface of CHO cells, since its C-terminus carries an HA tag, the display efficiency can be detected by anti-HA flow cytometry tag antibody. Cells were labeled with APC rabbit anti-HA antibody (1:100 dilution, Cayman, catalog number: 13406), and positive cells showing the CD19 extracellular region were sorted by flow cytometry for the affinity evolution experiment of the CD19 extracellular region.

[0111] The cells sorted by flow cytometry that displayed the extracellular region of CD19 with HA tag on the surface were named CHO-CD19. Flow cytometry was used to detect the CD19 display rate of the sorted cells and their affinity with the ligand antiCD19-ScFv-EGFP protein.

[0112] 2x10 6 Each cell was simultaneously labeled with: (1) an antibody labeled with HA tag (same source as above) to mark the CD19 display rate displayed on the cell surface; (2) purified antiCD19-ScFv-EGFP protein was incubated at 4°C (the concentration of purified antiCD19-ScFv-EGFP protein was 0.5 mg / ml, and 1 ul, i.e. 0.5 ug antiCD19-ScFv-EGFP protein, was added to each sample). After incubation at 4°C for 30 min, non-specific binding of antiCD19-ScFv-EGFP protein and fluorescent antibody was washed away with PBS.

[0113] Test results such as Figure 1 As shown in C: The control cells are cell lines without CD19 replacement (PuroR-14), the abscissa is the affinity of CD19 and antiCD19-ScFv-EGFP, and the ordinate is the display efficiency of CD19.

[0114] Example 2: Optimizing the affinity between the CD19 extracellular region and its single-chain antibody

[0115] Somatic hypermutation (SHM) combined with activation-induced cytidine deaminase (AID) technology can induce changes in the amino acid sequence of the target protein during cell proliferation, thereby improving the properties of the target protein such as affinity, stability or specificity (see the applicant's prior patent CN104531623B). Through this technology, the affinity of the CD19 extracellular region displayed on the surface of CHO-CD19 cells and its ligand antiCD19-ScFv-EGFP molecule was artificially evolved. The steps and processes of each round are as follows: Figure 2 shown.

[0116] 2.1. Optimizing the affinity of the CD19 extracellular region

[0117] AID was transferred into the CHO-CD19 cell line obtained by the above preparation method: about 2x10 5 CHO-CD19 cells were transfected with pCEP4-Ig-Ek-NEO-mAID plasmid (stored in this laboratory). This plasmid expresses the AID gene and carries the neo gene. It is resistant to G418. Adding G418 to the culture medium can maintain the continuous expression of the AID gene. CHO-CD19 cells transfected with pCEP4-Ig-Ek-NEO-mAID plasmid were placed in a culture medium containing G148 antibiotics and cultured for 7 days (cell proliferation to about 2x10 8 As the cells proliferate, the transferred AID randomly mutates the gene sequence of the CD19 extracellular region, producing a large number of randomly mutated CD19 extracellular region molecules and displaying them on the cell surface). After trypsin digestion, all cells were collected and stained with anti-HA tag antibody (Rabbit Anti-HA tag IgG: APC rabbit anti-HA antibody, 1:100 dilution, Cayman, Cat. No. 13406) and antiCD19-ScFv-EGFP fusion protein were co-labeled at 4°C. The cells with the highest affinity (about 0.02-0.05% of the total cells) were sorted by flow cytometry. Figure 3 The sorted cells were cultured in a medium without G418 antibiotics for 3 days, and the cells expanded to about 2x10 5 When there are more than 10 cells, re-transfect with pCEP4-Ig-Ek-NEO-mAID plasmid for the next round of evolution, and the remaining cells are used to verify the effect of this round of evolution ( Figure 3 shown).

[0118] 2.2. Flow cytometry sorting to obtain mutant cell populations with high affinity CD19 protein

[0119] Based on the cells sorted in the first round (S1 generation cells), three more rounds of evolution were performed according to the above experimental process, for a total of four rounds of evolution. The P3 region cells in each round of evolution were collected and named CHO-CD19 S1 to S4, respectively. The affinity of the evolved CD19 extracellular region to the antiCD19-ScFv-EGFP fusion protein was detected by the same method. The results are shown in Figure 4 ,It can be seen that with the increase of evolutionary rounds, the affinity of the evolved CD19 extracellular region to the antiCD19-ScFv-EGFP fusion protein has been greatly improved.

