Gene editing system for constructing three-gene combined mutant of small pig nuclear transfer donor cell and application thereof

By using CRISPR/Cas9 technology combined with dual gRNA to edit the GHR, IGF1 and IGF2 genes, preparing recombinant cells and performing somatic cell nuclear transplantation, the problems of low efficiency and high cost in constructing miniature pig models were solved, stable genetic variation and efficient gene editing were achieved, and an experimental model for the study of growth and development disorders was provided.

CN115232817BActive Publication Date: 2025-10-21NANJING KGENE GENETIC ENG CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202111019980.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-01
Publication Date
2025-10-21
Estimated Expiration
2041-09-01

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively construct miniature pig models to simulate human growth and development disorders or delays, and existing gene editing technologies have problems of low efficiency and high cost when applied to large animals.

Method used

CRISPR/Cas9 technology combined with dual gRNA was used to edit the GHR, IGF1, and IGF2 genes. Pig cells were transfected in vitro and electroporated to prepare recombinant cells. Gene mutation was achieved using an optimized ratio of Cas9 protein and gRNA, and miniature or model pigs were obtained through somatic cell nuclear transplantation.

Benefits of technology

It has achieved stable genetic variation in miniature pigs, shortened the production cycle of model pigs, reduced costs, improved gene editing efficiency, and provided an effective experimental model for drug screening and pathogenesis research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003241059810000231
    Figure BDA0003241059810000231
  • Figure BDA0003241059810000241
    Figure BDA0003241059810000241
  • Figure BDA0003241059810000251
    Figure BDA0003241059810000251
Patent Text Reader

Abstract

The application discloses a gene editing system for constructing a three-gene (GHR gene, IGF1 gene and IGF2 gene) combined mutation small pig nuclear transfer donor cell and application thereof. The application provides a kit comprising GHR-E5-gRNA2 shown in SEQ ID NO: 36, GHR-E5-gRNA3 shown in SEQ ID NO: 37, IGF1-E4-gRNA1 shown in SEQ ID NO: 38, IGF1-E4-gRNA2 shown in SEQ ID NO: 39, IGF2-E4-gRNA2 shown in SEQ ID NO: 40, IGF2-E4-gRNA7 shown in SEQ ID NO: 41 and NCN protein. The NCN protein is a Cas9 protein or a fusion protein with the Cas9 protein. The application adopts CRISPR / Cas9 technology combined with double gRNA editing to perform combined knockout of the GHR gene, the IGF1 gene and the IGF2 gene, and obtains a single cell clone with three-gene combined knockout, thereby laying a foundation for breeding small pigs and growth and development disorder or retardation model pigs through somatic cell nuclear transfer animal cloning technology in the later stage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically to a gene editing system for constructing miniature pig nuclear transplant donor cells with combined mutations of three genes (GHR gene, IGF1 gene and IGF2 gene) and its application. Background Art

[0002] Generally, animal growth is regulated by the somatostatin axis. This somatostatin axis is a neuroendocrine system consisting of a series of hormones and their receptors in the hypothalamus-pituitary-target organ system. It is composed of growth hormone-releasing factor (GRF), growth hormone (GH), and insulin-like growth factor (IGF). The growth hormone receptor (GHR) is a transmembrane protein encoded by a single gene and is a member of the cytokine receptor superfamily. GHR plays an important role in animal growth, development, and metabolism, and its dysfunction leads to growth retardation. Insulin-like growth factor I (IGF1) and insulin-like growth factor II (IGF2) play a crucial role in bone development and growth. Both osteocytes and chondrocytes produce IGF1 and IGF2, which promote their proliferation and functional changes (such as collagen and glycosaminoglycan production, respectively). Although the relative concentrations of IGF1 and IGF2 in bone vary among species and change from embryonic to postnatal stages, both are essential for normal development. Studies have shown that a lack of either IGF1 or IGF2 can cause animals to be smaller at birth.

[0003] Pigs, long domesticated livestock, are known for their docile temperaments and ideal companion animals. However, due to their generally large size, they have not been widely marketed as pets. Therefore, the development of miniature pigs will increase their market share in the pet market and has broad application prospects. Furthermore, miniature pigs created by editing growth-related genes can mimic human genetic diseases such as growth disorders or retardation, providing effective animal models for the treatment and pathogenesis of related human genetic diseases.

[0004] Gene editing is a biotechnology that has made significant progress in recent years. It includes gene editing based on homologous recombination to nuclease-based ZFN, TALEN, CRISPR / Cas9 and other editing technologies. Among them, CRISPR / Cas9 technology is currently the most advanced gene editing technology. Summary of the Invention

[0005] The purpose of the present invention is to provide a gene editing system for constructing miniature pig nuclear transplant donor cells with combined mutations of three genes (GHR gene, IGF1 gene and IGF2 gene) and its application.

[0006] The present invention provides a kit comprising GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein.

[0007] The present invention also provides a kit comprising GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and PRONCN protein.

[0008] The present invention also provides a kit comprising GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and a specific plasmid.

[0009] The present invention also provides the use of GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein in preparing a kit.

[0010] The present invention also provides the use of GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and PRONCN protein in preparing a kit.

[0011] The present invention also provides the use of GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and specific plasmids in preparing a kit.

[0012] Any of the above kits further comprises pig cells.

[0013] The present invention also provides a method for preparing recombinant cells, comprising the following steps: co-transfecting GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein into pig cells to obtain recombinant cells.

[0014] The uses of any of the above kits are as follows (a) or (b) or (c) or (d) or (e) or (f) or (g): (a) preparing recombinant cells; (b) preparing miniature pigs; (c) breeding pigs with reduced body size; (d) preparing a pig model with growth retardation; (e) preparing a cell model with growth retardation, a tissue model with growth retardation, or an organ model with growth retardation; (f) preparing a pig model with growth and development disorders; (g) preparing a cell model with growth and development disorders, a tissue model with growth and development disorders, or an organ model with growth and development disorders.

[0015] The co-transfection specifically adopts the method of electric shock transfection.

[0016] The parameters for electroporation can be set as follows: 1450V, 10ms, 3 pulses.

[0017] The co-transfection can be specifically performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.

[0018] The ratios of GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein are: 0.4-0.6μg GHR-E5-gRNA2: 0.4-0.6μg GHR-E5-gRNA3: 0.4-0.6μg IGF1-E4-gRNA1: 0.4-0.6μg IGF1-E4-gRNA2: 0.4-0.6μg IGF2-E4-gRNA2: 0.4-0.6μg IGF2-E4-gRNA7: 5-7μg NCN protein.

[0019] The ratios of GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein are: 0.5 μg GHR-E5-gRNA2: 0.5 μg GHR-E5-gRNA3: 0.5 μg IGF1-E4-gRNA1: 0.5 μg IGF1-E4-gRNA2: 0.5 μg IGF2-E4-gRNA2: 0.5 μg IGF2-E4-gRNA7: 6 μg NCN protein.

[0020] The ratios of pig cells, GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein are as follows: 100,000 pig cells: 0.4-0.6μg GHR-E5-gRNA2: 0.4-0.6μg GHR-E5-gRNA3: 0.4-0.6μg IGF1-E4-gRNA1: 0.4-0.6μg IGF1-E4-gRNA2: 0.4-0.6μg IGF2-E4-gRNA2: 0.4-0.6μg IGF2-E4-gRNA7: 5-7μg NCN protein.

[0021] The ratios of pig cells, GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein are as follows: 100,000 pig cells: 0.5μg GHR-E5-gRNA2: 0.5μg GHR-E5-gRNA3: 0.5μg IGF1-E4-gRNA1: 0.5μg IGF1-E4-gRNA2: 0.5μg IGF2-E4-gRNA2: 0.5μg IGF2-E4-gRNA7: 6μg NCN protein.

[0022] Any of the above GHR-E5-gRNA2 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 36.

[0023] Specifically, the GHR-E5-gRNA2 is shown in SEQ ID NO: 36.

[0024] Specifically, the GHR-E5-gRNA2 is shown in SEQ ID NO: 11.

[0025] Any of the above GHR-E5-gRNA3 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 37.

[0026] Specifically, the GHR-E5-gRNA3 is shown in SEQ ID NO: 37.

[0027] Specifically, the GHR-E5-gRNA3 is shown in SEQ ID NO: 12.

