An antimicrobial peptide that inhibits novel coronavirus infection and its uses

Abstract

This invention relates to the field of biomedical technology, specifically to antimicrobial peptides for inhibiting novel coronavirus infection and their uses, particularly to an antimicrobial peptide composition for inhibiting novel coronavirus infection. The composition comprises an antimicrobial peptide as the main active ingredient, plus other pharmaceutically acceptable excipients, carriers, or auxiliary components. This invention also discloses the use of the antimicrobial peptide and its composition in inhibiting novel coronavirus infection. The antimicrobial peptide and its composition have an inhibitory effect on the novel coronavirus and can be used to prevent and inhibit diseases caused by novel coronavirus infection. Compared with existing technologies, the antimicrobial peptide and its composition can effectively inhibit the novel coronavirus and are highly safe, hormone-free, and antibiotic-free, which is of great significance for the prevention and treatment of novel coronavirus infection, and further provides new ideas and scientific basis for the clinical prevention and treatment of SARS-CoV-2 infection.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to antimicrobial peptides that inhibit novel coronavirus infection and their uses. Background Technology

[0002] The novel coronavirus SARS-CoV-2 is mainly transmitted through respiratory droplets and close contact. It is highly contagious, and some patients are asymptomatic but still have the ability to infect others. The population is highly susceptible, and the infectivity is significantly increased, making it much more difficult to control the spread of infection from mobile sources.

[0003] The main symptoms of acute respiratory infectious disease (COVID-19) caused by the novel coronavirus SARS-CoV-2 are fever, fatigue, and cough, with occasional discomfort such as nasal congestion, runny nose, sore throat and diarrhea (Zhang Shiwan, Yu Xueqin, Chen Fang, Jing Xueming, Mei Yihan, Mei Xiaoping. Research progress on novel coronavirus pneumonia [J]. Shandong Medical Journal, 2020, 60(13):110-114.).

[0004] Studies have shown that some COVID-19 patients are asymptomatic or have only mild symptoms, but their ability to transmit the virus is not low. These asymptomatic carriers are also very likely to directly trigger a new wave of the epidemic.

[0005] Because coronaviruses have a wide range of host characteristics and their own complex genomic evolutionary structure, they are prone to recombination and genetic variation during biological evolution, exhibiting biological genetic diversity, which makes the prevention and early treatment of coronaviruses quite difficult (Chen Yunchun, Ke Haixia, Qiu Congying, Huang Yan, Meng Xialing, Hu Jiandong. Epidemiological status and research progress of novel coronavirus [J]. Laboratory Medicine and Clinical Practice, 2021, 18(01):131-133+141.).

[0006] Therefore, effectively controlling the COVID-19 pandemic, curing infected patients, reducing the number of infections, and minimizing the enormous economic losses caused by the pandemic are important issues facing the world today.

[0007] Currently, many drugs are entering clinical trials, which are expected to effectively control the epidemic. In addition to anti-COVID-19 drugs, vaccines and antibody drugs have received much attention. Through comprehensive prevention and treatment measures combining traditional Chinese and Western medicine, early prevention, early detection, early isolation and early treatment can be achieved to block the progression of the disease and achieve certain clinical efficacy or improvement (Expert consensus on prevention and treatment of COVID-19 using integrated traditional Chinese and Western medicine [J]. Chinese Journal of Integrated Traditional and Western Medicine, 2020, 40(12):1413-1423.).

[0008] Among the existing antiviral and antibacterial drugs, some have unsatisfactory effects against SARS-CoV-2 or have adverse reactions. Therefore, most of the current methods for preventing and controlling the novel coronavirus focus on vaccine development. Currently, the vaccines for the novel coronavirus under research mainly include: inactivated or attenuated virus vaccines, protein-based vaccines, vector vaccines, and DNA and RNA vaccines, etc. (Chen Huijuan, Liu Qiqi, Wang Shengqi. Novel Coronavirus Pneumonia: Laboratory Detection, Treatment and Vaccines (English) [J]. Chinese Journal of Biochemistry and Molecular Biology, 2021, 37(01):11-19.).

