A gene pdrabg3f for regulating radial and elongation growth of pteroceltis henryana and application thereof
By identifying and utilizing the PdRabG3f gene of Populus euphratica to regulate the PdRabG3f gene of Populus davidii, overexpression and repression expression vectors were constructed, and Populus davidii were heterologously transformed. This achieved effective regulation of the radial and elongation growth of Populus davidii stems, promoting the improvement of forest tree molecular breeding and timber yield.
Patent Information
- Application Number
- CN202210730183.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-24
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2042-06-24
AI Technical Summary
Existing technologies are insufficient to effectively regulate the radial and elongation growth of poplar stems, thus affecting timber yield and quality.
The PdRabG3f gene for radial and elongation growth of Populus d'Oro was identified and utilized. By constructing overexpression and repression vectors, it was heterologously transformed into Populus aurea 84K and the effects of gene expression on radial and elongation growth of the stem were observed.
By regulating the expression of the PdRabG3f gene, the radial and elongation growth of poplar stems was significantly affected, providing a genetic resource for screening poplars with superior traits and laying the foundation for molecular breeding of forest trees and increasing timber yield.
Smart Images

Figure CN115141261B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a kind of regulation and extension growth gene PdRabG3f of radial and elongation of Dan Hong Yang stem, and its application belong to plant genetic engineering technical field. BACKGROUND
[0002] Populus belongs to Salicaceae Populus, and the chromosome number is generally 2n=38, including Leuce, Aigeiros, Tacamahaca, Leucoides and Turanga, a total of 5 groups, about 30 species.
[0003] For a long time, Populus is widely used in wood production, environmental protection and ecological greening as a bioenergy, not only has potential application value for rapid vegetation recovery, preventing soil erosion and repairing saline-alkali land, but also can be used as woody fiber energy plant for biomass energy development and utilization.Dan Hong Yang (Populus deltoides 'Danhong') is a new generation of fast-growing insect-resistant poplar variety bred by artificial selection, which is bred by Chinese Academy of Forestry, and has excellent traits such as fast growth, easy survival, disease resistance, and water tolerance, and has become a leading variety of forestry industry, and has developed rapidly.
[0004] By cultivating new varieties of poplar with well-developed stem, improving wood yield is an important problem to be solved for sustainable development of poplar industrialization.
[0005] Therefore, providing a kind of regulation and extension growth gene PdRabG3f of radial and elongation of Dan Hong Yang stem and its application, help to understand and in-depth study the growth mechanism of radial and elongation growth of poplar stem, lay a good foundation for subsequent genetic breeding and creation of excellent traits poplar, at the same time, it has important significance for cultivating wood plant varieties with excellent growth traits and improving wood yield. SUMMARY
[0006] The present application aims to provide a kind of regulation and extension growth gene PdRabG3f of radial and elongation of Dan Hong Yang stem and its application, and use its expression vector to transform poplar, in order to promote the development of forest molecular breeding technology, provide technology for the cultivation or screening of excellent tree species, and lay a foundation for exploring the molecular mechanism of radial and elongation growth of poplar stem.
[0007] The above-mentioned purpose of the present application is achieved by the following technical solution:
[0008] The application is based on the analysis of QTL positioning results of quantitative traits of poplar hybrid offspring, and identifies a gene RabG3f related to plant height, that is, a stem radial and elongation growth regulating gene PdRabG3f of Danhong poplar, the coding region nucleotide sequence and the amino acid sequence are shown as SEQ ID NO. 7 and SEQ ID NO. 8 respectively.
[0009] Preferably, the CDS of the stem radial and elongation growth regulating gene PdRabG3f of Danhong poplar is 621 bp in full length, and encodes 206 amino acids and 1 stop codon.
[0010] The application of the stem radial and elongation growth regulating gene PdRabG3f of Danhong poplar in regulating stem radial and elongation growth of poplar.
[0011] The application of the stem radial and elongation growth regulating gene PdRabG3f of Danhong poplar in regulating stem radial and elongation growth of poplar, characterized in that: the plant contains the gene PdRabG3f or the plant overexpresses the gene PdRabG3f or the plant inhibits the expression of the gene PdRabG3f.
[0012] The application of the stem radial and elongation growth regulating gene PdRabG3f of Danhong poplar in regulating stem radial and elongation growth of poplar, characterized in that: a plant overexpression and inhibition expression vector containing the gene PdRabG3f is constructed, and is heterologously transformed into Populus alba x Populus glandulosa 84K, transgenic positive plants are obtained by screening, and the transgenic plants regulating stem radial and elongation growth are obtained by phenotype analysis of the positive plants and wild type plants.
