Application of RhoE gene in the preparation of medicines for treating diabetic cardiomyopathy

Abstract

The present invention provides the use of the RhoE gene in the preparation of a drug for treating diabetic cardiomyopathy, belonging to the field of biomedicine technology. The present invention first discovered that RhoE expression is decreased in diabetic cardiomyopathy animal models and in cardiomyocytes cultured in vitro with high glucose, accompanied by changes such as fibrosis. It clarifies that diabetes / high glucose stimulation has a significant inhibitory effect and pro-fibrotic effect on RhoE expression in cardiomyocytes. Experiments have confirmed that high glucose stimulation downregulates RhoE expression in cardiomyocytes through AMPK signaling, and downregulation of RhoE expression in cardiomyocytes increases fibrosis. By targeted restoration of RhoE expression in myocardial tissue, the heart function damage caused by diabetes was significantly restored.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of the RhoE gene in the preparation of medicines for treating diabetic cardiomyopathy. Background Art

[0002] Diabetes mellitus is a group of metabolic diseases characterized by hyperglycemia. The global prevalence of diabetes is rapidly increasing and remains high. Persistently poorly controlled blood sugar levels can lead to metabolic disorders and microvascular disease, which in turn can cause extensive focal myocardial necrosis. This diabetes-related cardiac complication is known as diabetic cardiomyopathy (DCM). DCM can lead to heart failure, arrhythmias, cardiogenic shock, and even sudden death in severe cases. Therefore, intensified research into the prevention and treatment of diabetic cardiomyopathy is urgent.

[0003] RhoE, also known as Rnd3, is an atypical member of the Rho GTPase superfamily. Its activity is primarily dependent on expression levels and protein modification, unlike the classic regulatory mechanisms of Rho1 and Rho2, which rely on the conversion between the GTP-bound and GDP-bound states. Studies have confirmed that RhoE is an endogenous inhibitor of Rho-associated coiled-coil kinase (ROCK1), playing an important role in cytoskeleton and polarity maintenance, cell proliferation, cell migration, cell cycle, apoptosis, and cell differentiation. [1-3] .

[0004] Currently, there is no record or report on the use of RhoE for diabetic cardiomyopathy.

[0005] References

[0006] 1.Jie W, Andrade KC, Lin X, Yang X, Yue X, Chang J. Pathophysiological Functions ofRnd3 / RhoE. ComprPhysiol. 2015Dec 15,6(1):169-86.

[0007] 2.Chardin P.Function and regulation of Rnd proteins.Nat Rev Mol CellBiol.2006,7(1):54-62.

[0008] 3.Riento K, Villalonga P, Garg R, Ridley A. Function and regulation of RhoE. Biochem Soc Trans. 2005, 33 (Pt4): 649-51. Summary of the Invention

[0009] In view of this, the object of the present invention is to provide the use of RhoE gene in the preparation of medicines for treating diabetic cardiomyopathy.

[0010] The present invention provides the use of a reagent for detecting the RhoE gene and / or RhoE gene expression products in the preparation of a product for assisting in the diagnosis of myocardial fibrosis caused by diabetes; the nucleotide sequence of the RhoE gene is shown in SEQ ID NO.1.

[0011] Preferably, the RhoE gene is down-regulated in patients with myocardial fibrosis caused by diabetes.

[0012] The present invention also provides a primer set for detecting RhoE gene expression for auxiliary diagnosis of myocardial fibrosis caused by diabetes, comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0013] The present invention also provides a kit for assisting in the diagnosis of myocardial fibrosis caused by diabetes, comprising the primer set described in the above scheme and a PCR amplification reagent.

[0014] The present invention also provides the use of an agent for promoting RhoE gene expression in the preparation of a drug for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes; the nucleotide sequence of the RhoE gene is shown in SEQ ID NO.1.

[0015] Preferably, the dosage form of the drug includes injection.

[0016] The present invention also provides a recombinant adeno-associated viral vector for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes. The recombinant adeno-associated viral vector is obtained by inserting the RhoE gene into the adeno-associated viral vector. The nucleotide sequence of the RhoE gene is shown in SEQ ID NO.1.

[0017] Preferably, the adeno-associated viral vector comprises AAV9 virus.

[0018] The present invention also provides a recombinant adenovirus for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes, which is obtained by transfecting packaging cells with the recombinant adenovirus expression vector described in the above scheme.

[0019] The present invention also provides a drug for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes, comprising the recombinant adenovirus described in the above scheme.

[0020] The present invention provides the use of a reagent for detecting the RhoE gene and / or its expression products in the preparation of a product for assisting in the diagnosis of myocardial fibrosis caused by diabetes. The present invention, for the first time, discovered that RhoE expression is decreased in animal models of diabetic cardiomyopathy and in cardiomyocytes cultured in vitro under high glucose conditions, accompanied by changes such as fibrosis. This study demonstrates that diabetes / high glucose stimulation has a significant inhibitory effect on RhoE expression in cardiomyocytes and promotes fibrosis. Furthermore, experiments confirm that high glucose stimulation downregulates RhoE expression in cardiomyocytes through AMPK signaling, and that downregulation of RhoE expression in cardiomyocytes increases fibrosis.

[0021] The present invention also provides the use of reagents for detecting the RhoE gene and / or its expression products in the preparation of products for treating diabetic cardiomyopathy and / or mitigating myocardial fibrosis caused by diabetes. By targeted restoration of RhoE expression in myocardial tissue, the present invention significantly restores diabetic-induced cardiac function impairment. By constructing AAV9 viral particles carrying a RhoE overexpression plasmid targeted to myocardial cells, the present invention can effectively protect against diabetic-induced cardiac function impairment and mitigate cardiac fibrosis via tail vein injection.