[0009] According to the WHO, as of February 26, 2021, 184 vaccines worldwide had entered the preclinical development stage, with 83 in clinical development. Most of these vaccines have certain limitations, such as reduced immunogenicity or carcinogenicity. (HTTPS: / / WWW.WHO.INT / PUBLICATIONS / M / ITEM / DRAFT-LANDSCAPE-OF-COVID-19-CANDIDATE-VACCINES). Furthermore, the severity and frequency of adverse reactions caused by vaccines vary slightly depending on the manufacturer.

[0010] In summary, some drugs and vaccines have encountered certain problems in the treatment of novel coronavirus, such as poor therapeutic effects, adverse reactions, and poor stability. Antimicrobial peptides, as novel bioactive ingredients, have attracted widespread attention due to their broad-spectrum antibacterial properties, inhibiting or killing bacteria, fungi, viruses, and parasites, while also being mild and non-irritating.

[0011] Many peptide inhibitors have shown activity against viruses (Tincho MB, Gabere MN, Pretorius A. InSilico Identification and Molecular Validation of Putative Antimicrobial Peptides for HIV Therapy[J]. Journal of AIDS & Clinical Research, 2016, 7(9).). Antimicrobial peptides (AMPs) have been reported as excellent candidates for viral infection (Abid, Qureshi, Nishant, et al. AVPdb: a database of experimentally validated antiviral peptides targeting medicinally important viruses[J]. Nucleic Acids Research, 2013, 42(D1): 1147-53.). However, due to differences in amino acid sequences and structures, different AMPs have different antiviral effects (Biplab K. Maiti, Potential Role of Peptide-Based Antiviral Therapy against SARS-CoV-2 Infection, ACS Pharmacology & Translational Science, 2020, 3(4), 783-785).

[0012] Furthermore, Zhao H disclosed that among 11 peptides derived from mouse β-defensin 4, only the short peptide P9 showed effective broad-spectrum antiviral activity against multiple respiratory viruses, including influenza A virus H1N1, H3N2, H5N1, H7N7, H7N9, SARS-CoV, and MERS-CoV, while the other 10 peptides derived from mouse β-defensin 4 had no anti-SARS-CoV activity (Zhao H, Zhou J, Zhang K, et al. A novel peptide with potent and broad-spectrum antiviral activities against multiple respiratory viruses[J]. Rep, 2016, 6(1): 22008.).

[0013] This shows that even homologous antimicrobial peptides have different antiviral properties.

[0014] During the research process, the inventors unexpectedly discovered that the antimicrobial peptides described in this invention have the effect of inhibiting the novel coronavirus, are non-cytotoxic, highly safe, hormone-free, and antibiotic-free, which is of great significance for the prevention and treatment of the novel coronavirus and further provides new ideas and scientific basis for the clinical prevention and treatment of SARS-CoV-2 infection. Summary of the Invention

[0015] To address the shortcomings of existing technologies, one objective of this invention is to provide an antimicrobial peptide that inhibits novel coronavirus infection; a second objective is to provide an antimicrobial peptide composition that inhibits novel coronavirus infection; and a third objective is to provide the use of the antimicrobial peptide and its composition that inhibit novel coronavirus infection. The invention is characterized in that the amino acid sequence of the antimicrobial peptide is SEQ ID: NO.1.

[0016] The use of an antimicrobial peptide and its composition for inhibiting novel coronavirus infection, characterized in that the amino acid sequence of the antimicrobial peptide is SEQ ID NO.1.

[0017] Preferably, the novel coronavirus is SARS-CoV-2.

[0018] Preferably, the uses of the antimicrobial peptide and its composition include, but are not limited to, inhibiting the novel coronavirus, treating or preventing diseases caused by novel coronavirus infection, and improving the symptoms of diseases caused by novel coronavirus infection.

[0019] An antimicrobial peptide composition for inhibiting novel coronavirus infection, characterized in that the composition comprises the antimicrobial peptide, wherein the amino acid sequence of the antimicrobial peptide is SEQ ID NO.1.

[0020] Preferably, the antimicrobial peptide composition includes other pharmaceutically acceptable excipients, carriers, or auxiliary components.