[0120] Based on the cells sorted in the first round (S1 generation cells), three more rounds of evolution were carried out according to the above experimental process, for a total of four rounds of evolution. The P3 region cells from each round of evolution were collected and named CHO-CD19 S1 to S4, respectively. The same method was used to detect the affinity of the evolved CD19 extracellular region to the antiCD19-ScFv-EGFP fusion protein.

[0121] Example 3: Identification of CD19 extracellular region mutants

[0122] The genomes of typical cells of generations S1 to S4 after each round of evolution were extracted, and the sequence structures of the evolved CD19 extracellular region mutants were detected.

[0123] After each round of evolution, the cells in the P3 region were sorted and the whole genome was extracted after the cells were amplified in a medium without G418. The DNA was extracted using the Genomic DNA Purification Kit (Promega), and the specific operation was performed according to the instructions. The genome was used as a template, and the transferred CD19 extracellular region sequence was amplified with primers, digested with nucleases (NheI, XhoI, NEB), and then connected to the pCDNA3.1(+) plasmid. 50 clones were randomly selected for sequencing, and compared with the wild-type CD19 base sequence to detect whether mutations occurred. The sequencing and comparison results showed that after 4 rounds of evolution and sorting, more than 30 mutants containing different amino acid mutations or amino acid mutation combinations were obtained. Ten mutants were selected and linked into pCDNA3.1(+) plasmid (the plasmid contains mutant hCD19 sequence and G4S-HA sequence, which can be transiently expressed on the cell surface for detecting the affinity of mutants) and then transiently transfected into CHO / dhFr- cells. After 48 hours, the cells were collected and labeled and flow cytometry was used to detect the binding ability of different hCD19 extracellular region mutants to their single-chain antibodies (the specific detection method is consistent with the method described above). The results are shown in Figure 2. Figure 5As shown: Mut9 and Mut10 have the most obvious affinity improvement, and Mut9 is used in CD19CAR-T related detection experiments. Ten mutants were selected and connected to pCDNA3.1(+) plasmid (the plasmid contains mutant hCD19 sequence and G4S-HA sequence, which can be transiently expressed on the cell surface and used to detect the affinity of mutants) and then transiently transfected into CHO / dhFr- cells. After 48 hours, the cells were collected and labeled, and the binding ability of different hCD19 extracellular region mutants to their single-chain antibodies was detected by flow cytometry.

[0124] After four rounds of flow cytometry sorting, a series of mutants with improved affinity to the detection probe (antiCD19-ScFv-EGFP) were obtained by sequencing. Among them, Mut9 and Mut10 showed the most obvious affinity improvement, and Mut9 was used in CD19CAR-T related detection experiments.

[0125] The mutation types of the above-mentioned different mutants (Mut1-Mut10) are shown in the following table:

[0126]

[0127] Example 4: Identification of the sensitivity of CD19 mutant detection

[0128] We performed affinity testing on CD19 mutants attached to mouse Fc tags, and found that the highest affinity (Kd value) for single-chain antibody was 6.6E-09 (M) (CD19-Mut9-mFc). CD19-Mut9-mFc and CD19-WT-mFc were simultaneously tested on CD19-CAR positive cells by flow cytometry, and found that Mut9 ( Figure 6 B) is more sensitive than the wild type ( Figure 6 Mut9 protein can still effectively detect positive cells at a concentration as low as 0.003 μg. At the same time, we tested the sensitivity of mutants by adding different proportions of positive cells to negative cells and found that when the addition rate was as low as 0.0003 μg, Mut9 protein could still effectively detect positive cells, while wild-type CD19 protein could not detect low concentrations of positive cells ( Figure 7 shown).

[0129] In order to further verify that Mut9 protein has higher sensitivity and lower detection background than CD19-WT, we used 0.3μg and 0.03μg of protein to detect the positive rate of CD19CAR-T ( Figure 8The results showed that Mut9 protein could maintain high sensitivity and low detection background for cells with different positive rates at different detection concentrations, while CD19-WT protein could not effectively detect samples with low CD19CAR-T positive rates at low concentrations.

[0130] Example 5: Identification of signal-to-noise ratio of CD19 mutants by flow cytometry

[0131] Signal-to-noise ratio, also known as SNR or S / N (SIGNAL-NOISE RATIO), refers to the ratio of signal to noise in an electronic device or electronic system. For flow cytometry, the higher the signal-to-noise ratio, the higher the detection time sensitivity, the lower the background, and the more accurate the result.