[0022] By clarifying the downregulation of RhoE expression in diabetic heart tissue and its role in fibrosis, the present invention can develop a therapeutic system that targets the restoration of RhoE expression in myocardial tissue and thereby protects cardiac function in diabetic heart disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Effects of high glucose on RhoE expression in H9C2 and AC16 cell lines in vitro; A. qPCR detection of RhoE mRNA expression level in H9C2 cells stimulated by different high glucose concentrations; B, C. Western blot detection of RhoE protein expression level in H9C2 cells stimulated by different high glucose concentrations; D. qPCR detection of RhoE mRNA expression level in H9C2 cells stimulated by high glucose at different times; E, F. Western blot detection of RhoE protein expression level in H9C2 cells stimulated by high glucose at different times; G. qPCR detection of RhoE mRNA expression level in AC16 cells stimulated by different high glucose concentrations; H, I. Western blot detection of RhoE protein expression level in AC16 cells stimulated by different high glucose concentrations; J. qPCR detection of RhoE expression level in AC16 cells stimulated by high glucose at different times. mRNA expression level; K, L. Western blot detection of RhoE protein expression level in AC16 cells stimulated with high glucose at different times; ns represents no statistical significance; **P < 0.01; ***P < 0.001; ****P < 0.0001;

[0024] Figure 2 In vitro high glucose induction of H9C2 and H9C2KO-RhoE Cardiomyocyte fibrosis; A, B. qRT-PCR analysis of the mRNA expression levels of Collagen I and Collagen III in H9C2 cells stimulated by high glucose in vitro before and after RhoE knockout; C-E. Western blot analysis of the protein expression levels of Collagen I and Collagen III in H9C2 cells stimulated by high glucose in vitro before and after RhoE knockout; F, G. Immunofluorescence analysis of the localization and expression of Collagen I and Collagen III in H9C2 cells stimulated by high glucose in vitro before and after RhoE knockout. Original magnification: 40×; ns indicates no statistical significance; **P < 0.01; ***P < 0.001; ****P < 0.0001. NG, 5.5 mM D-glucose; HG, 25 mM D-glucose.

[0025] Figure 3 Activation of some classic signaling pathways under high glucose stimulation; A. Western blot detection of NF-κB, AMPK, p-AMPK, JNK, p-JNK, PI3K, p-PI3K, PKC, p38, p-p38, MEK, and p-MEK protein expression levels; B. Quantitative analysis of the corresponding grayscale values of Western blot; Note: *P < 0.05, **P < 0.01, ***P < 0.001;

[0026] Figure 4 Western blot analysis of RhoE / Rnd3 protein expression in cells treated with some signaling pathway inhibitors or agonists under high glucose conditions; A. Representative protein expression bands; B. Relative quantitative results of protein expression; Note: **P < 0.01, ***P < 0.001, ****P < 0.0001;

[0027] Figure 5 Western blot analysis of AMPK, p-AMPK, and RhoE / Rnd3 expression in cells before and after metformin treatment; A. Representative protein expression bands; B. Quantitative results of AMPK signaling activation and RhoE protein expression levels; Note: ***P < 0.001;

[0028] Figure 6RhoE expression is downregulated in diabetic heart tissue; A, C. Western blot detection of RhoE protein expression in heart tissue of db / db mice and WT mice; B, D. Western blot detection of RhoE protein expression in heart tissue of SD rat WT and STZ groups; *P<0.05; ***P<0.001; C is the quantitative analysis result of A, D is the quantitative analysis result of B;

[0029] Figure 7 Diabetes-induced cardiac fibrosis; A-C. Western blot detection of the protein expression of Collagen I and Collagen III, related fibrosis indicators in the hearts of type 1 diabetic rats; D-F. Western blot detection of the protein expression of Collagen I and Collagen III, related fibrosis indicators in the hearts of type 2 diabetic db / db mice; **P < 0.01; ****P < 0.0001;

[0030] Figure 8 Figure 2: Effects of RhoE knockout on cardiac fibrosis in diabetic rats; A-C: Effects of RhoE knockout on changes in Collagen I and Collagen III protein levels in diabetic rats detected by Western blot; D: Masson staining of myocardial tissues of rats in each group, original magnification: 40×; *P<0.05; **P<0.01; ****P<0.0001;

[0031] Figure 9 is the physical map of the vector;

[0032] Figure 10 Agarose electrophoresis diagram of vector digestion products; 1#: 10kb Marker (bands from top to bottom are: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp); 2#: vector digestion products; 3#: undigested vector;

[0033] Figure 11 This is the agarose electrophoresis diagram of the target gene PCR positive product; the markers from top to bottom are: 5kb, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp and 100bp;

[0034] Figure 12The electrophoresis diagram of the PCR products of positive transformants; 1#: negative control (ddH2O); 2#: negative control (empty vector self-ligation control group); 3#: positive control (GAPDH); 4#: marker; 5-12#: transformants 1-8; markers from top to bottom are 5kb, 3kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp and 100bp;

[0035] Figure 13 Amplification curve for PCR identification of viral titer;

[0036] Figure 14 is the standard curve;

[0037] Figure 15 Copy the schematic for the model;

[0038] Figure 16 General conditions and cardiac function changes in rats with cardiac-specific RhoE overexpression, including: A. Body weight changes of rats in each group; B. Blood glucose changes of rats in each group; C. Cardiac appearance of rats in each group; D. Representative ultrasound images; E. Representative ultrasound images; F. EF changes of rats in each group; G. E / A changes of rats in each group; Ns, no statistically significant differences; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001;

[0039] Figure 17 HE and Masson staining of rats with cardiac-specific RhoE overexpression; A. HE staining; B. Masson staining; original magnification: 40×. DETAILED DESCRIPTION

[0040] The present invention provides the use of a reagent for detecting RhoE gene and / or RhoE gene expression product in the preparation of a product for assisting in the diagnosis of myocardial fibrosis caused by diabetes.