[0021] Other pharmaceutically acceptable excipients, carriers, or auxiliary ingredients include drugs for treating COVID-19 infection.

[0022] This invention provides an antimicrobial peptide for inhibiting novel coronavirus infection and its uses. The antimicrobial peptide of this invention has an inhibitory effect on the novel coronavirus, exhibiting an inhibition rate of 87.1% against SARS-CoV-2 at 80 μM. Furthermore, the inhibitory effect on viral gene expression increases with increasing concentration of the antimicrobial peptide, while exhibiting no cytotoxicity. It can be combined with other pharmaceutically acceptable excipients, carriers, or auxiliary components for the treatment of COVID-19 and related applications. Compared with existing technologies, the antimicrobial peptide and its composition can effectively inhibit the novel coronavirus and are highly safe, hormone-free, and antibiotic-free, which is of great significance for the prevention and treatment of novel coronavirus infection, and further provides new ideas and scientific basis for the clinical prevention and treatment of SARS-CoV-2 infection. Attached Figure Description

[0023] Figure 1 Immunofluorescence assay was used to detect SARS-CoV-2 infection in Vero-E6 cells.

[0024] Figure 2 RT-qPCR was used to detect the effects of different concentrations of antimicrobial peptides on SARS-CoV-2 infection of Vero-E6 cells.

[0025] Figure 3 Results of cytotoxicity tests on antimicrobial peptides at different concentrations. Detailed Implementation

[0026] One objective of this invention is to provide an antimicrobial peptide that inhibits novel coronavirus infection; a second objective is to provide an antimicrobial peptide composition that inhibits novel coronavirus infection; and a third objective is to provide the use of the antimicrobial peptide and its composition that inhibit novel coronavirus infection. The invention is characterized in that the amino acid sequence of the antimicrobial peptide is SEQ ID: NO.1.

[0027] The use of an antimicrobial peptide and its composition for inhibiting novel coronavirus infection, characterized in that the amino acid sequence of the antimicrobial peptide is SEQ ID NO.1.

[0028] Preferably, the novel coronavirus is SARS-CoV-2.

[0029] Preferably, the uses of the antimicrobial peptide and its composition include, but are not limited to, inhibiting the novel coronavirus, treating or preventing diseases caused by novel coronavirus infection, and improving the symptoms of diseases caused by novel coronavirus infection.

[0030] An antimicrobial peptide composition for inhibiting novel coronavirus infection, characterized in that the composition comprises the antimicrobial peptide, wherein the amino acid sequence of the antimicrobial peptide is SEQ ID NO.1.

[0031] Preferably, the antimicrobial peptide composition includes other pharmaceutically acceptable excipients, carriers, or auxiliary components.

[0032] Other pharmaceutically acceptable excipients, carriers, or auxiliary ingredients include drugs for treating COVID-19 infection.

[0033] When used, the safe and effective amount of the antimicrobial peptide or composition described in this invention is applied to humans or animals. Those skilled in the art can determine the preferred dose suitable for a certain situation using conventional methods. The specific dose should take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skills of a skilled physician.

[0034] Preferably, the peptides and compositions of the present invention can be administered by spraying or inhalation.

[0035] In the antimicrobial peptides and compositions thereof of the present invention, other pharmaceutically acceptable excipients, carriers or auxiliary ingredients may be used in amounts within a common range, and the appropriate amount may be determined by those skilled in the art based on the actual application.

[0036] The antimicrobial peptides described in this invention can be obtained through chemical synthesis or through expression, separation and purification using genetic engineering techniques (for specific methods, please refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, ColdSpring Harbor Laboratory Press, ColdSpring Harbor, NY, 2001).

[0037] The terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0038] In this document, unless otherwise specified, "composition" and "antimicrobial peptide composition" are used interchangeably and refer to products containing the antimicrobial peptides described in this invention as active ingredients.

[0039] In this article, the "novel coronavirus" refers to a new type of virus, namely SARS-CoV-2. "2019 novel coronavirus" and "2019-nCoV" are both alternative names for this virus.