[0013] The application of the stem radial and elongation growth regulating gene PdRabG3f of Danhong poplar in regulating stem radial and elongation growth of poplar, characterized in that: the method comprises the following steps:
[0014] 1) Collecting Danhong poplar cutting seedlings from the greenhouse of China Forestry Science Research Institute in Haidian District of Beijing, performing RNA extraction, reverse transcription into cDNA, cloning the CDS sequence of PdRabG3f, then connecting the pMD19-T vector for sequencing, and constructing an overexpression vector and an inhibition expression vector after correct identification, and heterologously transforming into 84K poplar;
[0015] 2) Using hygromycin resistance and PCR technology to screen positive plants of PdRabG3f gene heterologous transformation of 84K poplar, obtain transgenic positive plants, and perform RNA extraction and phenotype statistics to obtain transgenic plants regulating stem radial and elongation growth.
[0016] Phenotype observation on the transgenic 84K poplar and wild type 84K poplar shows that the ground diameter, xylem width and wood fiber cell wall thickness of the overexpression transgenic plant are smaller than those of the wild type, and the plant height and fiber length are also smaller than those of the wild type; the ground diameter, xylem width and wood fiber cell wall thickness of the suppression expression plant are larger than those of the wild type, and the plant height and fiber length are also larger than those of the wild type.
[0017] The above research results prove that PdRabG3f has certain inhibitory effect on the radial and elongation growth of poplar stem, and has important application value in the molecular breeding of forest trees and the breeding of excellent varieties.
[0018] Compared with the prior art, the main beneficial technical effects of the present application are that:
[0019] The present application takes Populus deltoides 'Danhong' as the material, and screens and identifies PdRabG3f gene. The phenotype identification of the overexpression and suppression expression plant lines based on the PdRabG3f gene shows that the PdRabG3f gene has the ability to inhibit the radial and elongation growth of the stem, which indicates that the PdRabG3f gene can negatively regulate the radial and elongation growth of the stem of the plant, and provides a new selection for screening the radial and elongation growth genes of the stem, and has important application value in the field of forest tree genetic engineering.
[0020] The present application is further described below through specific embodiments and drawings, but does not mean the limitation of the protection scope of the present application. DRAWINGS
[0021] Figure 1-1 It is for the detection of the overexpression PdRabG3f transgenic 84K poplar overexpression plant line in embodiment 1 of the present application;
[0022] Figure 1-2 It is for the detection of the overexpression PdRabG3f transgenic 84K poplar overexpression plant line in embodiment 1 of the present application;
[0023] Figure 1-3 It is for the detection of the overexpression PdRabG3f transgenic 84K poplar overexpression plant line in embodiment 1 of the present application;
[0024] Figure 2-1 It is for the difference diagram of the plant height of the PdRabG3f transgenic 84K poplar plant in embodiment 1 of the present application;
[0025] Figure 2-2 It is for the plant height statistics of the PdRabG3f transgenic 84K poplar plant in embodiment 1 of the present application;
[0026] Figure 2-3 It is for the wood fiber length statistics of the PdRabG3f transgenic 84K poplar plant in embodiment 1 of the present application;
[0027] Figure 2-4 Wood fiber cell wall profile of 84K poplar plant overexpressing PdRabG3f transgene in Example 1 of the present application;
[0028] Figure 2-5 Wood fiber cell wall profile of wild type 84K poplar plant in Example 1 of the present application;
[0029] Figure 2-6 Wood fiber cell wall profile of 84K poplar plant suppressing PdRabG3f transgene in Example 1 of the present application;
[0030] Figure 2-7 Statistical data of ground diameter of 84K poplar plant PdRabG3f transgene in Example 1 of the present application;
[0031] Figure 2-8 Xylem oscillation section of 84K poplar plant PdRabG3f transgene in Example 1 of the present application. DETAILED DESCRIPTION
[0032] The present application will be further described below in conjunction with specific examples. The operations not described in detail in the following examples can be implemented by referring to the operations of molecular cloning and the operation instructions of the related kits.
[0033] Unless otherwise specified, the reagents involved in the following examples are all conventional reagents available on the market, and the methods used are all commonly used methods in the technical field.