[0041] In the present invention, the species of the RhoE gene is Rat; the gene number is NM_001007641; the nucleotide sequence of the RhoE gene is shown in SEQ ID NO.1, specifically:

[0042]

[0043]

[0044] In the present invention, the expression of the RhoE gene is downregulated in patients with myocardial fibrosis caused by diabetes, and there is a statistical difference compared with healthy individuals.

[0045] RhoE expression is decreased in animal models of diabetic cardiomyopathy and in cardiomyocytes cultured in vitro with high glucose, accompanied by changes such as fibrosis, which illustrates that diabetes / high glucose stimulation has a significant inhibitory effect on RhoE expression in cardiomyocytes and a profibrotic effect.

[0046] The present invention also provides a primer set for detecting the expression level of the RhoE gene for auxiliary diagnosis of myocardial fibrosis caused by diabetes, comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, specifically: ACATGGACACAAGGCGTAGG; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3, specifically: GCTAAGGTCACAGTGCGAGT.

[0047] Amplification system:

[0048]

[0049] Amplification procedure:

[0050]

[0051] The present invention also provides a kit for assisting in the diagnosis of myocardial fibrosis caused by diabetes, comprising the primer set described in the above scheme and a PCR amplification reagent.

[0052] The present invention also provides the use of an agent for promoting RhoE gene expression in the preparation of a drug for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes; the nucleotide sequence of the RhoE gene is shown in SEQ ID NO.1.

[0053] In the present invention, the dosage form of the drug preferably includes an injection.

[0054] The present invention also provides a recombinant adeno-associated viral vector for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes. The recombinant adeno-associated viral vector is obtained by inserting the RhoE gene into the adeno-associated viral vector. The nucleotide sequence of the RhoE gene is shown in SEQ ID NO.1.

[0055] In the present invention, the adeno-associated virus preferably includes AAV9 virus.

[0056] The present invention also provides a recombinant adenovirus for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes, which is obtained by transfecting packaging cells with the recombinant adenovirus expression vector described in the above scheme.

[0057] In the present invention, the titer of the recombinant adenovirus is preferably 3.36E+13 to 4.10E+13.

[0058] The present invention also provides a drug for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes, comprising the recombinant adenovirus described in the above scheme.

[0059] In the present invention, the administration method of the drug is preferably injection, the number of injections is preferably 2, the interval between the two administrations is preferably 3 weeks, and the amount of the drug for each injection is preferably 5×10 11 pg / rat.

[0060] The technical solutions of the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention.

[0061] Example 1

[0062] Experimental process and results:

[0063] 1. In vitro high glucose stimulation inhibits RhoE expression in cardiomyocytes

[0064] Rat H9C2 and human AC16 cardiomyocytes were cultured in vitro under high glucose conditions for 48 hours, and the expression of RhoE was detected by qRT-PCR and Western blot, respectively. The mRNA expression levels of RhoE in H9C2 and AC16 cells were not significantly correlated with changes in glucose concentration ( Figure 1 .A,G); from the protein level analysis, when the sugar concentration reached 12.5mM, it did not activate the regulatory effect on RhoE in H9C2 cells, but when the sugar concentration was greater than 12.5mM, it was found that the expression of RhoE in H9C2 cells was negatively correlated with the sugar concentration ( Figure 1 .BC, HI). In AC16 cardiomyocytes, as the sugar concentration increases, the degree of inhibition of RhoE expression becomes more obvious. From the time dimension, high sugar stimulation of H9C2 cells does not show obvious time dependence in terms of RhoE expression at the mRNA level ( Figure 1 .D), but at the protein level, the expression level of RhoE decreased with the extension of high glucose intervention time ( Figure 1 .E,F); In AC16 cells, as the high glucose intervention time prolonged, the expression level of RhoE showed a significant negative correlation with the intervention time, both at the mRNA level and the protein level ( Figure 1 .J~L). This indicates that human cardiomyocytes are more sensitive to RhoE expression after high glucose stimulation than rat cardiomyocytes.