[0040] In this article, "SARS-CoV-2 infection" refers to an infectious disease caused by the novel coronavirus (SARS-CoV-2), including but not limited to "COVID-19".

[0041] In this article, the use of "prevention of SARS-CoV-2 infection" includes the use of preventing the novel coronavirus from infecting healthy people, referring to preventive measures taken to protect or prevent individuals who have not yet been infected with the virus.

[0042] In this article, "pharmaceutically acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other components of the formulation and / or the mammals to which it is treated.

[0043] In this article, "other pharmaceutically acceptable excipients" include non-toxic solid fillers, diluents, adjuvants, encapsulating materials, or other pharmaceutical excipients.

[0044] In this document, "pharmaceutically acceptable carrier" refers to any of the various carriers or carriers known to those skilled in the art. Furthermore, such pharmaceutically acceptable carriers can be aqueous or non-aqueous solutions, suspensions, and emulsions. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, inert gases, etc.

[0045] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0046] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the experimental methods not mentioned are conventional experimental methods. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the embodiments can be purchased from the market or prepared by existing methods.

[0047] The embodiments described herein further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the present invention are within the scope of the present invention.

[0048] Example 1: Detection of in vitro anti-SARS-CoV-2 activity of antimicrobial peptides

[0049] The in vitro anti-SARS-CoV-2 activity evaluation experiment of the antimicrobial peptides involved virus culture. In accordance with the requirements of the National Health Commission's "Prevention and Control Plan for Novel Coronavirus-Infected Pneumonia (Fourth Edition)," all virus cultures were conducted in a biosafety cabinet within a Biosafety Level 3 (BSL-3) laboratory. Nucleic acid extraction from viral cultures and the addition of lysis or inactivation agents were performed in laboratories and under the same protective conditions as the virus cultures. Nucleic acid detection and other procedures performed after live virus inactivation using reliable methods were conducted in a Biosafety Level 2 (BSL-2) laboratory.

[0050] SARS-CoV-2 virus strain: The strain isolated by Naval Medical University in February 2020. Genome information: GenBank: MT627325.1.

[0051] 1.1 Fluorescent immunohistochemical detection

[0052] Different concentrations of antimicrobial peptides were co-incubated with SARS-CoV-2 virus and then co-infected with Vero-E6 cells. Immunofluorescence was used to verify whether the antimicrobial peptides had an inhibitory effect on the novel coronavirus.

[0053] Vero-E6 cells were revived and activated. Once activation was complete and cell viability was good, they were seeded into 96-well cell culture plates at a seeding density of approximately 80%. The culture medium used for cell culture was DMEM + 10% fetal bovine serum (FBS) + DA. A SARS-CoV-2 virus suspension was prepared and its titer was controlled at 1 × 10⁻⁶. 7 pfu / mL; the antimicrobial peptide solid was dissolved in PBS (phosphate buffer, pH 7.4) to prepare a stock solution of antimicrobial peptide with a concentration of 4 mM; the amount of SARS-CoV-2 virus required to infect cells was calculated with an MOI (multiple of infection) of 0.01; live SARS-CoV-2 virus was co-incubated with antimicrobial peptide solutions of different concentrations and the same volume at 37°C for 20 min (the stock solution of antimicrobial peptide was diluted with PBS so that the final concentrations of antimicrobial peptide during incubation were 0, 10 μM, 20 μM, 40 μM, and 80 μM).

[0054] Add 100 μl of the supernatant after incubation to each well of a cell culture plate seeded with Vero-E6 cells, with 100 μl of culture medium per well. Mix well and incubate in a CO2 incubator for 24 h. After the Vero-E6 cells have been cultured, remove the supernatant and gently wash twice with sterile PBS solution. Fix with pre-cooled methanol at -20°C for 20 min and discard the supernatant. Block with PBS solution containing 3% BSA (PBS solution prepared) at room temperature for 1 h and discard the supernatant. Use SARS-CoV-2 virus S protein antibody as the primary antibody and incubate overnight at 4°C. Wash the culture wells three times with PBS for 5 min each time. Incubate with fluorescent secondary antibody 488 at room temperature for 1 h and wash the culture wells three times with PBS for 5 min each time.