[0034] Example 1:
[0035] I. Cloning of PdRabG3f gene of Danhong poplar
[0036] Danhong poplar was used as the material, and the total RNA reagent kit of Tiangen polysaccharide and polyphenol was used to extract RNA from the leaves of Danhong poplar (Danhong poplar total RNA), and the method was as follows:
[0037] (1) About 0.1 grams of Danhong poplar leaf tissue was frozen with liquid nitrogen, put into a mortar pre-cooled in liquid nitrogen, and ground. The leaf tissue sample was kept in a frozen state during the grinding process. After the tissue sample was ground into powder, it was transferred to a 1.5 ml centrifuge tube, then 500 μl of lysis buffer + 10 μl of β-mercaptoethanol) was added into the 2 ml sterilized centrifuge tube, and then the tissue and reagent were fully mixed by using a vortex oscillator;
[0038] (2) 12000 r / min, centrifugation for 2 minutes, discard the supernatant;
[0039] (3) The supernatant was moved to the filter column, 12000 r / min, centrifugation for 2 minutes, and the supernatant was carefully absorbed into a new centrifuge tube;
[0040] (4) Add 0.4 times (200 microliters) of anhydrous ethanol, mix well, and move into the adsorption column, centrifuge at 12000 rpm for 15 seconds, and discard the liquid;
[0041] (5) Add 80 microliters of DNA enzyme working solution to the adsorption column, and stand at room temperature for 15 minutes; (DNA enzyme: 10 microliters of DNA enzyme storage solution + 70 microliters of buffer)
[0042] (6) Add 350 microliters of deproteinizing solution to the adsorption column, centrifuge at 12000 rpm for 15 seconds, and discard the liquid;
[0043] (7) Add 500 microliters of rinsing solution to the adsorption column, centrifuge at 12000 rpm for 15 seconds, and discard the liquid;
[0044] (8) Repeat (7);
[0045] (9) Centrifuge at 12000 rpm for 2 minutes, move into a new centrifuge tube, dry, add 30 microliters of RNA-free ultrapure water to dissolve the precipitate, stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 1 minute, and the plant total RNA extraction solution is obtained;
[0046] Take 2.0 microliters of RNA from each sample, reverse transcribe into cDNA by using Tengen reverse transcription reagent, and the experimental consumables are free of RNA contamination, and the reaction is performed on ice; the reverse transcription steps are as follows:
[0047] 1) gDNA removal reaction (10 microliter system) is shown in Table 1:
[0048] Table 1
[0049]
[0050] Reaction conditions: 42°C, reaction for 3 minutes;
[0051] 2) The reaction product of the previous step is used as a template for reaction (20 microliter system) as shown in Table 2:
[0052] Table 2
[0053]
[0054]
[0055] 3) Add 1) to 2), reaction conditions: 42°C, reaction for 15 minutes; 95°C, reaction for 3 minutes, dilute 10 microliters of cDNA + 190 microliters of ultrapure water when using, and the template cDNA is obtained;
[0056] According to the published Populus trichocarpa genome sequence, the primers (amplifon containing start codon and stop codon) were designed by Primer3 software to perform gene full-length amplification; wherein, the PdRabG3f ORF forward primer PdRabG3f-ORF-F is as shown in SEQ ID NO. 1 of the sequence listing (Table 3), and the reverse primer PdRabG3f-ORF-R is as shown in SEQ ID NO. 2 (Table 4);
[0057] Table 3
[0058] Name Sequence 1 (SEQ ID NO. 1) PdRabG3f-ORF-F ATGCCTTCCCGTAGAAGAACTC
[0059] Table 4
[0060] Name Sequence 2 (SEQ ID NO. 2) PdRabG3f-ORF-R TTAGCACTCGCATCCCGTTG
[0061] Table 5
[0062]
[0063] Table 6
[0064]
[0065] Table 7
[0066]
[0067] Table 8
[0068]
[0069] The cDNA of Danhong Yang was used as a template, and the corresponding primers were used for PCR amplification. The PCR reaction system (20 μL system) is shown in Table 9 below:
[0070] Table 9
[0071]
[0072] The reaction conditions are shown in Table 10 below:
[0073] Table 10
[0074]
[0075] The target fragment was recovered by gel cutting, and the PdRabG3f target fragment amplified by PCR was recovered by gel cutting using the gel recovery kit of American OMEGA Biotechnology Company. The specific operation steps are as follows:
[0076] 1) Cut the target fragment band into a 1.5 mL sterile centrifuge tube, add 600 μL of binding liquid, and melt at 50°C;
[0077] 2) The melted liquid was moved into the filter column, 12500 rpm, centrifuged for 2 minutes, and the waste liquid was discarded;
[0078] 3) 600 microliters of eluent was added, 12500 rpm, centrifuged for 30 minutes, and the waste liquid was discarded;
[0079] 4) Repeat (3), and the waste liquid was discarded;
[0080] 5) The filter column was centrifuged at 12500 rpm for 2 minutes;
[0081] 6) The filter column was moved into another 1.5 milliliter centrifuge tube, 30 microliters of sterilized deionized water was added, and it was left at room temperature for 5 minutes, 12500 rpm, centrifuged for 2 minutes, and it could be eluted once more;
[0082] 7) After 0.1% agarose gel electrophoresis detection, it was stored at -20°C;
[0083] After being connected to pMD19-T, sequencing was performed, and the full-length cDNA sequence of the gene was 621 bp, and was named PdRabG3f gene, and the sequence is shown in the sequence table SEQ ID NO. 7 (Table 11), and the expressed protein sequence encoded thereby is shown in SEQ ID NO. 8 (Table 12);
[0084] Table 11
[0085]
[0086]
[0087] Table 12
[0088]
[0089] II. Construction of PdRabG3f gene plant expression vector
[0090] 1. Construction of overexpression and inhibition expression vector
[0091] The overexpression vector was constructed using the Gateway method, and the gel recovery product of the PdRabG3f with the Gateway tag amplified by PCR was used, the forward primer PdRabG3f-OE-F was as shown in SEQ ID NO. 3 in the sequence listing (Table 5), and the reverse primer PdRabG3f-OE-R was as shown in SEQ ID NO. 4 (Table 6), the inhibition expression vector was also constructed using the Gateway method, and the gel recovery product of the PdRabG3f RNAi target fragment with the Gateway tag amplified by PCR was used, the forward primer PdRabG3f-RNAi-F was as shown in SEQ ID NO. 5 in the sequence listing (Table 7), and the reverse primer PdRabG3f-RNAi-R was as shown in SEQ ID NO. 6 (Table 8), which was first constructed into the pDONR222 intermediate vector through the BP reaction (Thermo, Shanghai, China), the BP reaction system is shown in Table 13, to obtain the recombinant plasmid pDONR222-PdRabG3f / pDNOR222-PdRabG3f-RNAi, then, the PdRabG3f was constructed into the pMDC32 vector using the LR reaction (Thermo, Shanghai, China) to obtain pMDC32-PdRabG3f, and the PdRabG3f RNAi target fragment was constructed into the pH7GWIWG2 vector to obtain pH7GWIWG2-PdRabG3f;
[0092] The BP reaction system (5 μL system) is shown in Table 13 below:
[0093] Table 13
[0094]
[0095] Reaction conditions: 25°C, reaction for 2.5 hours;
[0096] The ligation product was transformed into E. coli DH5α, and the specific transformation steps were as follows:
[0097] 1. Take 5 μL of ligation product and add it to 50 μL of E. coli competent DH5α produced by Beijing Quansiji Biological Technology Co., Ltd. on an ice box, mix gently with a pipette, and ice bath for 30 minutes;
[0098] 2. Place the transformed bacterial solution at 42°C for 90 seconds, and take it out of the ice bath for 5 minutes;
[0099] 3. Add 300 μL of LB liquid medium, 37°C, 180 rpm, and shake for 1 hour;
[0100] 4. Room temperature, 4000 rpm, centrifuge for 5 minutes, discard the supernatant, and resuspend the remaining bacterial solution;
[0101] 5. Spread the mixed transformation bacteria on LB solid plates containing 50 mg / L Kan, dry, seal and invert in a 37°C incubator for 12-14 hours;