[0065] 2. Insufficient RhoE expression promotes high glucose-induced cardiomyocyte fibrosis

[0066] The RhoE gene knockout H9C2 cell line was constructed using CRISPR / Cas9 technology. qRT-PCR results showed that under high glucose conditions, the expression levels of Collagen I and Collagen III mRNA in both groups of cells were significantly increased ( Figure 2 .A, B), the expression level of Collagen III mRNA in H9C2 KO-RhoE The expression level of CollagenI mRNA in the cells was more significant, while there was no significant difference in the expression level of CollagenI mRNA between the two groups of cells. Western blot results showed that ( Figure 2 .C~E), under high glucose conditions, the protein expression level of Collagen III in the two groups of cells was consistent with the mRNA expression level, and the expression level of Collagen I protein showed an upward trend in H9C2 cells, but KO-RhoE Its expression level in cells did not increase significantly. KO-RhoE The expression levels of Collagen I and Collagen III in the cells were higher than those in H9C2, and the results of mRNA level and protein level were consistent. In addition, the immunofluorescence results showed that ( Figure 2 .F, G), the fluorescence intensity of Collagen I and Collagen III was detected in the cytoplasm and nucleus of both groups of cells, and the fluorescence intensity in the nucleus was more obvious. KO-RhoE The fluorescence intensity of Collagen I and Collagen III in H9C2 was stronger than that in H9C2. After 48 hours of high glucose induction, the fluorescence intensity of Collagen I and Collagen III in both groups of cells increased, and the fluorescence intensity of Collagen I and Collagen III in H9C2 was stronger than that in H9C2. KO-RhoE More pronounced in cells.

[0067] 3. Some classic signaling pathways are activated or inhibited in cardiomyocytes stimulated by high glucose

[0068] To explore the mechanism of RhoE downregulation in cardiomyocytes under high glucose conditions, we selected several classic signaling pathways for exploration. H9C2 cells were cultured for 24 hours using normal glucose medium containing 5.5 mmol / L D-glucose (control group) and high glucose medium containing 25 mmol / L D-glucose (treatment group). Western blot was used to detect the protein expression levels of NF-κB, AMPK, p-AMPK, JNK, p-JNK, PI3K, p-PI3K, PKC, p38, p-p38, MEK and p-MEK. Figure 3As shown in the figure, compared with the normal control group, the expressions of NF-κB, p-JNK, PKC, p-p38, and p-MEK were significantly upregulated, while p-AMPK and p-PI3K were significantly downregulated in the high glucose treatment group. There were no significant changes in AMPK, JNK, PI3K, p38, and MEK. This suggests that under high glucose stimulation, the NF-κB, JNK, PKC, p38, and MEK signaling pathways are activated, while the AMPK and PI3K signaling pathways are inhibited.

[0069] 4. Activation of the AMPK signaling pathway under high glucose conditions can increase the expression of RhoE

[0070] To further explore the mechanism of downregulation of Rnd3 expression under high glucose conditions, we used TGF-β (SB431542), NF-κB (PDTC), PKC H9C2 cells were treated with inhibitors of p38 (SB203580), JNK (SP600125), and MEK (U0126) signaling pathways, and activators of AMPK (Metformin) and PI3K (Dorsomorphin) signaling pathways for 24 h at a glucose concentration of 25 mmol / L, and the expression of RhoE protein was detected by Western blot. Figure 4 As shown in the figure, compared with the high glucose stimulation control group, the expression level of RhoE / Rnd3 increased under the action of AMPK activator Metformin, suggesting that the mechanism of RhoE downregulation under high glucose stimulation may be related to the AMPK signaling pathway.

[0071] 5. High glucose stimulation-induced changes in RhoE can be reversed by metformin

[0072] We used metformin, an AMPK signaling pathway activator, to treat H9C2 cells cultured in high glucose, and Western blot was used to detect the expression of AMPK, p-AMPK, and RhoE. Figure 5 As shown in the results, high glucose stimulation downregulated p-AMPK and RhoE expression, consistent with the previous results. However, the addition of metformin reversed the downregulation of RhoE, with statistically significant differences. This suggests that metformin can reverse the changes in RhoE induced by high glucose.

[0073] 6. RhoE expression is decreased in the heart tissue of diabetic animals

[0074] In order to clarify the expression level of RhoE under diabetic conditions, this study used intraperitoneal injection of SZT to induce type 1 diabetes, and at the same time raised db / db mice to adulthood to replicate the spontaneous type 2 diabetes model. The fasting blood glucose values of SZT-injected rats were ≥16.7mmol / L, and there was a significant increase in food intake and water intake, increased urination, and weight loss, which was significantly different from the control group, indicating that diabetic rats were successfully modeled. The db / db mice mainly showed characteristics such as obesity, slow movement, hyperglycemia, hyperinsulinemia, and abnormal sugar and lipid metabolism. It is a commonly used type 2 diabetes model caused by leptin receptor gene defects. The fasting blood glucose values of adult db / db mice were ≥16.7mmol / L for three consecutive times. The mice were obese, with a significant increase in food intake and water intake and increased urination, which was significantly different from the control group, indicating that diabetic mice were successfully modeled. Western blot was used to detect the expression of RhoE protein in the heart tissue of the four groups of SD rats WT group, STZ group, db / db mouse group and WT mouse group. Figure 6 As shown in Figure 3, RhoE protein expression was downregulated in both acute type 1 diabetic rat models and chronic type 2 diabetic mouse models compared with normal controls, and the decrease was more significant in the chronic type 2 diabetic model.

[0075] 7. Diabetes leading to cardiac fibrosis

[0076] In order to clarify the extent of cardiac fibrosis caused by diabetes, this study used Western blot to detect the expression levels of fibrosis-related indicators Collagen I and Collagen III in the heart in type 1 diabetes model and type 2 diabetes model. Figure 7 As shown in Figure 2, the expression levels of Collagen I and Collagen III proteins in the hearts of type 1 diabetic rats were higher than those in WT rats ( Figure 7 Similarly, the expression levels of Collagen I and Collagen III proteins in the heart tissue of type 2 diabetic db / db mice were significantly higher than those in WT mice ( Figure 7 D~F).