[0028] Any of the above IGF1-E4-gRNA1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 38.

[0029] Specifically, the IGF1-E4-gRNA1 is shown in SEQ ID NO: 38.

[0030] Specifically, the IGF1-E4-gRNA1 is shown in SEQ ID NO: 16.

[0031] Any of the above IGF1-E4-gRNA2 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 39.

[0032] Specifically, the IGF1-E4-gRNA2 is shown in SEQ ID NO: 39.

[0033] Specifically, the IGF1-E4-gRNA2 is shown in SEQ ID NO: 17.

[0034] Any of the above IGF2-E4-gRNA2 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 40.

[0035] Specifically, the IGF2-E4-gRNA2 is shown in SEQ ID NO: 40.

[0036] Specifically, the IGF2-E4-gRNA2 is shown in SEQ ID NO: 23.

[0037] Any of the above IGF2-E4-gRNA7 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 41.

[0038] Specifically, the IGF2-E4-gRNA7 is shown in SEQ ID NO: 41.

[0039] Specifically, the IGF2-E4-gRNA7 is shown in SEQ ID NO: 28.

[0040] Any of the above-mentioned NCN proteins is a Cas9 protein or a fusion protein with a Cas9 protein.

[0041] Specifically, the NCN protein is shown in SEQ ID NO: 3.

[0042] Any of the above pig cells is a pig somatic cell.

[0043] Any of the above pig cells is a pig fibroblast.

[0044] Any of the above pig cells is a primary pig fibroblast.

[0045] The preparation method of the NCN protein comprises the following steps:

[0046] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria;

[0047] (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria;

[0048] (3) crushing the collected bacteria and collecting the crude protein solution;

[0049] (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography;

[0050] (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein;

[0051] Plasmid pKG-GE4 contains the fusion gene represented by nucleotides 5209 to 9852 in SEQ ID NO: 1.

[0052] The preparation method of the NCN protein specifically comprises the following steps:

[0053] (1) The plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.

[0054] (2) inoculating the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culturing with shaking;

[0055] (3) The bacterial solution obtained in step (2) was inoculated into liquid LB medium and cultured at 30°C and 230 rpm until the OD 600nm value = 1.0, then IPTG was added to make its concentration in the system 0.5 mM, and then cultured with shaking at 25°C and 230 rpm for 12 hours, and then the bacteria were collected by centrifugation;

[0056] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;

[0057] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then crush the bacterial cells, collect the supernatant by centrifugation, filter with a 0.22 μm pore size filter membrane, and collect the filtrate;

[0058] (6) Purifying the His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) from the filtrate obtained in step (5) by affinity chromatography;

[0059] (7) The column solution collected in step (6) was concentrated using an ultrafiltration tube and then diluted with 25 mM Tris-HCl (pH 8.0);

[0060] (8) adding recombinant bovine enterokinase with a His6 tag to the solution obtained in step (7) and performing enzymatic digestion;

[0061] (9) Mixing the solution obtained in step (8) with Ni-NTA resin, incubating, and then centrifuging to collect the supernatant;

[0062] (10) The supernatant obtained in step (9) was concentrated using an ultrafiltration tube and then added to the enzyme storage solution to obtain the NCN protein solution.

[0063] The specific method for purifying the fusion protein with the His6 tag from the filtrate obtained in step (5) by affinity chromatography is as follows:

[0064] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate of 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate of 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0065] Any of the above PRONCN proteins includes the following elements from upstream to downstream: a signal peptide, a molecular chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.

[0066] The function of the signal peptide is to promote protein secretion and expression. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, the Staphylococcus aureus protein A signal peptide, the Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretion and expression of the target protein into the bacterial periplasm, thereby separating it from the bacterial intracellular proteins. The target protein secreted into the bacterial periplasm is expressed as a soluble protein and can be cleaved by the signal peptidase in the bacterial periplasm.

[0067] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably thioredoxin (TrxA protein). Thioredoxin can act as a molecular chaperone to help the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improve protein stability, correct folding, and increase the solubility and activity of the target protein.

[0068] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, more preferably a His tag. The His tag can bind to a Ni column, allowing the target protein to be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein.

[0069] The function of the protease cleavage site is to be used to remove the non-functional segment after purification to release the natural form of Cas9 protein. The protease can be selected from enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease or any other endoprotease, and enterokinase is further preferred. EK is an enterokinase cleavage site, which is convenient for using enterokinase to remove the fused TrxA-His segment to obtain the natural form of Cas9 protein. After the commercial enterokinase with a His tag is used to cut the fusion protein, the TrxA-His segment and the enterokinase with a His tag can be removed by one affinity chromatography to obtain the natural form of Cas9 protein, thereby avoiding the damage and loss of the target protein caused by multiple purification and dialysis.

[0070] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. NLS is a nuclear localization signal, and an NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, to enable Cas9 to more effectively enter the cell nucleus for gene editing.

[0071] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.

[0072] The PRONCN protein is specifically shown in SEQ ID NO: 2.

[0073] Any of the above-mentioned specific plasmids includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a gene encoding PRONCN protein, and a terminator.

[0074] The promoter may specifically be a T7 promoter, which is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.

[0075] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, IPTG can be used to induce expression of the target protein at low temperatures. This can prevent the impact of premature expression of the target protein on host bacterial growth. Inducing expression at low temperatures also significantly improves the solubility of the expressed target protein.

[0076] The ribosome binding site is a ribosome binding site during protein translation and is necessary for protein translation.

[0077] The terminator may specifically be a T7 terminator, which can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.

[0078] For the codons of the spCas9 protein, this application has optimized its codons to make it fully adapt to the codon preference of the Escherichia coli high-efficiency expression strain E. coli BL21 (DE3) selected in this application, thereby improving the expression level of the Cas9 protein.

[0079] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0080] The Lac operon is shown in nucleotides 5140 to 5164 of SEQ ID NO: 1.

[0081] The ribosome binding site is shown in nucleotides 5178 to 5201 of SEQ ID NO: 1.

[0082] The coding sequence of the alkaline phosphatase signal peptide is shown in nucleotides 5209 to 5271 in SEQ ID NO: 1.

[0083] The coding sequence of the TrxA protein is shown in nucleotides 5272-5598 in SEQ ID NO: 1.

[0084] The coding sequence of His-Tag is shown in nucleotides 5620-5637 in SEQ ID NO: 1.

[0085] The coding sequence of the enterokinase cleavage site is shown in nucleotides 5638 to 5652 in SEQ ID NO: 1.

[0086] The coding sequence of the nuclear localization signal is shown in nucleotides 5656-5670 of SEQ ID NO: 1.

[0087] The coding sequence of the spCas9 protein is shown in nucleotides 5701-9801 in SEQ ID NO: 1.

[0088] The coding sequence of the nuclear localization signal is shown in nucleotides 9802-9849 of SEQ ID NO: 1.

[0089] The T7 terminator is represented by nucleotides 9902 to 9949 in SEQ ID NO: 1.

[0090] Specifically, the specific plasmid is plasmid pKG-GE4.

[0091] Plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121 to 9949 in SEQ ID NO: 1.

[0092] Specifically, any one of the above plasmids pKG-GE4 is shown as SEQ ID NO: 1.

[0093] The present invention also protects recombinant cells, which are cells with combined mutations in the GHR gene, the IGF1 gene and the IGF2 gene.

[0094] The present invention also protects recombinant cells, which are cells in which the GHR gene, the IGF1 gene and the IGF2 gene are jointly knocked out.

[0095] The recombinant cell may be a recombinant cell prepared by any of the above methods.

[0096] The recombinant cell may be a cell in which the genotype of the IGF1 gene is heterozygous, the genotype of the GHR gene is biallelic identical mutation type or biallelic different mutation type, and the genotype of the IGF2 gene is biallelic identical mutation type or biallelic different mutation type.

[0097] The recombinant cell may be a single cell clone numbered 9, 35, 36, 54, 63, 65, 69, 75, 79 or 81 in Table 1.

[0098] Any of the above mutations is a deletion and / or insertion and / or substitution of one or more nucleotides.

[0099] The present invention also protects the use of the recombinant cell in preparing miniature pigs.

[0100] The recombinant cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, i.e. miniature pigs.

[0101] Miniature pigs can be used as pet pigs.