[0102] Randomly pick several single colonies from the resistant plate, add 300 μL of LB liquid medium containing Kan (50 mg / L), and incubate at 37°C, 180 rpm for 4-5 hours. Then use the bacterial solution as a template for PCR to detect positive clones;
[0103] The PCR reaction system (20 μL system) is shown in Table 14 below:
[0104] Table 14
[0105]
[0106] The reaction conditions are shown in Table 15 below:
[0107] Table 15
[0108]
[0109]
[0110] After the reaction, take 5 μL of the PCR amplification product, use 0.1% agarose gel electrophoresis for detection, and take a photo under ultraviolet light of a gel imaging system. A band with the same size as the amplification primer is considered a positive clone. Select 3-5 PCR positive clones, entrust Beijing Qikexing Biological Technology Co., Ltd. for sequencing, and confirm successful construction into the intermediate vector. According to the sequencing results, add the target strain into an equal volume of 50% sterile glycerol, shake well, pre-freeze in liquid nitrogen, and then transfer to a -80°C refrigerator for storage, or extract and store the pDNOR222-PdRabG3f / pDNOR222-PdRabG3f-RNAi plasmid by expanding culture;
[0111] Perform enzyme digestion and LR ligation reaction on the pDNOR222-PdRabG3f / pDNOR222-PdRabG3f-RNAi plasmid gene fragment;
[0112] The enzyme digestion reaction system (10 μL system) is shown in Table 16 below:
[0113] Table 16
[0114]
[0115] Reaction conditions: 37°C, 3 hours;
[0116] The pDNOR222-PdRabG3f / pDNOR222-PdRabG3f-RNAi plasmids are connected by LR reaction, and the LR reaction system (5 μL system) is shown in Table 17 below:
[0117] Table 17
[0118]
[0119] Reaction conditions: 25°C, reaction for 2.5 hours;
[0120] The connection product is transformed into E. coli, single colonies are picked, and sequencing is performed. The single colony with correct results is the pMDC32-PdRabG3f / pH7GWIWG2-PdRabG3f plasmid, and the overexpression vector pMDC32-PdRabG3F and the inhibitory expression vector pH7GWIWG2-PdRabG3f of the PdRabG3f gene related to the height development of P. densata are finally cloned;
[0121] III. Genetic transformation and detection of PdRabG3f gene
[0122] 1. Genetic transformation of PdRabG3f gene
[0123] The constructed overexpression vector (pMDC32-PdRabG3f) and inhibitory expression vector (pH7GWIWG2-PdRabG3f) are transformed into Agrobacterium GV3101 by electroporation, and are transformed into 84K poplar by Agrobacterium-mediated genetic transformation. The transformation steps are as follows: the 84K poplar callus used for genetic transformation is cultured at a temperature of 23-25°C, with a light period of 16 / 8 hours (day / night) and a light intensity of 50 μM m -2 s -1Under the specified conditions, Agrobacterium containing the target expression vector infected callus at an OD600 of 0.6–0.8. The infected callus was then placed on L&M (Lloyd & McCown Woody Plant Basal Medium with Vitamins) for adventitious shoot induction and co-cultured for 3 days in the dark at 22±2℃. The resulting leaves were then transferred to L&M medium supplemented with 0.5 mg / L 6-benzyl aminopurine (6-BA), 0.05 mg / L naphthaleneacetic acid (NAA), 3 mg / L hygromycin B, and 200 mg / L timentin. The culture was carried out at 23–25℃ with a light cycle of 16 / 8 h (day / night) and a light intensity of 50 μM. Under m-2s-1 conditions, resistant adventitious shoots were induced and screened. After 30-45 days of induction culture, the resistant adventitious shoots were transferred to rooting medium containing 3 mg / L hygromycin B and 200 mg / L timentin. The medium was then 1 / 2 Murashige and Skoog (MS) basal medium supplemented with 0.05 mg / L IBA and 0.02 mg / L NAA until rooting was induced. DNA was extracted from the leaves of the rooted plants for PCR verification.