[0077] 8. Effects of RhoE knockout on cardiac fibrosis in diabetic rats

[0078] To explore the effect of RhoE knockout on cardiac fibrosis in diabetic rats, this study used diabetic rats with whole-body RhoE knockout established by the research team in the early stage, and took their hearts for Western blot detection. It was found that in the absence of diabetes, the levels of cardiac collagen (Collagen I and Collagen III) in RhoE knockout rats increased compared with wild-type rats. Interestingly, in the diabetic state, the increase in cardiac collagen levels in RhoE knockout rats was more significant than that in wild-type rats ( Figure 8 Masson staining also showed that the WT diabetic group had more collagen fiber deposition than the WT control group. In the non-diabetic state, RhoE knockout cells had more obvious collagen fiber deposition than the WT control group, and diabetes exacerbated this trend ( Figure 8 D) in.

[0079] 9. Effects of RhoE overexpression on cardiac function and morphological changes in diabetic rats

[0080] 9.1 Construction and packaging of RhoE overexpressing AAV

[0081] 9.1.1 Carrier information:

[0082] The vector, GV388, was purchased from Shanghai Jikai Company. The element sequence is: CMV bGlobin-MCS-EGFP-3FLAG-WPRE-hGH polyA. The physical map of the vector can be found at Figure 9 .

[0083] 9.1.2 Vector enzyme digestion map

[0084] Table 1 Enzyme digestion system

[0085]

[0086] See the agarose electrophoresis diagram of the vector digestion product for details. Figure 10 .

[0087] 9.1.3 Target gene information

[0088] Gene name: RhoE, species: Rat; gene number: NM_001007641

[0089] https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001007641 ;

[0090]

[0091]

[0092] CDS region: 186~920bp.

[0093] 9.1.4 Obtaining target genes

[0094] The target gene fragment was retrieved from the cDNA library (purchased from Shanghai Jikai Company) by PCR.

[0095] Table 2

[0096]

[0097] RhoE-Primer 1:

[0098] GGAGGTAGTGGAAT GGATCC CGCCACCATGAAGGAGAGAAGAGCCAG(SEQ ID NO.4);

[0099] RhoE-Primer 2:

[0100] TCACCATGGTGGCG GGATCC ATCACAGTGCAGCTCTTGGCTTTG(SEQ ID NO.5);

[0101] Primer description: Contains exchange pairing bases, BamHI restriction site (underlined), expression enhancement sequence (bold bases), and contains the 5' end portion of the target gene sequence for PCR amplification of the target gene.

[0102] PCR product size: 778 bp. Figure 11 .

[0103] Table 3 Reaction conditions

[0104]

[0105] 9.1.5 Recombinant Plasmid Construction

[0106] The PCR product was connected to the linearized vector through a base exchange mechanism to obtain a recombinant plasmid, and positive transformants were selected by PCR.

[0107] Table 4 PCR product and vector exchange reaction system

[0108] Reaction system Positive control (μl) Self-ligation control (μl) Experimental group (μl) <![CDATA[ddH2O]]> 2.5 4.5 3.5 5×CEⅡBuffer 2.0 2.0 2.0 Vector DNA after enzyme digestion 2.5 2.5 2.5 Purified PCR product fragments 2.0 0 1.0 <![CDATA[Exnase TM Ⅱ]]> 1.0 1.0 1.0 Total 10.0 10.0 10.0

[0109] Primer 3: ATTCTGAGTCCAAGCTAGGC (SEQ ID NO. 6);

[0110] Primer 4: CGTCGCCGTCCAGCTCGACCAG (SEQ ID NO. 7);

[0111] The PCR product size of the positive transformant is 989 bp; the PCR product size of the negative transformant is 257 bp.

[0112] Add 10 μL of the exchange reaction product to 100 μL of Stbl3 chemically competent cells (Invitrogen catalog number C737303). Gently tap the tube several times to mix thoroughly. Place on ice for 30 minutes. Heat shock the tube at 42°C for 90 seconds, then incubate in an ice-water bath for 2 minutes. Add 500 μL of LB medium and incubate the tube in a shaker at 37°C for 1 hour. Spread an appropriate amount of the bacterial solution evenly on a plate containing the appropriate antibiotic and incubate in an incubator upside down for 12-16 hours.

[0113] Prepare the following reaction system, vortex to mix, and briefly centrifuge. In a clean bench, use a sterile pipette tip to pick a single colony into 20 μL of the identification system, pipette to mix, and place in a PCR instrument for reaction.

[0114] Table 5 Identification reaction system

[0115] Reagents Volume, μl <![CDATA[ddH2O]]> 9.2 2×Taq Plus Master Mix 10.0 Upstream primer (10 μM) 0.4 Downstream primer (10 μM) 0.4 Single colony - total 20.0

[0116] Table 6 PCR reaction conditions

[0117]

[0118] Agarose electrophoresis of PCR products of positive transformants can be found in Figure 12 .