[0132] We put the detection signals of CD19CAR-T positive cells with different detection concentrations of Mut9 protein and CD19-WT protein in the same flow cytometry graph ( Fig. 9 As shown in the figure, the flow cytometry signal of Mut9 protein at different detection concentrations is higher than that of CD19-WT protein. The lower the concentration, the more obvious the advantage. Obviously, the characteristics of Mut9 can better meet the needs of scientific research and clinical flow cytometry. Fig. 9 A is the negative control cell. Fig. 9 B is CD19CAR-T positive cells. Similarly, the detection signals of different detection concentrations of Mut9 protein and CD19-WT protein on CD19CAR-T positive cells and negative control cells were placed in the same flow cytometry graph ( Fig.10 As shown in the figure, the signal-to-noise ratio of Mut9 protein in flow cytometry detection was higher than that of CD19-WT protein at different detection concentrations. Fig.10 A is CD19-WT protein, Fig.10 B is Mut9 protein.

[0133] Flow cytometry is a technique for high-speed measurement of single cell optical signals (mainly various fluorescent signals), and is also a major technique in the field of cytometry today. Flow cytometer is an instrument that implements this cell measurement technique. Alice L. Givan gave a descriptive definition: Flow cytometer is an instrument that collects various signals generated by cells when they are illuminated by a detection beam, processes the signals, and correlates the signals for analysis when cells (or other particles) flow in a single manner in front of a light source.

[0134] Flow cytometry combines high-throughput, multi-parameter, high-precision and high-sensitivity analysis functions and high-speed cell sorting capabilities at the single-cell level, and is considered to be the best tool currently available for measuring multi-parameter information. Based on the above characteristics, flow cytometry has irreplaceable advantages over other detection methods when used for CAR-T cell detection. In the early stages of CAR T manufacturing, flow cytometry can be used to analyze the components of apheresis products and identify specific populations of donor T cells associated with better or worse prognosis. Flow cytometry can also be used to evaluate the phenotype and function of CAR T cells before infusion. After infusion, flow cytometry becomes an essential tool for monitoring CAR-T cell expansion and persistence and evaluating treatment response. For example, in clinical trials of anti-CD19 CAR T cells for the treatment of relapsed and refractory B-ALL in children and adults, flow cytometry was used to quantify the extent of CAR T cell expansion and detect the presence of CAR T cells in the bone marrow and cerebrospinal fluid of patients who responded to treatment. After treatment, these patients were longitudinally followed up by flow cytometry to confirm MRD negativity in patients who achieved sustained remission and to promptly detect patients with relapse. In the setting of relapse, flow cytometry can also help determine the number and phenotype of leukemic cells, such as loss of the CD19 antigen in the blasts of a child with relapsed B-ALL.

[0135] An important consideration when evaluating CAR products before and after infusion is to ensure that the protocol can identify CAR-positive leukemic cells. Although very rare, there have been reports that CAR can also be transfected into leukemic cells during the production of CAR T cells, thereby mixing with therapeutic CAR T cells and ultimately leading to relapse. This resistance mechanism was found in B-ALL patients who relapsed after receiving anti-CD19 CAR T cells. This highlights the importance of using flow cytometry rather than relying solely on qPCR to monitor CAR T expansion, because flow cytometry allows us to determine whether there is a non-T cell population (leukemic cells) among the expanding CAR-positive cells. We fluorescently labeled the Mut9 protein with two fluorescent dyes, PE (phycoerythrin) and FITC (fluorescein isothiocyanate), respectively, to illustrate that Mut9 can adapt to different fluorescent dye labeling, thereby better meeting the needs of multi-parameter detection in scientific research and clinical practice.

[0136] Depend on Fig.11 It can be seen that after Mut9 protein is labeled with two fluorescent dyes, PE (phycoerythrin) and FITC (fluorescein isothiocyanate), it can effectively detect CD19CAR-T positive cells. Among them, the discrimination of PE labeling is slightly better than that of FITC fluorescent labeling.

[0137] In the actual operation of clinical samples, simple and efficient experimental steps are very important and can greatly improve the detection efficiency. At the same time, simplifying the experimental steps also puts higher requirements on the properties of the detection reagents themselves. Usually in scientific research experiments, the experimental cell samples need to be washed with buffer two to three times after incubation with the detection reagents, which can reduce the impact of non-specific binding signals to a certain extent. If this step can be omitted, a certain amount of time can be saved in clinical operations, making the detection reagents more practical.