[0102] Minipigs refer to pigs that are smaller in size than the pigs from which the pig cells were derived.

[0103] The present invention also protects the use of the recombinant cell in preparing a growth retardation model pig.

[0104] The recombinant cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, which are model pigs with growth retardation.

[0105] The present invention also protects the pig tissue of the model pig prepared by using the recombinant cells, that is, the tissue model of growth retardation.

[0106] The present invention also protects the pig organs of the model pig prepared by using the recombinant cells, that is, the organ model of growth retardation.

[0107] The present invention also protects pig cells of a model pig prepared using the recombinant cells, that is, a cell model of growth retardation.

[0108] The present invention also protects the use of the recombinant cell, the growth retardation tissue model, the growth retardation organ model, the growth retardation cell model or the growth retardation model pig, which is as follows (d1) or (d2) or (d3) or (d4):

[0109] (d1) Screening for drugs to treat growth retardation;

[0110] (d2) Conduct efficacy evaluation of growth retardation drugs;

[0111] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for growth retardation;

[0112] (d4) To study the pathogenesis of growth retardation.

[0113] Any of the above growth retardation may be congenital growth retardation.

[0114] Any of the above-mentioned growth retardation may be autosomal recessive congenital growth retardation.

[0115] Any of the above growth retardation is caused by a combined mutation of the GHR gene, the IGF1 gene and the IGF2 gene.

[0116] The present invention also protects the use of the recombinant cells in preparing a model pig with growth and development disorders.

[0117] The recombinant cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, which are model pigs with growth and development disorders.

[0118] The present invention also protects the pig tissue of the model pig prepared by using the recombinant cells, that is, the tissue model of growth and development disorders.

[0119] The present invention also protects pig organs of model pigs prepared using the recombinant cells, namely, organ models of growth and development disorders.

[0120] The present invention also protects pig cells of a model pig prepared using the recombinant cells, that is, a cell model of growth and development disorders.

[0121] The present invention also protects the use of the recombinant cell, the tissue model of growth and development disorder, the organ model of growth and development disorder, the cell model of growth and development disorder, or the pig model of growth and development disorder, which is as follows (d5) or (d6) or (d7) or (d8):

[0122] (d5) Screening for drugs to treat growth and development disorders;

[0123] (d6) Conduct efficacy evaluation of growth and development disorder drugs;

[0124] (d7) Evaluate the efficacy of gene therapy and / or cell therapy for growth and development disorders;

[0125] (d8) Study the pathogenesis of growth and development disorders.

[0126] Any of the above growth and development disorders may be congenital growth and development disorders.

[0127] Any of the above growth and development disorders may be autosomal recessive congenital growth and development disorders.

[0128] Any of the above growth and development disorders is caused by a combined mutation of the GHR gene, the IGF1 gene and the IGF2 gene.

[0129] Any of the above-mentioned pigs can specifically be Congjiang Xiang pigs.

[0130] Porcine GHR gene information: encodes growth hormone receptor; located on chromosome 16; GeneID is 397488, Sus scrofa.

[0131] The amino acid sequence encoded by the porcine GHR gene is shown in SEQ ID NO:8.

[0132] The porcine GHR gene has a DNA segment shown in SEQ ID NO:9.

[0133] Porcine IGF1 gene information: encodes insulin-like growth factor 1 (insulin like growth factor 1); located on chromosome 5; GeneID is 397491, Sus scrofa.

[0134] The amino acid sequence encoded by the porcine IGF1 gene is shown in SEQ ID NO: 14.

[0135] The porcine IGF1 gene has the DNA segment represented by SEQ ID NO:15.

[0136] Pig IGF2 gene information: encodes insulin-like growth factor 2; located on chromosome 2; GeneID is 396916, Sus scrofa.

[0137] The amino acid sequence encoded by the porcine IGF2 gene is shown in SEQ ID NO: 20.

[0138] The porcine IGF2 gene has a DNA segment represented by SEQ ID NO:21.

[0139] Compared with the prior art, the present invention has at least the following beneficial effects:

[0140] (1) The research object of the present invention (pig) has better applicability than other animals (rat, mouse, and primate).

[0141] Rodents such as mice and rats differ significantly from humans in terms of body shape, organ size, physiology, and pathology, making them unable to truly simulate normal human physiological and pathological conditions. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but their small size, late sexual maturity (mating begins at 6-7 years old), and single-birth primates make population expansion extremely slow and their breeding costs very high. Furthermore, primate cloning is inefficient, difficult, and costly.

[0142] Pigs, however, do not have these drawbacks as model animals. They are the closest relative to humans besides primates, with body shape, weight, and organ size similar to humans. Their anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis are highly similar to humans. Furthermore, pigs reach sexual maturity early (4-6 months), have high fertility, and can produce many offspring per litter, allowing them to form a large population within 2-3 years. Furthermore, pig cloning technology is highly mature, and the costs of cloning and rearing pigs are much lower than those of primates. Therefore, pigs are highly suitable as models for human diseases.

[0143] (2) The vector constructed by the present invention uses a strong promoter T7-lac that can efficiently express the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein into the bacterial periplasmic cavity, thereby separating it from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is soluble. At the same time, the thioredoxin TrxA and Cas9 protein are fused and expressed. TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. At the same time, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment to obtain the natural form of the Cas9 protein. After the fusion protein is cleaved by His-tagged enterokinase, the TrxA-His polypeptide fragment and His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of the Cas9 protein, avoiding damage and loss to the target protein caused by multiple purification and dialysis. At the same time, the present invention also designs an NLS site at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the cell nucleus for gene editing. In addition, the present invention selects the E. coli BL21 (DE3) strain as the target protein expression strain. This strain can efficiently express exogenous genes cloned in an expression vector containing a bacteriophage T7 promoter (such as pET-32a). At the same time, the present invention performs codon optimization on the codons of the Cas9 protein to fully adapt to the codon preference of the expression strain, thereby improving the expression level of the target protein. In addition, after the bacteria grow to a certain number, the present invention uses IPTG to induce the expression of the target protein at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Inducing expression at low temperature also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization designs and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with the commercial Cas9 protein.

[0144] (3) The Cas9 high-efficiency protein constructed and expressed by the present invention was combined with in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA was optimized.

[0145] (4) The present invention uses a dual gRNA combination for mutation, which can effectively reduce the generation of non-frameshift mutations compared to the use of a single gRNA. If a single gRNA is used to mutate the target gene, there will be a 1 / 3 probability of generating a non-frameshift mutation of the base during the random repair of DNA non-homologous end joining (NHEJ), and the non-frameshift mutation is likely to fail to destroy the function of the target gene and fail to achieve the expected goal of inactivating the target gene. When a dual gRNA is used to cut and mutate the target gene, a fragment of the target gene can be removed. By designing and removing base fragments that are not three times the number, a fragment deletion frameshift mutation of the target gene can be effectively generated. In addition, in addition to causing theoretical fragment deletion, dual gRNA also has the possibility of separate cutting by a single gRNA, thereby greatly increasing the efficiency of gene mutation.

[0146] (5) Using the target gene knockout single cell clone obtained by the present invention to carry out somatic cell nuclear transplantation animal cloning can directly obtain cloned pigs with target gene knockout, and the gene mutation can be stably inherited.

[0147] The method of embryo transplantation after microinjection of gene editing materials into fertilized eggs used in mouse model production is relatively low in terms of the probability of directly obtaining offspring with gene mutations, and requires hybridization and breeding of offspring, which is not suitable for the production of large animals (such as pigs) with long gestation periods. Therefore, the present invention adopts a method of in vitro editing of primary cells with high technical difficulty and high challenge, and double gRNA cutting and screening of positive edited single-cell clones. In the later stage, miniature pigs or model pigs are directly obtained by somatic cell nuclear transplantation animal cloning technology, which can greatly shorten the production cycle of miniature pigs or model pigs and save manpower, material resources and financial resources.

[0148] The present invention uses CRISPR / Cas9 technology combined with dual gRNA editing to jointly knock out the GHR gene, IGF1 gene and IGF2 gene, and obtains single-cell clones with the three genes jointly knocked out, laying the foundation for the later breeding of miniature pigs or model pigs through somatic cell nuclear transfer animal cloning technology.