[0119] 9.1.6 Sequencing results and analysis of positive clones

[0120] Inoculate the identified positive clone transformants into an appropriate amount of LB liquid medium containing the corresponding antibiotics, culture at 37°C for 12-16 hours, and take an appropriate amount of bacterial liquid for sequencing. Compare the sequencing results with the target gene sequence. Comparison results:

[0121] CGGTACCGGAATTCGGAACTGGAGGTGGAGGTAGTGGAATGGATCCCGCCACC ATGAAGGAGAGAAGA GCCAGCCAGAAATTATCCAGTAAATCTATCATGGATCCTAATCAGAACGTGAAATGCAAGATAGTAGTGGTGGGCG ACAGCCAGTGTGGGAAAACCGCGCTGCTCCACGTCTTCGCAAAGGACTGCTTCCCGAAAATTACGTCCCTACGGT GTTTGAGAATTACACTGCCAGTTTTGAAATCGACACACAAAGAATAGAGTTGAGCCTGTGGGACACTTCAGGTTCC CCTTACTATGACAACGTCCGTCCCCTCTCTTACCCAGATTCTGATGCTGTGCTCATTTGCTTTGACATCAGTAGAC CAGAAACTCTGGACAGTGTCTTAAAGAAGTGGAAAGGTGAAATCCAGGAGTTTTGTCCCAATACCAAGATGCTGTT GGTTGGTTGCAAGTCTGACCTTCGGACAGATGTCAGCACACTAGTGGAACTCTCAAATCACAGGCAGACTCCTGTG TCATATGATCAGGGGGCAAACATGGCGAAGCAGATCGGAGCAGCCACTTACATAGAATGCTCAGCTTTACAGTCGG AGAACAGCGTCAGAGACATTTTTCACGTCGCCACCTTGGCGTGTGTAAATAAGACAAATAAAAACGTTAAGCGGAA CAAATCACAGAGGGCCACAAAGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCAGCAGTTGCTACGGACTTA CGAAAGGACAAAGCCAAGAGCTGCACTGTGATG GATCCCGCCACCATGGTGAGCAAGGGCGAGGAG (SEQ ID NO. 8). The single underline indicates the successfully cloned CDS region of RhoE.

[0122] Comparison result description: the test is OK.

[0123] 9.1.7 Plasmid Extraction

[0124] Transfer the correctly sequenced bacterial suspension to 10 ml of LB liquid medium containing the corresponding antibiotics, culture at 37°C overnight, and use the Tiangen Endotoxin-Free Plasmid Mini-Prep Kit for plasmid extraction. Qualified plasmids will enter the downstream process. The detailed steps are as follows:

[0125] (1) Collect the overnight culture solution into a labeled 5 ml centrifuge tube and centrifuge at 12000 rpm for 2 minutes to collect the bacteria;

[0126] (2) Discard the supernatant, add 250 μl of cell resuspension solution, and shake thoroughly to evenly suspend the bacterial clumps;

[0127] (3) Add 250 μl of cell lysis buffer and 10 μl of proteinase K, invert the tube 5-6 times, and mix gently; let it stand for 1-2 minutes to allow the cells to lyse and clarify.

[0128] (4) Add 350 μl of neutralizing solution, mix thoroughly by inverting the tube to completely precipitate the protein, and place it in an ice bath for 5 min;

[0129] (5) Centrifuge at 10,000 rpm for 10 min, discard the protein, and collect the supernatant into another clean, sterile 1.5 ml EP tube;

[0130] (6) Centrifuge at 12,000 rpm for 5 minutes. Prepare a labeled recovery column and transfer the supernatant to the recovery column. Centrifuge at 12,000 rpm for 1 minute and discard the lower layer of waste liquid.

[0131] ⑺Add 600 μl of pre-prepared rinse solution, centrifuge at 12,000 rpm for 1 min, discard the lower layer of waste liquid, repeat once, and centrifuge at 12,000 rpm for 2 min to further remove the residual rinse solution;

[0132] ⑻ Transfer the recovery column to a new 1.5ml EP tube in a clean bench, let it stand for 10-20 minutes, and let it dry naturally;

[0133] ⑼ Add 95 μl of Nuclease-Free Water to the recovery column, let it stand for 2 minutes, centrifuge at 12000 rpm for 2 minutes, collect the samples, number them, perform electrophoresis, determine the concentration, and conduct quality inspection.

[0134] 9.2 Packaging of Recombinant AAV9 Virus

[0135] Recombinant AAV particles were produced using the AAV Helper-Free System.

[0136] The selected positive transformants were recombinant expression plasmids, pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) were co-transfected into AAV-293 cells (providing trans-acting factors required for AAV replication and packaging, Shanghai Jikai Company). 3×10 6 AAV-293 cells were added and used for transfection 48 hours later.

[0137] Two to three days after transfection, recombinant AAV is assembled in the packaging cells. Cells are lysed to release AAV particles, and the supernatant is collected. The virus is concentrated and purified by two cycles of CsCl density gradient centrifugation and one cycle of ultrafiltration to remove most cytosolic proteins and residual CsCl ions. The resulting virus titer is determined by quantitative PCR. Glycerol is added to the virus concentrate to a 5% concentration. Aliquots are stored at -80°C.

[0138] Virus titer PCR identification amplification curve see Figure 13 .

[0139] Table 7 Q-PCR raw data

[0140]

[0141] Table 8 Standard curve copy number

[0142]

[0143] Table 9 Virus titers for preparing standard curves

[0144] Standard-2 Standard-3 Standard-4 Standard-5 Standard-6 Copies / ml 2.58E+11 2.58E+10 2.58E+09 2.58E+08 2.58E+07

[0145] Standard curve see Figure 14 .

[0146] Titer calculation

[0147] Substitute the Ct value of the target sample into the formula to obtain the titer of the sample to be tested, and multiply it by the dilution factor to obtain the original sample titer. Average the titer values of the four groups to obtain the mean titer, which is the final titer data of the sample.

[0148] Table 10 Titer data of samples

[0149]

[0150] 9.3 Tail vein injection of RhoE-overexpressing AAV9 and establishment of a diabetic model

[0151] 9.3.1 Model construction diagram Figure 15 .