[0124] 2. Detection of overexpressing transgenic plants
[0125] By overexpressing the resistant PdRabG3f gene in 84K poplar and wild-type plants, genomic DNA was extracted, and the resistance gene on the expression vector was amplified by PCR. Clear bands were obtained, indicating that these were transgenic plants. Figure 1-1 to 1-2 The image shows the detection results of wild-type 84K poplar and transgenic poplar plants overexpressing and suppressing PdRabG3f in Example 1 of this invention. Six overexpressing transgenic lines and six suppressing transgenic lines were ultimately obtained. Leaves of the transgenic plants were selected, with the wild-type as a control. Total RNA was extracted and reverse transcribed for quantitative analysis of the PdRabG3f gene to determine the expression level of the target gene in the transgenic plants. Finally, two transgenic lines with significant differences in expression levels were selected for subsequent experiments. The gene expression levels are shown in the figure below. Figure 1-3 As shown, the quantitative primers are PdRabG3f-RT-F (SEQ ID NO. 9), as shown in Table 18 below; and PdRabG3f-RT-R (SEQ ID NO. 10), as shown in Table 19 below;
[0126] Table 18
[0127] Name Sequence 9 (SEQ ID NO. 9) PdRabG3f-RT-F TGCTTTCTATCGTGGTGCTG
[0128] Table 19
[0129] Name Sequence 10 (SEQ ID NO. 10) PdRabG3f-RT-F GGGATATTCCCTTTCGAAGC
[0130] IV. Phenotypic observation of PdRabG3f transgenic plants
[0131] At least three biological replicates were set up for the overexpression transgenic line 84K poplar, with wild-type 84K poplar (WT) as a control. The culture site was an artificial climate chamber at the Chinese Academy of Forestry. Plant height and diameter at ground level were measured after 90 days. Results are as follows: Figure 2-1 , Figure 2-2 and Figure 2-7 As shown, the overexpression lines had smaller plant height and ground diameter than the wild type, while the suppressed expression lines had larger plant height and ground diameter than the wild type. The 15th internode was selected, xylem fibers were analyzed, and observed under an Olympus BX51 microscope (Olympus, Japan). The lengths of fibers longer than 200 were counted. The results are as follows: Figure 2-3 As shown, the fiber length of the overexpression lines OE#5 and OE#11 was shorter than that of the wild type, while the fiber length of the suppressed expression lines RNAi#15 and RNAi#31 was longer than that of the wild type. Meanwhile, xylem development was observed in sections from the 6th, 9th, and 12th internodes using a VT1000S (Leica, Germany) microscope with shaking, and also observed using an Olympus BX51 (Olympus, Japan) microscope. The results are as follows. Figure 2-8 As shown, the xylem width of the overexpression lines OE#5 and OE#11 was smaller than that of the wild type, while the xylem width of the suppressed expression lines RNAi#15 and RNAi#31 was larger than that of the wild type. The results indicate that PdRabG3f inhibited plant height, fiber length and xylem development.
[0132] V. Transmission electron microscopy analysis of cell walls in PdRabG3f transgenic plants
[0133] At least three biological replicates were set up for the overexpression transgenic line 84K poplar, with wild-type 84K poplar (WT) as a control. The culture sites were the artificial climate chamber and greenhouse of the Chinese Academy of Forestry. After 100 days, the 20th internode of the overexpression line OE#5, wild-type WT, and the suppressed expression line RNAi#15 were collected, fixed with glutaraldehyde, and vacuum-sealed for 2 hours. The samples were then sent to Henan Sanrui Biotechnology Co., Ltd. for transmission electron microscopy observation. The results are as follows: Figure 2-4 to 2-6 As shown, the cell wall thickness of the overexpression line OE#5 was less than WT, while the cell wall thickness of the inhibited expression line RNAi#15 was greater than WT, indicating that PdRabG3f inhibits cell wall thickening.
[0134] In one aspect, the application provides a PdRabG3f gene for regulating radial and elongation growth of a stem of a P. densata and an encoded protein thereof, and in another aspect, the application provides a use of the PdRabG3f gene for regulating radial and elongation growth of a stem of a P. densata. The application provides an important and possibly universal radial and elongation growth regulating gene resource for a stem of a P. densata, and the regulation of radial and elongation growth of a stem of a P. densata provides materials for later related research and lays a foundation for research on a radial and elongation growth regulating mechanism of a stem of a plant.