[0138] Our normal experimental procedure is to incubate CD19CAR-T positive cell samples with the detection reagent for 30 minutes and then wash them three times with buffer. In this experiment, the normal step samples were used as positive controls, and CD19CAR-T negative cells were used as negative controls to verify the experimental results of incubating CD19CAR-T positive cell samples with the detection reagent for 15 minutes and 30 minutes before directly using a flow cytometer for detection. Fig.12 It can be seen that the non-specific binding of Mut9 protein to CD19CAR-T positive and negative cell samples is extremely low, and the unclear binding after assignment basically does not affect the experimental results. This further shows that Mut9 protein can meet the needs of clinical testing.

[0139] Example 6: Comparison of sensitivity of Mut9 protein with existing detection products

[0140] For CAR-T cells, the active ingredient that plays a tumor-killing role is CAR-positive T cells. The packaging specifications and clinical dosages of CAR-T cell products are expressed in terms of the number of CAR-T positive cells. Therefore, the CAR transfection positivity rate is a must-check item for CAR-T cell product quality control. Regulatory authorities recommend that flow cytometry (FACS) should be used to detect the CAR transfection positivity rate. At present, the detection methods for different structural regions of CAR include those for CAR antigen binding sites, such as CD19 antigen and anti-idiotypic antibodies, or anti-Fab antibodies and Protein L proteins for light chains or hinge regions.

[0141] Anti-Fab antibodies can recognize the Fab segment of antibodies and can bind to scFv containing the variable region of the Fab segment to achieve the purpose of detecting CAR expression. They have a certain degree of versatility and can detect CARs with different targets. The quality of commercial anti-Fab antibody products varies and most of them are polyclonal antibodies with poor batch consistency. The polyclonal goat anti-mouse F(ab)2 antibody from Jackson ImmunoResearch Laboratories is currently the most widely used anti-Fab antibody and is widely used in the detection of anti-CD19 CAR expression of the marketed drug Yescarta. We labeled Mut9 protein and commercial anti-Fab antibody (Jackson ImmunoResearch) with FITC, and used five concentrations of 0.1μg, 0.03μg, 0.01μg, 0.003μg, and 0.001μg to detect CD19CAR-T cell samples. Fig.13 The results showed that our Mut9 protein detection sensitivity was much higher than that of commercial anti-Fab antibodies.

[0142] Example 7, Affinity detection of CD19 mutants

[0143] Surface plasmon resonance (SPR) affinity assay is an optical-based label-free detection technology used to detect molecular interactions between two or more molecules in real time. SPR affinity assay has the characteristics of high throughput, high flexibility, and high sensitivity, and can be used for early drug development and preclinical drug screening. For example: screening small molecule drugs or peptides (enzymes or antibodies, etc.) has a strong advantage in being able to quickly and accurately screen candidate drug molecules to save costs for subsequent research.

[0144] SPR affinity detection is a method for detecting molecular interactions by tracking signal changes through a sensor chip. The SPR signal is presented as a change in refractive index, which refers to a response unit (RU) that is approximately equivalent to a protein surface concentration of 1pg / mm2. During the interaction between two molecules, plotting the SPR signal over time produces a sensorgram that can be visualized in real time. A general binding reaction consists of three stages: binding, equilibrium, and dissociation; by fitting these sensorgram data with a mathematical model, scientists can calculate the association (Ka) and dissociation (Kd) rate constants and ultimately determine the binding affinity (KD). Unlike isothermal calorimetry (ITC), which measures antibody binding affinity based on equilibrium points, SPR can obtain complete kinetic parameters to evaluate all effects of binding and dissociation as well as antibody affinity. We tested the affinity of a series of CD19 mutant proteins to their single-chain antibody FMC63, among which the affinity of Mut9 protein to FMC63 reached 6.6E-09 (M). The affinity of CD19 wild-type protein to its single-chain antibody FMC63 is very low (Kd>10 -7M), the instrument cannot detect the result ( Fig.14 shown).