[0055] Immunofluorescence assays were performed to detect SARS-CoV-2 infection in Vero-E6 cells. Figure 1 .

[0056] In this study, cells a through e were incubated with SARS-CoV-2 virus in PBS containing antimicrobial peptides at concentrations of 0, 10, 20, 40, and 80 μM for 20 min, respectively, and then infected with the virus. Immunofluorescence was then performed 24 h later. Cell f was the control group, i.e., normal cells that were not infected with the virus under the same conditions. Green fluorescence indicates SARS-CoV-2 positivity.

[0057] Depend on Figure 1 It is known that antimicrobial peptides have an inhibitory effect on the novel coronavirus, and the inhibitory effect increases with increasing concentration, showing a dose-dependent effect.

[0058] 1.2 RT-qPCR detection

[0059] After co-incubating the antimicrobial peptide with the novel coronavirus, the mixture was inoculated into a cell culture plate containing Vero-E6 cells, and the expression intensity of the viral gene was measured.

[0060] Vero-E6 cells were revived and activated. Once the cells were activated and viable, they were seeded into 24-well cell culture plates at a seeding density of about 80%. The culture medium used for cell culture was DMEM + 10% FBS + DA.

[0061] Prepare a SARS-CoV-2 virus suspension and control its titer to 1×10⁻⁶. 7pfu / mL; the antimicrobial peptide solid was dissolved in PBS (phosphate buffer, pH 7.4) to prepare a stock solution of antimicrobial peptide with a concentration of 4 mM; the amount of SARS-CoV-2 virus required to infect cells was calculated with an MOI (multiple of infection) of 0.01; live SARS-CoV-2 virus was co-incubated with antimicrobial peptide solutions of different concentrations and the same volume at 37°C for 40 min (the stock solution of antimicrobial peptide was diluted with PBS so that the final concentrations of antimicrobial peptide during incubation were 0, 10 μM, 20 μM, 40 μM, and 80 μM).

[0062] Add 200 μl of the supernatant after incubation to each well of a cell culture plate seeded with Vero-E6 cells, with 300 μl of culture medium per well. Mix well and incubate on ice for 2 h for subsequent detection. After the Vero-E6 cells have been infected, remove the supernatant and wash gently twice with sterile PBS. Incubate with 0.4 mL / well of Trizol at room temperature for 10 min, and collect the lysis buffer into a 2 mL centrifuge tube. Subsequent experiments were performed according to the standard Trizol method for RNA extraction, reverse transcription of mRNA, and qPCR.

[0063] The internal control primers used in this application are:

[0064] GAPDH-F: CAAGGTCATCCATGACAACTTTG

[0065] GAPDH-R: GTCCACCACCCTGTTGCTGTAG

[0066] The primers for detecting the SARS-CoV-2 gene are:

[0067] nCov-F: GGGGAACTTCTCCTGCTAGAAT

[0068] nCoV-R: CAGACATTTTGCTCTCAAGCTG

[0069] The relative intensity of viral gene expression in SARS-CoV-2-infected Vero-E6 cells by different concentrations of antimicrobial peptides was detected by RT-qPCR. Figure 2 .

[0070] Depend on Figure 2 It is known that low concentrations of the sample exhibited lower inhibitory activity against the novel coronavirus, and the inhibitory effect of the antimicrobial peptide on viral gene expression continuously increased with increasing concentration. 80 μM of the antimicrobial peptide could inhibit viral gene expression to 12.9%, with an inhibition rate of 87.1%. Therefore, the antimicrobial peptide described in this invention can effectively inhibit SARS-CoV-2 infection.

[0071] Example 2: Cytotoxicity of Antimicrobial Peptides on Vero Cells. Because succinate dehydrogenase in the mitochondria of living cells can reduce exogenous thiazolyl blue (MTT) to water-insoluble blue-violet formazan crystals, which are then deposited in the cells, dead cells lack this function. Dimethyl sulfoxide (DMSO) can dissolve the formazan in the cells. Measuring the absorbance at an appropriate wavelength using an enzyme-linked immunosorbent assay (ELISA) scanner can indirectly reflect the number of living cells. Within a certain cell count range, the amount of MTT crystals formed is directly proportional to the cell count.