[0149] This invention will help study and reveal the pathogenesis of growth disorders / stunting caused by dysfunctional GHR, IGF1, and IGF2 genes. It can also be used for drug screening, efficacy evaluation, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and, in turn, providing a powerful experimental approach for the successful treatment of growth disorders / stunting in humans. This invention has significant application value in the development of drugs for growth disorders / stunting and in revealing the pathogenesis of these diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0150] Figure 1This is the electrophoresis diagram of PCR amplification performed using the genome extracted from the ear tissue of the pig named 1 as a template using different primer pairs in Example 1.

[0151] Figure 2 The electrophoretic diagrams are obtained by using the genomic DNA of 18 pigs as templates and the primer pair consisting of GHR-E5-F132 and GHR-E5-R467 for PCR amplification in Example 1.

[0152] Figure 3 This is a sequencing peak graph comparing the editing efficiency of different target combinations in Example 1.

[0153] Figure 4 This is the electrophoresis diagram of PCR amplification using the genome extracted from the ear tissue of the pig named 1 as a template using different primer pairs in Example 2.

[0154] Figure 5 The electrophoretic diagrams are obtained by using the genomic DNA of 18 pigs as templates and the primer pair consisting of IGF1-E4-F114 and IGF1-E4-R575 for PCR amplification in Example 2.

[0155] Figure 6 This is a sequencing peak graph comparing the editing efficiency of different target combinations in Example 2.

[0156] Figure 7 This is the electrophoresis diagram of PCR amplification using the genome extracted from the ear tissue of the pig named 1 as a template using different primer pairs in Example 3.

[0157] Figure 8 The electrophoretic diagrams are obtained by using the genomic DNA of 18 pigs as templates and the primer pair consisting of IGF2-E4-F136 and IGF2-E4-R728 for PCR amplification in Example 3.

[0158] Figure 9 This is a sequencing peak diagram comparing the editing efficiency of different target combinations in Example 3.

[0159] Figure 10 Schematic diagram of the structure of plasmid pET-32a.

[0160] Figure 11 Schematic diagram of the structure of plasmid pKG-GE4.

[0161] Figure 12 This is the electrophoresis diagram of the optimized ratio of gRNA to NCN protein in Example 6.

[0162] Figure 13 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 6.

[0163] Figure 14 This is the result of reverse sequencing of the single cell clone numbered 63 and the comparison with the wild-type sequence (GHR gene).

[0164] Figure 15 This is the result of reverse sequencing of the single cell clone numbered 63 and the comparison with the wild-type sequence (IGF1 gene).

[0165] Figure 16 This is the result of reverse sequencing of the single cell clone numbered 63 and the comparison with the wild-type sequence (IGF2 gene). DETAILED DESCRIPTION

[0166] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0167] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good results. The commercial Cas9-B protein is a commercially available Cas9 protein with good results. Complete culture medium (% is volume ratio): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, constant temperature incubator with 5% CO2 and 5% O2.

[0168] The primary porcine fibroblasts used in the examples were prepared from ear tissue of fresh-born Congjiang Xiang pigs. The following preparation methods were used: ① 0.5 g of pig ear tissue was removed, hair and bone tissue removed, and then soaked in 75% alcohol for 30-40 seconds. The tissue was then washed five times with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco), followed by one wash with PBS buffer. ② The tissue was minced with scissors and digested with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 hour. The cells were then centrifuged at 500 g for 5 minutes and the supernatant discarded. ③ The pellet was resuspended in 1 mL of complete culture medium and plated onto a 10 cm diameter cell culture dish sealed with 0.2% gelatin (VWR) containing 10 mL of complete culture medium. The cells were cultured until they approximately covered 60% of the bottom of the dish. ④ After completing step ③, the cells were trypsinized, harvested, and resuspended in complete culture medium. These cells were used for subsequent electroporation experiments.

[0169] Plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in patent application 202010084343.6. In NO: 2, nucleotides 395-680 constitute the CMV enhancer, nucleotides 682-890 constitute the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the self-cleavage polypeptide P2A (the amino acid sequence of the self-cleavage polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the self-cleavage cleavage position is The sequence of the nucleotide sequence of the present invention is as follows: nucleotides 5333-6046 encode the EGFP protein, nucleotides 6056-6109 encode the self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the cleavage site is between the first and second amino acid residues starting from the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 constitute the WPRE sequence element, nucleotides 7382-7615 constitute the 3'LTR sequence element, and nucleotides 7647-7871 constitute the bGH poly(A) signal sequence element. In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 911-6706 form a fusion gene to express the fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0170] The pKG-U6gRNA vector, or plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in patent application 202010084343.6. In SEQ ID NO: 3 in patent application 202010084343.6, nucleotides 2280-2539 constitute the hU6 promoter, and nucleotides 2558-2637 are used to transcribe the gRNA backbone. During use, a 20-bp DNA molecule (used to transcribe the target sequence binding region of the gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, which is then transcribed in cells to produce the gRNA.

[0171] Example 1. Screening of efficient gRNA target combinations for the GHR gene

[0172] Porcine GHR gene information: Encodes growth hormone receptor; located on chromosome 16; GeneID 397488, Sus scrofa. The amino acid sequence of the protein encoded by the porcine GHR gene is shown in SEQ ID NO: 8. In porcine genomic DNA, the GHR gene has a total of 17 exons, of which 10 are coding exons, and exons 1-6 encode the extracellular region of the GHR protein. In the present invention, the 5th coding exon of the GHR gene was used as the target region for gene editing. The nucleotide sequence of the 5th coding exon and its upstream and downstream parts are shown in SEQ ID NO: 9.

[0173] 1. Conservation analysis of the pre-specified target region of the GHR gene and adjacent genomic sequences

[0174] 18 newborn Congjiang Xiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0175] GHR-E5-F132:CTGGAATTAAGGGCCGACAGA;

[0176] GHR-E5-R454: GTCAGAAAGGCATGAAGGCTGTA;

[0177] GHR-E5-F133: TGGAATTAAGGGCCGACAGA;

[0178] GHR-E5-R467:CATGGAGAGAAAAGTCAGAAAGGC.

[0179] The genome was extracted from the ear tissue of the pig named 1 and used as a template. PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. Figure 1 . Figure 1 Middle: Group 1: Uses the primer pair consisting of GHR-E5-F132 and GHR-E5-R454; Group 2: Uses the primer pair consisting of GHR-E5-F132 and GHR-E5-R467; Group 3: Uses the primer pair consisting of GHR-E5-F133 and GHR-E5-R454; Group 4: Uses the primer pair consisting of GHR-E5-F133 and GHR-E5-R467. The results show that the primer pair consisting of GHR-E5-F132 and GHR-E5-R467 is preferred for amplifying the target fragment.

[0180] PCR amplification was performed using the genomic DNA of 18 pigs as templates, using the primer pair consisting of GHR-E5-F132 and GHR-E5-R467, and then subjected to 1% agarose gel electrophoresis. Figure 2 The PCR amplification products were recovered and sequenced, and the sequencing results were compared with the GHR gene sequence of the porcine reference genome (susscrofa11.1). The conserved regions shared by 18 pigs were selected for gRNA target design.

[0181] 2. Target Screening

[0182] By screening NGG (avoiding possible mutation sites), several targets were initially screened, and 4 targets were further screened after preliminary experiments.

[0183] The four targets are as follows:

[0184] GHR-E5-g1:CAGGGCTCTGTAAACCGTGA;

[0185] GHR-E5-g2:GACGGACCCCATCTGTCCAG;

[0186] GHR-E5-g3:AAGTCTCTAGTTCAGGTGAA;

[0187] GHR-E5-g4: TGGACAGATGGGGTCCGTCA.

[0188] 3. Preparation of gRNA

[0189] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0190] GHR-E5-g1-S and GHR-E5-g1-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (GHR-E5-g1). Plasmid pKG-U6gRNA (GHR-E5-g1) expresses the sgRNA shown in SEQ ID NO: 10 GHR-E5-g1 .

[0191] sgRNA GHR-E5-g1 (SEQ ID NO: 10):

[0192] CAGGGCUCUGUAAACCGUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0193] GHR-E5-g2-S and GHR-E5-g2-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (GHR-E5-g2). Plasmid pKG-U6gRNA (GHR-E5-g2) expresses the sgRNA shown in SEQ ID NO: 11 GHR-E5-g2 .