[0135] The above merely provides the preferred embodiment of the present application, and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Chinese Academy of Forestry <120> A PdRabG3f gene for regulating radial and elongation growth of a stem of a P. densata and application thereof <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 22 <212> DNA <213> Artificial sequence (PdRabG3f-ORF-F) <400> 1 atgccttccc gtagaagaac tc 22 <210> 2 <211> 20 <212> DNA <213> Artificial sequence (PdRabG3f-ORF-R) <400> 2 ttagcactcg catcccgttg 20 <210> 3 <211> 50 <212> DNA <213> Artificial sequence (PdRabG3f-OE-F) <400> 3 ggggacaact ttgtacaaaa aagttggaat gccttcccgt agaagaactc 50 <210> 4 <211> 55 <212> DNA <213> Artificial Sequence (PdRabG3f-OE-R) <400> 4 ggcggccgca caactttgta caagaaagtt gggtattagc actcgcatcc cgttg 55 <210> 5 <211> 50 <212> DNA <213> Artificial Sequence (PdRabG3f-RNAi-F) <400> 5 ggggacaact ttgtacaaaa aagttggaat gccttcccgt agaagaactc 50 <210> 6 <211> 59 <212> DNA <213> Artificial Sequence (PdRabG3f-RNAi-R) <400> 6 ggcggccgca caactttgta caagaaagtt gggtacaagg acacaacaat cagcaccac 59 <210> 7 <211> 621 <212> DNA <213> Artificial Sequence (PdRabG3f) <400> 7 atgccttccc gtagaagaac tctcttgaag gttatcatcc tcggcgacag cggggtagga 60 aagacctctt tgatgaatca atatgtaaat aagaagttta gcaatcaata caaggcgaca 120 attggagcgg attttttgac taaggaagtt cagtttgaag ataggctctt cactttacag 180 atttgggata ctgctgggca ggaaagattc caaagccttg gtgttgcttt ctatcgtggt 240 gctgattgtt gtgtccttgt atatgatgtc aactcgatga aatctttcga tcatcttaat 300 aattggaggg aagaattcct cattcaggca agtccttcag acccagagaa tttcccattt 360 gttgttcttg gaaacaaggt cgatgtggat ggtggaaata gcagagtggt ttcagagaag 420 aaggcacggg catggtgtgc ttcgaaaggg aatatccctt actttgagac ctctgccaag 480 gaaggtgtta atgttgagga agctttccaa tgcatagcaa agaatgccct gaagagtgga 540 gaagaggaag aaatatactt gccagacacc attgatgttg gaagcagcag tcagcctagg 600 tcaacgggat gcgagtgcta a 621 <210> 8 <211> 206 <212> PRT <213> Protein sequence (PdRabG3f) <400> 8 Met Pro Ser Arg Arg Arg Thr Leu Leu Lys Val Ile Ile Leu Gly Asp 1 5 10 15 Ser Gly Val Gly Lys Thr Ser Leu Met Asn Gln Tyr Val Asn Lys Lys 20 25 30 Phe Ser Asn Gln Tyr Lys Ala Thr Ile Gly Ala Asp Phe Leu Thr Lys 35 40 45 Glu Val Gin Phe Glu Asp Arg Leu Phe Thr Leu Gin He Trp Asp Thr 50 55 60 Ala Gly Gin Glu Arg Phe Gin Ser Leu Gly Val Ala Phe Tyr Arg Gly 65 70 75 80 Ala Asp Cys Cys Val Leu Val Tyr Asp Val Asn Ser Met Lys Ser Phe 85 90 95 Asp His Leu Asn Asn Trp Arg Glu Glu Phe Leu He Gin Ala Ser Pro 100 105 110 Ser Asp Pro Glu Asn Phe Pro Phe Val Val Leu Gly Asn Lys Val Asp 115 120 125 Val Asp Gly Gly Asn Ser Arg Val Val Ser Glu Lys Lys Ala Arg Ala 130 135 140 Trp Cys Ala Ser Lys Gly Asn He Pro Tyr Phe Glu Thr Ser Ala Lys 145 150 155 160 Glu Gly Val Asn Val Glu Glu Ala Phe Gin Cys He Ala Lys Asn Ala 165 170 175 Leu Lys Ser Gly Glu Glu Glu Glu He Tyr Leu Pro Asp Thr He Asp 180 185 190 Val Gly Ser Ser Ser Gin Pro Arg Ser Thr Gly Cys Glu Cys 195 200 205 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence (PdRabG3f-RT-F) <400> 9 tgctttctat cgtggtgctg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence (PdRabG3f-RT-F) <400> 10 gggatattcc ctttcgaagc 20
Claims
1. Genes PdRabG3f Its application in regulating poplar tree height, fiber length, xylem development, and cell wall thickening is shown in SEQ ID NO.
7.
2. The gene as described in claim 1 PdRabG3f Its application in regulating poplar tree height, fiber length, xylem development, and cell wall thickening is characterized by: Make poplar trees overexpress PdRabG3f Gene or repressed expression PdRabG3f Gene.
3. The gene as described in claim 1 PdRabG3f Its application in regulating poplar tree height, fiber length, xylem development, and cell wall thickening is characterized by: Constructing a gene PdRabG3f The plant overexpression or suppression vectors were heterologously transformed into 84K poplar, resulting in transgenic overexpression plants or suppression plants that regulate the radial and elongation growth of the stem.