[0145] Example 8. Detection of CD19 mutants in clinical samples

[0146] In CAR-T therapy, the number of CAR-T cells infused back needs to be precisely controlled. Too many or too few will not work. What we expect to happen is that after CAR-T is infused back, there will be an in vivo expansion process, indicating that it has successfully identified the target cells and has been fully activated. Flow cytometry has irreplaceable value in detecting the positivity rate of CAR-T cells in clinical practice. First, it can be used for pre-infusion screening to define the proportion of abnormal cells expressing CAR target antigens and the number of molecules expressed on the surface. This information may be valuable because it is difficult to know what antigen density threshold is sufficient to trigger T cell activation through CAR. Secondly, after patients are infused with CAR-T, tracking the expression level of the target antigen in a quantitative manner may help understand drug resistance. The sensitivity of CD19-Mut9 we obtained is much higher than that of various currently available detection reagents. The data show that our optimized CD19-Mut9 has more accurate detection results in the detection of samples before infusion compared with wild-type CD19 and other flow detection reagents. It has a very high degree of differentiation between positive CAR-T cells and negative CAR-T cells, and the detection results are more accurate. By Fig.15 It can be seen that CD19-Mut9 is detected by flow cytometry ( Fig.15 C) has a clearer boundary between CAR-T positive cells and negative cells, and can more accurately determine the CAR-T cell positivity rate; it can determine whether CAR-T cells enter the rapid proliferation phase at the earliest time after being injected into the body, and it is also easier to determine whether a small amount of CAR-T positive cells still remain in the body of patients who have been treated for more than half a year.

[0147] CD19CAR-T is a chimeric antigen receptor T cell targeting the B cell target CD19. CD19CAR-T has been approved for the treatment of leukemia in the United States and Europe, and has recently been approved for clinical treatment in China. The principle is to obtain the patient's T cells, load anti-CD19 antibodies and fusion protein genes, and return them to the patient, so that they can be amplified in large quantities in the patient's body, targeting and killing CD19+ leukemia B cells. During the construction of CAR-T cells and the amplification of CAR-T in vivo, it is necessary to detect and monitor the expression level of anti-CD19 on CAR-T cells and the number of CAR-T cells. The rapid proliferation of CAR-T cells after infusion is an important guarantee for the effective elimination of cancer cells; maintaining a low level of CAR-T cells in the body for a long time is one of the important indicators of no recurrence. The detection reagents used in the past could not distinguish between low-level CAR-T cells and negative controls, nor could they effectively distinguish between the expression of high-level and low-level anti-CD19 single-chain antibodies on CAR-T cells. We use the artificial evolution platform of CHO cells developed by us to optimize the affinity of CD19*-Fc (Mut9) for anti-CD19 antibodies and obtain the reagent CD19*-Fc with the highest detection sensitivity in the world. The affinity of CD19*-Fc for anti-CD19 reaches 6.6X 10 -9 .

[0148] FITC-conjugated anti-IgG Fc F(ab')2 (Jackson ImmunoResearch) antibody is the CD19 CAR-T diagnostic antibody currently used in clinical practice. This antibody shows a very high background noise signal (2.44%), and the positive signal value for detecting CAR-T is not high (4.45%), less than twice that of the negative control. When our mCD19* (CD19-Mut9) was used to detect the same cell sample, the background was significantly lower than that of FITC-conjugated anti-IgG Fc F(ab')2 (Jackson ImmunoResearch) antibody, and the positive signal was more than three times that of the antibody.

Claims

1. A mutated CD19 extracellular domain, wherein the mutated CD19 extracellular domain has mutations at the following amino acid sites corresponding to the amino acid sequence shown in SEQ ID No. 1 compared with the amino acid sequence of the parent CD19 extracellular domain: amino acid sites 75, 82 and 83; the amino acid site 75 is mutated to I, the amino acid site 82 is mutated to V, and the amino acid site 83 is mutated to L.

2. A diagnostic reagent comprising the mutated CD19 extracellular domain according to claim 1.

3. The diagnostic reagent according to claim 2, characterized in that The diagnostic reagent also includes a detectable label.

4. Use of the mutated CD19 extracellular domain according to claim 1 in the preparation of a product for detecting anti-CD19 immune reagents.

5. The use according to claim 4, characterized in that: The anti-CD19 immune agent is selected from antibodies, chimeric antigen receptors (CARs) or CAR-T cells against CD19.

6. A method for detecting an anti-CD19 immune agent in a sample, wherein the method is for non-disease diagnosis and treatment purposes, and the method comprises the step of detecting the anti-CD19 immune agent in the sample using the mutated CD19 extracellular domain according to claim 1.

7. A pharmaceutical preparation comprising the mutated CD19 extracellular domain according to claim 1 and a pharmaceutically acceptable carrier.

8. A method for producing the mutated CD19 extracellular domain of claim 1, comprising the step of expressing a gene encoding the mutated CD19 extracellular domain.

Images