[0194] sgRNA GHR-E5-g2 (SEQ ID NO: 11):

[0195] GACGGACCCCAUCUGUCCAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0196] GHR-E5-g3-S and GHR-E5-g3-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (GHR-E5-g3). Plasmid pKG-U6gRNA (GHR-E5-g3) expresses the sgRNA shown in SEQ ID NO: 12 GHR-E5-g3 .

[0197] sgRNA GHR-E5-g3 (SEQ ID NO: 12):

[0198] AAGUCUCUAGUUCAGGUGAAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0199] GHR-E5-g4-S and GHR-E5-g4-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (GHR-E5-g4). Plasmid pKG-U6gRNA (GHR-E5-g4) expresses the sgRNA shown in SEQ ID NO: 13 GHR-E5-g4 .

[0200] sgRNA GHR-E5-g4 (SEQ ID NO: 13):

[0201] UGGACAGAUGGGGUCCGUCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0202] GHR-E5-g1-S:caccgCAGGGCTCTGTAAACCGTGA;

[0203] GHR-E5-g1-A:aaacTCACGGTTTACAGAGCCCTGc;

[0204] GHR-E5-g2-S: caccGACGGACCCCATCTGTCCAG;

[0205] GHR-E5-g2-A:aaacCTGGACAGATGGGGTCCGTC;

[0206] GHR-E5-g3-S:caccgAAGTTCCTAGTTCAGGTGAA;

[0207] GHR-E5-g3-A:aaacTTCACCTGAACTAGAGACTTc;

[0208] GHR-E5-g4-S: caccgTGGACAGATGGGGTCCGTCA;

[0209] GHR-E5-g4-A:aaacTGACGGACCCCATCTGTCCAc.

[0210] GHR-E5-g1-S, GHR-E5-g1-A, GHR-E5-g2-S, GHR-E5-g2-A, GHR-E5-g3-S, GHR-E5-g3-A, GHR-E5-g4-S, and GHR-E5-g4-A are all single-stranded DNA molecules.

[0211] 4. Comparison of Editing Efficiency of Different Target Combinations

[0212] 1. Co-transfection

[0213] Group 1: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (GHR-E5-g1) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (GHR-E5-g1): 1.08 μg plasmid pKG-GE3.

[0214] Group 2: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (GHR-E5-g2) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (GHR-E5-g2): 1.08 μg plasmid pKG-GE3.

[0215] Group 3: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (GHR-E5-g3) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (GHR-E5-g3): 1.08 μg plasmid pKG-GE3.

[0216] Group 4: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (GHR-E5-g4) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (GHR-E5-g4): 1.08 μg plasmid pKG-GE3.

[0217] Group 5: Primary porcine fibroblasts were electroporated with the same electroporation parameters but without adding plasmids.

[0218] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0219] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0220] 3. After completing step 2, trypsin was used to digest and collect the cells, the cells were lysed, and genomic DNA was extracted. PCR amplification was performed using a primer pair consisting of GHR-E5-F132 and GHR-E5-R467, followed by 1% agarose gel electrophoresis.

[0221] The target product was excised and recovered and sent to a sequencing company for sequencing (see the sequencing peak diagram). Figure 3 ) The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different targets. The gene editing efficiencies of groups 1 to 4 were 24%, 51%, 25%, and 16%, respectively. No gene editing occurred in group 5. The results showed that GHR-E5-g2 and GHR-E5-g3 had high editing efficiencies.

[0222] Example 2: Screening of efficient gRNA target combinations for the IGF1 gene

[0223] Porcine IGF1 gene information: Encodes insulin-like growth factor 1; located on chromosome 5; GeneID 397491, Sus scrofa. The amino acid sequence of the protein encoded by the porcine IGF1 gene is shown in SEQ ID NO: 14. In porcine genomic DNA, the IGF1 gene has a total of 8 exons, of which 7 are coding exons. In the present invention, the 4th coding exon of the IGF1 gene was targeted for gene editing. The nucleotide sequence of the 4th coding exon and its upstream and downstream regions is shown in SEQ ID NO: 15.

[0224] 1. Conservative analysis of the pre-specified target region of the IGF1 gene and adjacent genomic sequences

[0225] 18 newborn Congjiang Xiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0226] IGF1-E4-F114:AACAGTGGAACCCAGAAGGAC;

[0227] IGF1-E4-R547: ACGTTTTGGCACACTCACACT;

[0228] IGF1-E4-F189:TGTGGGTTGACAAGAGGTGG;

[0229] IGF1-E4-R575:TCCTCAGGGAGAGAACCAGGG.

[0230] The genome was extracted from the ear tissue of the pig named 1 and used as a template. PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. Figure 4 . Figure 4Middle: Group 1: Uses the primer pair consisting of IGF1-E4-F114 and IGF1-E4-R547; Group 2: Uses the primer pair consisting of IGF1-E4-F114 and IGF1-E4-R575; Group 3: Uses the primer pair consisting of IGF1-E4-F189 and IGF1-E4-R547; Group 4: Uses the primer pair consisting of IGF1-E4-F189 and IGF1-E4-R575. The results show that the primer pair consisting of IGF1-E4-F114 and IGF1-E4-R575 is preferred for amplifying the target fragment.

[0231] PCR amplification was performed using the genomic DNA of 18 pigs as templates, using the primer pair consisting of IGF1-E4-F114 and IGF1-E4-R575, and then subjected to 1% agarose gel electrophoresis. Figure 5 The PCR amplification products were recovered and sequenced, and the sequencing results were compared with the IGF1 gene sequence of the porcine reference genome (susscrofa11.1). The conserved regions shared by 18 pigs were selected for gRNA target design.

[0232] 2. Target Screening

[0233] By screening NGG (avoiding possible mutation sites), several targets were initially screened, and 4 targets were further screened after preliminary experiments.

[0234] The four targets are as follows:

[0235] IGF1-E4-g1:GAGCCTTGGGCATGTCCGTG;

[0236] IGF1-E4-g2:GCTTCCGGAGCTGTGATCTG;

[0237] IGF1-E4-g3:GGCGCCACAGACGGGCATCG;

[0238] IGF1-E4-g4:CGTCCGTGCCCAGCGCCACA.

[0239] 3. Preparation of gRNA

[0240] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0241] IGF1-E4-g1-S and IGF1-E4-g1-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF1-E4-g1). Plasmid pKG-U6gRNA (IGF1-E4-g1) expresses the sgRNA shown in SEQ ID NO: 16 IGF1-E4-g1 .

[0242] sgRNA IGF1-E4-g1 (SEQ ID NO: 16):

[0243] GAGCCUUGGGCAUGUCCGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0244] IGF1-E4-g2-S and IGF1-E4-g2-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF1-E4-g2). Plasmid pKG-U6gRNA (IGF1-E4-g2) expresses the sgRNA shown in SEQ ID NO: 17 IGF1-E4-g2 .

[0245] sgRNA IGF1-E4-g2 (SEQ ID NO: 17):

[0246] GCUUCCGGAGCUGUGAUCUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0247] IGF1-E4-g3-S and IGF1-E4-g3-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF1-E4-g3). Plasmid pKG-U6gRNA (IGF1-E4-g3) expresses the sgRNA shown in SEQ ID NO: 18 IGF1-E4-g3 .

[0248] sgRNA IGF1-E4-g3 (SEQ ID NO: 18):

[0249] GGCGCCACAGACGGGCAUCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0250] IGF1-E4-g4-S and IGF1-E4-g4-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain the plasmid pKG-U6gRNA (IGF1-E4-g4). The plasmid pKG-U6gRNA (IGF1-E4-g4) expresses the sgRNA shown in SEQ ID NO: 19 IGF1-E4-g4 .

[0251] sgRNA IGF1-E4-g4 (SEQ ID NO: 19):

[0252] CGUCCGUGCCCAGCGCCACAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0253] IGF1-E4-g1-S:caccGAGCCTTGGGCATGTCCGTG;

[0254] IGF1-E4-g1-A:aaacCACGGACATGCCCAAGGCTC;

[0255] IGF1-E4-g2-S: caccGCTTCCGGAGCTGTGATCTG;

[0256] IGF1-E4-g2-A:aaacCAGATCACAGCTCCGGAAGC;

[0257] IGF1-E4-g3-S:caccGGCGCCACAGACGGGCATCG;

[0258] IGF1-E4-g3-A:aaacCGATGCCCGTCTGTGGCGCC;

[0259] IGF1-E4-g4-S: caccgCGTCCGTGCCCAGCGCCACA;

[0260] IGF1-E4-g4-A:aaacTGTGGCGCTGGGCACGGACGc.