[0152] 9.3.2 Grouping:

[0153] The rats were divided into 4 groups: ①NC group, i.e. normal SD rat control group; ②T1DM group, SD rats induced with T1DM group; ③T1DM+NC-AAV9 group, SD rats with T1DM and injected with negative control AAV9 virus; ④T1DM+RhoE-AAV9 group, SD rats with T1DM and injected with RhoE-AAV9 virus;

[0154] Virus injection volume: 1×10 12 pg / rat, injected twice, 5×10 11 pg / rat, 3 weeks interval.

[0155] SZT dosage: 70 mg / kg.

[0156] 9.3.3 Diabetes impairs cardiac function in rats, whereas overexpression of RhoE restores cardiac function in diabetic rats

[0157] Given that adeno-associated virus is stably expressed after 3 weeks after injection into the body, and the peak expression lasts for about 5-6 months, the specific time points for the construction of RhoE cardiac-specific overexpression model and diabetes model are as follows: Figure 15 Three weeks after RhoE-AAV9 injection, the rats showed no obvious abnormalities in behavior, their diet and defecation were normal, and they moved freely. STZ was injected for 3 days at the appropriate time, and the fasting blood glucose level was ≥16.7mmol / L ( Figure 16 B), rats showed obvious increase in eating, drinking and urination, which was significantly different from the control group, indicating that the diabetic rat model was successfully established ( Figure 16 A, B, and D in the figure). At 4 weeks after modeling, cardiac function tests were performed using a small animal ultrasound device. It was found that there was no significant change in cardiac function in the diabetic group (results not shown). Therefore, cardiac function tests were performed again at 8 weeks after modeling. There was no significant difference in the body weight of rats in each group at the time of enrollment. On the 60th day, it was found that the diabetic state could cause the rats to lose weight; compared with the WT group, the body weight of the OV group increased to a certain extent ( Figure 16 A in the figure). Observation of heart size revealed that the heart of wild-type rats significantly enlarged after STZ administration, while the heart size of the OV group decreased after STZ stimulation ( Figure 16 C); The HW / BW value of the STZ-induced group was significantly higher than that of the control group, while the HW / BW value of the OV-STZ group was lower than that of the WT-STZ group ( Figure 16 D in the figure); the hearts of rats in each group were examined by cardiac ultrasound ( Figure 16E in the WT-STZ group), it was found that the EF value and E / A value of the WT-STZ group were significantly decreased compared with the WT-control; the EF value and E / A value of the OV-STZ group were decreased compared with the OV-control, and the E / A value had no significant change, but compared with the WT-STZ group, the EF value and E / A value were significantly increased ( Figure 16 F, G in ).

[0158] 9.3.4 Cardiac-Specific RhoE Overexpression Ameliorates Diabetes-Induced Cardiac Morphological Changes

[0159] HE staining was used to examine the morphological changes of myocardial tissue in each group of rats. The myocardial tissue of the WT control group was arranged normally, with clear cell outlines and no obvious fibrous tissue proliferation in the interstitial and small blood vessels. After STZ was given to induce diabetes, some myocardial cell outlines were unclear, some myocardial cells were edematous, the interstitium was accompanied by more collagen fiber deposition, the adventitia of the interstitial arterioles was thickened, and there was obvious fibrous tissue proliferation. The morphological structure of the control group after RhoE overexpression was similar to that of the WT control group, with no obvious abnormalities. After STZ was given to induce diabetes, the myocardial cell edema was not obvious, the interstitial fiber deposition was reduced, and the adventitia thickness of the small blood vessels was reduced to a certain extent compared with the WT diabetic group. Figure 17 Masson staining revealed that collagen fiber deposition in the myocardial interstitium and small blood vessel adventitia was not obvious in the WT control group and the RhoE overexpression control group. However, after WT cells were induced to become diabetic, significant collagen fiber deposition was observed in the myocardial interstitium and small blood vessels, a situation that was attenuated in the RhoE overexpression diabetic group ( Figure 17 B) in.