[0072] Collect cells in the logarithmic growth phase, adjust the cell suspension concentration, add 100 μL to each well, and seed the plate to adjust the cell density to 1000-10000 cells / well. Incubate with 5% CO2 at 37°C until the cell monolayer covers the bottom of the well (96-well flat-bottom plate). Add antimicrobial peptides at different concentration gradients of 1 μM, 6.25 μM, 12.5 μM, 25 μM, 50 μM, and 100 μM, with 5 replicates.

[0073] Incubate with 5% CO2 at 37°C for 24 hours, observing under an inverted microscope. Add 10 μL of MTT solution (5 mg / mL, i.e., 0.5% (w / v) MTT) to each well, and continue incubation for 4 hours. Carefully aspirate the culture medium from the wells. Add 150 μL of DMSO to each well, and shake slowly for 10 minutes to fully dissolve the crystals. Analyze the OD value using an ELISA reader. 490nm The absorbance value of each hole was measured.

[0074] Simultaneously set up zeroing wells (culture medium, MTT, and DMSO) and control wells (cells, antimicrobial peptide dissolution medium of the same concentration, culture medium, MTT, and DMSO).

[0075] The results are as follows Figure 3 As shown, the relative cell proliferation rate of the antimicrobial peptide was greater than 80% at concentrations of 1 μM, 6.25 μM, 12.5 μM, 25 μM, 50 μM, and 100 μM.

[0076] According to the literature published by Wang Chen et al. (Wang Chen, Liao Xin, Wang Yanting, Fan Yuan, Liang Ruizhen. Biosafety evaluation of four disinfectants applied to the control of microbial contamination in DUWLs[J]. Stomatology, 2019, 39(07):596-600.), the five-level toxicity evaluation standard grading table (Table 1) shows that the antimicrobial peptide has no cytotoxicity to Vero cells at a concentration of 100 μM.

[0077] Table 1. Cytotoxicity Evaluation Criteria

[0078] Relative cell proliferation rate (RGR) / % Cytotoxicity score 80-100 0 60-80 1 40-60 2 20-40 3 0-20 4

[0079] In summary, the antimicrobial peptides of the present invention can effectively inhibit SARS-CoV-2 infection without causing cytotoxic side effects.

[0080] Furthermore, the antimicrobial peptide described in this invention is composed of 19 amino acids, and its degradation products are natural amino acids. It does not produce drug residues, has no biotoxicity, and is non-irritating.

[0081] In summary, the antimicrobial peptides described in this invention can effectively inhibit SARS-CoV-2 infection without causing cellular biotoxicity. The antimicrobial peptides and their compositions are of great significance in inhibiting the novel coronavirus, treating or preventing diseases caused by the novel coronavirus infection, and improving the symptoms of diseases caused by the novel coronavirus infection. They provide new ideas and scientific basis for further clinical prevention and treatment of SARS-CoV-2 infection and have promising application prospects.

[0082] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention. sequence list <110> Hangzhou Advanced Biotechnology Co., Ltd. Jiangsu Jirui Biotechnology Co., Ltd. <120> An antimicrobial peptide that inhibits novel coronavirus infection and its uses <141> 2021-03-31 <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> PRT <213> Artificial Sequence <400> 1 Met Gly Arg Phe Lys Arg Phe Arg Lys Lys Phe Lys Lys Leu Phe Lys 1 5 10 15 Lys Leu Ser

Claims

1. The application of an antimicrobial peptide in the preparation of drugs for the prevention and treatment of novel coronavirus infection, characterized in that... The amino acid sequence of the antimicrobial peptide is SEQ ID NO.

1.

2. The application according to claim 1, characterized in that... The antimicrobial peptide has applications including inhibiting the novel coronavirus, treating or preventing diseases caused by novel coronavirus infection, and improving symptoms of diseases caused by novel coronavirus infection.

3. The application of the antimicrobial peptide according to claim 1 in the preparation of drugs for the prevention and treatment of novel coronavirus infection, characterized in that... The drug includes other pharmaceutically acceptable excipients.

Images