[0261] IGF1-E4-g1-S, IGF1-E4-g1-A, IGF1-E4-g2-S, IGF1-E4-g2-A, IGF1-E4-g3-S, IGF1-E4-g3-A, IGF1-E4-g4-S, and IGF1-E4-g4-A are all single-stranded DNA molecules.

[0262] 4. Comparison of Editing Efficiency of Different Target Combinations

[0263] 1. Co-transfection

[0264] Group 1: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF1-E4-g1) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF1-E4-g1): 1.08 μg plasmid pKG-GE3.

[0265] Group 2: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF1-E4-g2) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF1-E4-g2): 1.08 μg plasmid pKG-GE3.

[0266] Group 3: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF1-E4-g3) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF1-E4-g3): 1.08 μg plasmid pKG-GE3.

[0267] Group 4: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF1-E4-g4) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF1-E4-g4): 1.08 μg plasmid pKG-GE3.

[0268] Group 5: Primary porcine fibroblasts were electroporated with the same electroporation parameters but without adding plasmids.

[0269] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0270] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0271] 3. After completing step 2, trypsin was used to digest and collect the cells, the cells were lysed, genomic DNA was extracted, and PCR amplification was performed using a primer pair consisting of IGF1-E4-F114 and IGF1-E4-R575, followed by 1% agarose gel electrophoresis.

[0272] The target product was excised and recovered and sent to a sequencing company for sequencing (see the sequencing peak diagram). Figure 6 ) The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different targets. The gene editing efficiencies of groups 1 to 4 were 25%, 29%, 5%, and 1%, respectively. No gene editing occurred in group 5. The results showed that IGF1-E4-g1 and IGF1-E4-g2 had high editing efficiencies.

[0273] Example 3: Screening of efficient gRNA target combinations for the IGF2 gene

[0274] Porcine IGF2 gene information: Encodes insulin-like growth factor 2; located on chromosome 2; GeneID 396916, Sus scrofa. The amino acid sequence of the protein encoded by the porcine IGF2 gene is shown in SEQ ID NO: 20. In porcine genomic DNA, the IGF2 gene has a total of 12 exons, of which 5 are coding exons. In the present invention, the 4th coding exon of the IGF2 gene was targeted for gene editing. The nucleotide sequence of the 4th coding exon and its upstream and downstream regions is shown in SEQ ID NO: 21.

[0275] 1. Conservative analysis of the pre-specified target region of the IGF2 gene and adjacent genomic sequences

[0276] 18 newborn Congjiang Xiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0277] IGF2-E4-F278: CCTTGGTCCTGTGGGACTTC;

[0278] IGF2-E4-R728:CGGGGTATCTGGGGAAGTTG;

[0279] IGF2-E4-F136: GACCCCCACTCTCACTTCTT;

[0280] IGF2-E4-R602:GAAGACTGCCCTGGGCTTCTG.

[0281] The genome was extracted from the ear tissue of the pig named 1 and used as a template. PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. Figure 7 . Figure 7 Middle: Group 1: Uses the primer pair consisting of IGF2-E4-F136 and IGF2-E4-R602; Group 2: Uses the primer pair consisting of IGF2-E4-F278 and IGF2-E4-R602; Group 3: Uses the primer pair consisting of IGF2-E4-F136 and IGF2-E4-R728; Group 4: Uses the primer pair consisting of IGF2-E4-F278 and IGF2-E4-R728. The results show that the primer pair consisting of IGF2-E4-F136 and IGF2-E4-R728 is preferred for amplifying the target fragment.

[0282] PCR amplification was performed using the genomic DNA of 18 pigs as templates, using the primer pair consisting of IGF2-E4-F136 and IGF2-E4-R728, and then subjected to 1% agarose gel electrophoresis. Figure 8 The PCR amplification products were recovered and sequenced, and the sequencing results were compared with the IGF2 gene sequence of the porcine reference genome (susscrofa11.1). The conserved regions shared by 18 pigs were selected for gRNA target design.

[0283] 2. Target Screening

[0284] By screening NGG (avoiding possible mutation sites), several targets were initially screened, and 8 targets were further screened after preliminary experiments.

[0285] The 8 targets are as follows:

[0286] IGF2-E4-g1:AGCACTCTTCCACGATGCCA;

[0287] IGF2-E4-g2:GGCGCAGTAGGTCTCCAGCA;

[0288] IGF2-E4-g3: CCACCCCCGCCAAGTCCGAG;

[0289] IGF2-E4-g4:CTTCCACGATGCCACGGCTG;

[0290] IGF2-E4-g5: CCGCCGCAGCCGTGGCATCG;

[0291] IGF2-E4-g6: CACGGCTGCGGCGGTTCACG;

[0292] IGF2-E4-g7: CCACGATGCCACGGCTGCGG;

[0293] IGF2-E4-g8: AGTAGGTCTCCAGCAGGGCC.

[0294] 3. Preparation of gRNA

[0295] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0296] IGF2-E4-g1-S and IGF2-E4-g1-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF2-E4-g1). Plasmid pKG-U6gRNA (IGF2-E4-g1) expresses the sgRNA shown in SEQ ID NO: 22 IGF2-E4-g1 .

[0297] sgRNA IGF2-E4-g1 (SEQ ID NO: 22):

[0298] AGCACUCUUCCACGAUGCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0299] IGF2-E4-g2-S and IGF2-E4-g2-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF2-E4-g2). Plasmid pKG-U6gRNA (IGF2-E4-g2) expresses the sgRNA shown in SEQ ID NO: 23 IGF2-E4-g2 .

[0300] sgRNA IGF2-E4-g2 (SEQ ID NO: 23):

[0301] GGCGCAGUAGGUCUCCAGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0302] IGF2-E4-g3-S and IGF2-E4-g3-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF2-E4-g3). Plasmid pKG-U6gRNA (IGF2-E4-g3) expresses the sgRNA shown in SEQ ID NO: 24 IGF2-E4-g3 .

[0303] sgRNA IGF2-E4-g3 (SEQ ID NO: 24):

[0304] CCACCCCCGCCAAGUCCGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0305] IGF2-E4-g4-S and IGF2-E4-g4-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF2-E4-g4). Plasmid pKG-U6gRNA (IGF2-E4-g4) expresses the sgRNA shown in SEQ ID NO: 25 IGF2-E4-g4 .

[0306] sgRNA IGF2-E4-g4 (SEQ ID NO: 25):

[0307] CUUCCACGAUGCCACGGCUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0308] IGF2-E4-g5-S and IGF2-E4-g5-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF2-E4-g5). Plasmid pKG-U6gRNA (IGF2-E4-g5) expresses the sgRNA shown in SEQ ID NO: 26 IGF2-E4-g5 .

[0309] sgRNA IGF2-E4-g5 (SEQ ID NO: 26):

[0310] CCGCCGCAGCCGUGGCAUCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0311] IGF2-E4-g6-S and IGF2-E4-g6-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF2-E4-g6). Plasmid pKG-U6gRNA (IGF2-E4-g6) expresses the sgRNA shown in SEQ ID NO: 27 IGF2-E4-g6 .

[0312] sgRNA IGF2 - E4-g6 (SEQ ID NO: 27):

[0313] CACGGCUGCGGCGGUUCACGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0314] IGF2-E4-g7-S and IGF2-E4-g7-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (IGF2-E4-g7). Plasmid pKG-U6gRNA (IGF2-E4-g7) expresses the sgRNA shown in SEQ ID NO: 28 IGF2-E4-g7 .

[0315] sgRNA IGF2-E4-g7 (SEQ ID NO: 28):

[0316] CCACGAUGCCACGGCUGCGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0317] IGF2-E4-g8-S and IGF2-E4-g8-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain the plasmid pKG-U6gRNA (IGF2-E4-g8). The plasmid pKG-U6gRNA (IGF2-E4-g8) expresses the sgRNA shown in SEQ ID NO: 29. IGF2-E4-g8 .