[0160] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention rather than all the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention. Sequence Listing <110> Hainan Medical College Guangdong Medical University <120> Application of RhoE gene in the preparation of medicines for treating diabetic cardiomyopathy <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2002 <212> DNA <213> Artificial Sequence <400> 1 ggcagaaac ttgttggaga ggcgctgcct ctcctcctcc aactccgctg cgcttaaggg gttccctccg gccttgcgat ttatttttat atccgctttt tatagagaga 120 agtatatata tttttttctt ctaaagagaa aaattcctgt tccaagagaa aataaggcaa catcaatga ggagagaga gccagccaga aattatccag taaatctatc atggatccta atcagaacgt gaaatgcaag atagtagtgg tgggcgacag ccagtgtggg aaaaccgcgc 360. tgctccacgt cttcgcaaag gactgcttcc ccgaaaatta cgtccctacg gtgtttgaga attack cagttttga atcgacacac aaagaataga gttgagcctg tgggacactt caggttcccc ttacttgac aacgtccgtc ccctctctta cccagattct gatgctgtgc 480 tcatttgctt tgacatcagt agaccagaaa ctctggacag tgtcttaaag aagtggaaag gtgaatcca ggagttttgt cccaatacca agatgctgtt ggttggttgc aagtctgacc ttcggacaga tgtcagcaca ctagtggac tctcaaatca caggcagact cctgtgtcat atgatcaggg ggcaaacatg gcgaagcaga tcggagcagc cacttacata gaatgctcag ctttacagtc ggagaacagc gtcagagaca tttttcacgt cgccaccttg gcgtgtgtaa 780 ataagacaaa taaaaacgtt aagcggaaca aatcacagag ggccacaaag cggatttcac 840 acatgcctag cagaccagaa ctctcagcag ttgctacgga cttacgaaag gacaaagcca 900 agagctgcac tgtgatgtga ggcttcaccg tctttaatga ggacacatgg aaatctggtg 960 taaaaaaaa attaaaataa aatttgaaac agcaagagca aacggaaaga gggagtcaaa 1020 tgaagtgcac agccaaagtc acatggacac aaggcgtagg agtcccttga aaaaaaaagt 1080 ggatacccac ttttcggaat cctgtcctta gtttcggcat gtagaccgag tggtgagaag 1140 cgaatgcgtt gaagagtttt gtgtaacaag aggtgtgact tgaaaaatac accaaaaaca 1200 aagggagcta caaacgggcg agcgctagag aagtgggggg ccctggtacc tccaagaaga 1260 aagtccacgc tttgaatggt gcttgagtat ttttggtttt gtgtttgtgg ttttattaca 1320 acctattcgt ggatctctac tttgatttag tttttcaatg ttttaatccc tttttccaaa 1380 aaagtatata ttagtagacc gtcctcgttg ggaactcgca ctgtgacctt agcgtttagt 1440 tttctagagg atgtgatcta atttcctcct agctcgtcat taaaatggaa attgtactag gacccggtgg gattcgagag gaaaaacttg ctgcggcttt gaaatcttga cttcctgaag gtcgccgctg agcgagatgg tttgaagcaa ggcttcctgg ccttacaaga tgcgtagacc 1620 agcactacag agcactgcgta gatcaactag aagagagtgt tgctttttct tctgtcttga 1680. tggttttgtt catcctcgtg attgtcctta aacaagtggt aaatcgttcc gtgtaatatt 1740. ttttgtgcgc tgtgtagaag agtgtgtgtg tggcttcgtt ttgttttct tttttctttt tgccatcgtt gatgaaaaca agaagtcaaa taaagatgt cttcgtctga ttgtgatagc gtgattaaag aggaggcagg tgggtgccga tttcaccagg aagaccttg aatgaaggag 1980. 1980. 1980. 1980. 1980. 1980. 1980. 1980. 1980 Attack Caaaagcact ct <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 acatggacac aaggcgtagg <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gctaaggtca cagtgcgagt 20 <210> 4 <211> 47 <212> DNA <213> Artificial Sequence <400> 4 ggaggtagtg gaatggatcc cgccaccatg aaggagagaa gagccag 47 <210> 5 <211> 44 <212> DNA <213> Artificial Sequence <400> 5 tcaccatggt ggcggggatcc atcacagtgc agctcttggc tttg 44 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 attctgagtc caagctaggc 20 <210> 7 <211> twenty two <212> DNA <213> Artificial Sequence <400> 7 cgtcgccgtc cagctcgacc ag 22 <210> 8 <211> 818 <212> DNA <213> Artificial Sequence <400> 8 cggtaccgga attcggaact ggaggtggag gtagtggaat ggatcccgcc accatgaagg 60 agagaagagc cagccagaaa ttatccagta aatctatcat ggatcctaat cagaacgtga 120 aatgcagat agtagtggtg ggcgacagcc agtgtgggaa aaccgcgctg ctccacgtct 180 tcgcaagga ctgcttcccc gaaaattacg tcctacggt gtttgagaat tacactgcca 240 gttttgaaat cgacacacaa agaatagagt tgagcctgtg ggacacttca ggttcccctt 300 actatgacaa cgtccgtccc ctctcttacc cagattctga tgctgtgctc atttgctttg 360 acatcagtag accagaact ctggacagtg tcttaagaa gtggaaggt gaatccagg 420 agttttgtcc caataccaag atgctgttgg ttggttgca gtctgacctt cggacagatg 480 tcagcacact agtggactc tcaatcaca ggcagactcc tgtgtcatat gatcagggggg 540 cieacatggc gaagcagatc ggagcagcca cttacataga atgctcagct ttacagtcgg 600 agacagcgt cagagacatt ttcacgtcg ccaccttggc gtgtgtaaat agacaaata 660 aaaacgttaa gcggaacaa tcacagagggg ccacaagcg gatttcacac atgcctagca 720 gaccagaact ctcagcagtt gctacggact tacgaaagga caaagccaag agctgcactg 780 tgatggatcc cgccaccatg gtgagcaagg gcgaggag 818

Claims

1. Use of a reagent for detecting the expression level of the RhoE gene in the preparation of a product for assisting in the diagnosis of myocardial fibrosis caused by diabetes; the nucleotide sequence of the RhoE gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The RhoE gene is downregulated in patients with myocardial fibrosis caused by diabetes.

3. The use according to claim 1, characterized in that The reagent for detecting the expression level of the RhoE gene includes a primer set; the primer set includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

4. Use of a recombinant adeno-associated viral vector in the preparation of a drug for treating diabetic cardiomyopathy and / or alleviating myocardial fibrosis caused by diabetes; the recombinant adeno-associated viral vector is obtained by inserting the RhoE gene into the AAV9 virus; the nucleotide sequence of the RhoE gene is shown in SEQ ID NO.

1.

5. The use according to claim 4, characterized in that The dosage form of the drug includes injection.

Images