[0318] sgRNA IGF2-E4-g8 (SEQ ID NO: 29):

[0319] AGUAGGUCUCCAGCAGGGCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0320] IGF2-E4-g1-S: caccgAGCACTCTTCCACGATGCCA;

[0321] IGF2-E4-g1-A:aaacTGGCATCGTGGAAGAGTGCTc;

[0322] IGF2-E4-g2-S: caccGGCGCAGTAGGTCTCCAGCA;

[0323] IGF2-E4-g2-A:aaacTGCTGGAGACCTACTGCGCC;

[0324] IGF2-E4-g3-S:caccgCCACCCCCGCCAAGTCCGAG;

[0325] IGF2-E4-g3-A:aaacCTCGGACTTGGCGGGGGTGGc;

[0326] IGF2-E4-g4-S:caccgCTTCCACGATGCCACGGCTG;

[0327] IGF2-E4-g4-A: aaacCAGCCGTGGCATCGTGGAAGc;

[0328] IGF2-E4-g5-S: caccgCCGCCGCAGCCGTGGCATCG;

[0329] IGF2-E4-g5-A: aaacCGATGCCACGGCTGCGGCGGc;

[0330] IGF2-E4-g6-S: caccgCACGGCTGCGGCGGTTCACG;

[0331] IGF2-E4-g6-A: aaacCGTGAACCGCCGCAGCCGTGc;

[0332] IGF2-E4-g7-S: caccgCCACGATGCCACGGCTGCGG;

[0333] IGF2-E4-g7-A: aaacCCGCAGCCGTGGCATCGTGGc;

[0334] IGF2-E4-g8-S: caccgAGTAGGTCTCCAGCAGGGCC;

[0335] IGF2-E4-g8-A: aaacGGCCCTGCTGGAGACCTACTc.

[0336] IGF2-E4-g1-S, IGF2-E4-g1-A, IGF2-E4-g2-S, IGF2-E4-g2-A, IGF2-E4-g3-S, IGF2-E4-g3-A, IGF2-E4-g4-S, IGF2-E4-g4-A, IGF2-E4-g5-S, IGF2-E4-g5-A, IGF2-E4-g6-S, IGF2-E4-g6-A, IGF2-E4-g7-S, IGF2-E4-g7-A, IGF2-E4-g8-S, IGF2-E4-g8-A are all single-stranded DNA molecules.

[0337] IV. Comparison of editing efficiencies of different target combinations

[0338] 1. Co-transfection

[0339] Group 1: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g1) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g1): 1.08 μg plasmid pKG-GE3.

[0340] Group 2: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g2) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g2): 1.08 μg plasmid pKG-GE3.

[0341] Group 3: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g3) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g3): 1.08 μg plasmid pKG-GE3.

[0342] Group 4: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g4) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g4): 1.08 μg plasmid pKG-GE3.

[0343] Group 5: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g5) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g5): 1.08 μg plasmid pKG-GE3.

[0344] Group 6: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g6) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g6): 1.08 μg plasmid pKG-GE3.

[0345] Group 7: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g7) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g7): 1.08 μg plasmid pKG-GE3.

[0346] Group 8: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (IGF2-E4-g8) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (IGF2-E4-g8): 1.08 μg plasmid pKG-GE3.

[0347] Group 9: Primary porcine fibroblasts, electroporated with the same electroporation parameters but without adding plasmids.

[0348] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0349] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0350] 3. After completing step 2, trypsin was used to digest and collect the cells, the cells were lysed, genomic DNA was extracted, and PCR amplification was performed using a primer pair consisting of IGF2-E4-F136 and IGF2-E4-R728, followed by 1% agarose gel electrophoresis.

[0351] The target product was excised and recovered and sent to a sequencing company for sequencing (see the sequencing peak diagram). Figure 9 ) The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different targets. The gene editing efficiencies of groups 1 to 8 were 9%, 14%, 1%, 1%, 11%, 5%, 18%, and 6%, respectively. No gene editing occurred in group 9. The results showed that IGF2-E4-g2 and IGF2-E4-g7 had the highest editing efficiencies.

[0352] Example 4. Construction of prokaryotic Cas9 efficient expression vector

[0353] The schematic diagram of the structure of plasmid pET-32a is shown in Figure 10 .

[0354] Plasmid pKG-GE4 was modified from plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid. The schematic diagram of the structure is shown in Figure 11 .

[0355] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode an alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as a His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotide sequence encoding the spCas9 protein has been codon-optimized for the Escherichia coli BL21(DE3) strain.

[0356] The main modifications of plasmid pKG-GE4 are as follows: ① The coding region of TrxA protein is retained. TrxA protein can help the expressed target protein form disulfide bonds and increase the solubility and activity of the target protein; the coding sequence of alkaline phosphatase signal peptide is added before the coding region of TrxA protein. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacterial membrane and can be cleaved by prokaryotic periplasmic signal peptidase; ② The coding sequence of His-Tag is added after the coding sequence of TrxA protein. His-Tag can be used for ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the codon-optimized Cas9 gene suitable for expression in Escherichia coli BL21 (DE3) strain, and add the nuclear localization signal coding sequence upstream and downstream of the gene to increase the nuclear localization ability of the Cas9 protein purified later.

[0357] The fusion gene in plasmid pKG-GE4 is shown at nucleotides 5209-9852 in SEQ ID NO: 1, encoding the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein). Due to the presence of the alkaline phosphatase signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3, which is named NCN protein.

[0358] Example 5. Preparation and purification of NCN protein

[0359] 1. Inducible Expression

[0360] 1. Introduce plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.

[0361] 2. The recombinant bacteria obtained in step 1 were inoculated into liquid LB medium containing 100 μg / ml ampicillin and cultured overnight at 37°C and 200 rpm with shaking.

[0362] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium and culture at 30°C and 230 rpm until the OD 600nm The value was set to 1.0, and then isopropylthiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The cells were shaken and cultured at 25°C and 230 rpm for 12 hours, and then centrifuged at 4°C and 10,000 g for 15 minutes to collect the cells.

[0363] 4. Take the bacteria obtained in step 3 and wash them with PBS buffer.

[0364] 2. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0365] 1. Take the cells obtained in step 1, add crude extraction buffer and suspend the cells, then use a homogenizer to break the cells (1000 par three times), then centrifuge at 4°C, 15000g for 30 minutes, collect the supernatant, filter the supernatant through a 0.22μm pore size filter, and collect the filtrate. In this step, 10ml of crude extraction buffer is added for every gram of wet weight of cells.

[0366] Crude extraction buffer: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance is ddH2O.

[0367] 2. Purify the fusion protein using affinity chromatography.

[0368] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate of 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate of 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0369] Ni-NTA agarose column: GenScript, L00250 / L00250-C, filler volume 10 ml.

[0370] Equilibration solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.

[0371] Buffer: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, and the balance is ddH2O.

[0372] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0373] 3. Enzymatic cleavage of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0374] 1. Take 15 ml of the post-column solution collected in step 2 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity). Then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0375] 2. Add commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotechnology, C620031, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (approximately 6 ml). Digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0376] 3. Take the solution from step 2 (about 6 ml) and mix it with 480 μl Ni-NTA resin (GenScript, L00250 / L00250-C). Rotate and mix at room temperature for 15 min, then centrifuge at 7000 g for 3 min and collect the supernatant (4-5.5 ml).

[0377] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.

[0378] Sequencing revealed that the N-terminal 15 amino acid residues of the protein in the NCN protein solution were as shown in positions 1 to 15 of SEQ ID NO: 3, namely, the NCN protein.

[0379] The NCN proteins used in the subsequent examples were all provided by NCN protein solutions.

[0380] Enzyme storage solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (volume ratio) glycerol, and the balance is ddH2O.

[0381] Example 6: Performance of NCN protein

[0382] Two gRNA targets targeting the TTN gene were selected as follows:

[0383] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0384] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0385] The primers used to identify the target fragment containing the gRNA in the TTN gene are as follows:

[0386] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0387] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0388] 1. Preparation of gRNA

[0389] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates

[0390] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0391] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0392] 2. Obtain gRNA by in vitro transcription

[0393] TTN-T7-gRNA1 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TMTTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0394] TTN-T7-gRNA2 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM TTN-gRNA2 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908) to obtain a single-stranded RNA, as shown in SEQ ID NO: 7.

[0395] 2. Optimization of the ratio of gRNA to NCN protein

[0396] 1. Co-transfection of primary porcine fibroblasts

[0397] Group 1: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.

[0398] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into primary porcine fibroblasts. Ratio: approximately 100,000 primary porcine fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.

[0399] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0400] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.

[0401] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into primary porcine fibroblasts. Ratio: approximately 100,000 primary porcine fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0402] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0403] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0404] 3. After completing step 2, trypsin was used to digest and collect the cells, and genomic DNA was extracted. PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.

[0405] Electrophoresis diagram Figure 12 The 505bp band is the wild-type band (WT), and the 254bp band (the wild-type band is 505bp and theoretically lacks 251bp) is the deletion mutation band (MT).

[0406] Gene deletion mutation efficiency = (MT grayscale / MT band bp number) / (WT grayscale / WT band bp number + MT grayscale / MT band bp number) × 100%. The gene deletion mutation efficiency was 19.9% ​​in the first group, 39.9% in the second group, 79.9% in the third group, and 44.3% in the fourth group. No mutation occurred in the fifth group.

[0407] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1μg:1μg:4μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1μg:1μg:4μg.

[0408] 3. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0409] 1. Co-transfection of primary porcine fibroblasts

[0410] Cas9-A Group: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2, and commercially available Cas9-A protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.

[0411] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0412] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.

[0413] Control group: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0414] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0415] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0416] 3. After completing step 2, trypsin was used to digest and collect the cells, and genomic DNA was extracted. PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.

[0417] Electrophoresis diagram Figure 13 The gene deletion mutation efficiency using the commercial Cas9-A protein was 28.5%, the gene deletion mutation efficiency using the NCN protein was 85.6%, and the gene deletion mutation efficiency using the commercial Cas9-B protein was 16.6%.

[0418] The results showed that compared with commercial Cas9 protein, the NCN protein prepared by the present invention significantly improved the gene editing efficiency.

[0419] Example 7: Preparation of single-cell clones of Congjiang Xiang pigs with combined knockout of GHR, IGF1, and IGF2 genes

[0420] The efficient gRNA combination of the GHR gene screened in Example 1 (GHR-E5-g2 and GHR-E5-g3), the efficient gRNA combination of the IGF1 gene screened in Example 2 (IGF1-E4-g1 and IGF1-E4-g2), and the efficient gRNA combination of the IGF2 gene screened in Example 3 (IGF2-E4-g2 and IGF2-E4-g7) were selected.

[0421] 1. Preparation of gRNA

[0422] 1. Prepare transcription template

[0423] The GHR-E5-T7-g2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 30.

[0424] The GHR-E5-T7-g3 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 31.

[0425] The IGF1-E4-T7-g1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 32.

[0426] The IGF1-E4-T7-g2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 33.

[0427] The IGF2-E4-T7-g2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 34.

[0428] The IGF2-E4-T7-g7 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 35.

[0429] 2. Obtain gRNA by in vitro transcription

[0430] The transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used to recover and purify the gRNA, which was a single-stranded RNA.

[0431] The gRNA obtained by transcription of GHR-E5-T7-g2 template is GHR-E5-gRNA2, as shown in SEQ ID NO: 36.

[0432] The gRNA obtained by transcribing the GHR-E5-T7-g3 template is GHR-E5-gRNA3, as shown in SEQ ID NO: 37.

[0433] The gRNA obtained by transcription of the IGF1-E4-T7-g1 template is IGF1-E4-gRNA1, as shown in SEQ ID NO: 38.

[0434] The gRNA obtained by transcription of the IGF1-E4-T7-g2 template is IGF1-E4-gRNA2, as shown in SEQ ID NO: 39.

[0435] The gRNA obtained by transcribing the IGF2-E4-T7-g2 template is IGF2-E4-gRNA2, as shown in SEQ ID NO: 40.

[0436] The gRNA obtained by transcribing the IGF2-E4-T7-g7 template is IGF2-E4-gRNA7, as shown in SEQ ID NO: 41.

[0437] GHR-E5-gRNA2 (SEQ ID NO: 36):

[0438] GGGACGGACCCCAUCUGUCCAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0439] GHR-E5-gRNA3 (SEQ ID NO: 37):

[0440] GGAAGUCUCUAGUUCAGGUGAAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0441] IGF1-E4-gRNA1 (SEQ ID NO: 38):

[0442] GGGAGCCUUGGGCAUGUCCGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0443] IGF1-E4-gRNA2 (SEQ ID NO: 39):

[0444] GGGCUUCCGGAGCUGUGAUCUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0445] IGF2-E4-gRNA2 (SEQ ID NO: 40):

[0446] GGGGCGCAGUAGGUCCAGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0447] IGF2-E4-gRNA7 (SEQ ID NO: 41):

[0448] GGCCACGAUGCCACGGCUGCGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0449] 2. Transfection of Primary Porcine Fibroblasts

[0450] 1. Co-transfect porcine primary fibroblasts with GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 0.5 μg GHR-E5-gRNA2: 0.5 μg GHR-E5-gRNA3: 0.5 μg IGF1-E4-gRNA1: 0.5 μg IGF1-E4-gRNA2: 0.5 μg IGF2-E4-gRNA2: 0.5 μg IGF2-E4-gRNA7: 6 μg NCN protein. Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).

[0451] 2. After completing step 1, culture the cells in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0452] 3. After completing step 2, use trypsin to digest and collect the cells, then wash with complete culture medium, resuspend in complete culture medium, and then pick each monoclonal clone and transfer it to a 96-well plate (1 cell per well, each well contains 100 μl complete culture medium) and culture for 2 weeks (replace new complete culture medium every 2-3 days).

[0453] 4. After completing step 3, trypsinize and collect the cells (about 2 / 3 of the cells obtained in each well are inoculated into a 6-well plate filled with complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0454] 5. Take the 6-well plate from step 4 and culture until the cells grow to 80% confluence, digest and collect the cells with trypsin, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, volume ratio).

[0455] 6. Take the centrifuge tube from step 4, remove the cells, lyse the cells, and extract genomic DNA. Perform PCR amplification using three primer pairs (GHR-E5-F132 and GHR-E5-R467, IGF1-E4-F114 and IGF1-E4-R575, and IGF2-E4-F136 and IGF2-E4-R728), followed by electrophoresis. Use primary porcine fibroblasts as a wild-type control (WT).

[0456] 7. After completing step 6, recover the PCR amplification product and sequence it.

[0457] There is only one sequencing result for primary porcine fibroblasts, and its genotype is wild type (also known as homozygous wild type). If a single-cell clone has two sequencing results, one of which is consistent with the sequencing result of primary porcine fibroblasts and the other has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is heterozygous; if a single-cell clone has two sequencing results, both of which have a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic different mutation type; if a single-cell clone has one sequencing result and has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic identical mutation type; if a single-cell clone has one sequencing result and is consistent with the sequencing result of primary porcine fibroblasts, the genotype of the single-cell clone is wild type (also known as homozygous wild type).

[0458] Homozygous knockout of the IGF1 gene significantly impacts mice and can easily lead to lethality in cloned mice. Homozygous knockout of the GHR gene does not lead to lethality in cloned mice, nor does homozygous knockout of the IGF2 gene. Therefore, the target single-cell clones should have the following three-gene combination: the IGF1 gene genotype is heterozygous, the GHR gene genotype is either biallelic identical mutations or biallelic different mutations, and the IGF2 gene genotype is either biallelic identical mutations or biallelic different mutations.

[0459] A total of 93 single cell clones were obtained. The results are shown in Table 1. Based on the genotypes identified by sequencing results, 10 single cell clones numbered 9, 35, 36, 54, 63, 65, 69, 75, 79, and 81 were selected as target single cell clones, accounting for 11%. For example, the comparison of the three-gene sequencing results of the single cell clone numbered 63 with those of the wild-type (WT) cells is shown in the figure below. Figures 14 to 16 As shown. The above-mentioned single-cell clones can be used for subsequent cloned pig production. Using the cells as nuclear transplant donor cells for somatic cell cloning can produce cloned pigs, namely miniature pigs.

[0460] Table 1 Genotyping results of single-cell clones co-edited with GHR, IGF1, and IGF2 genes

[0461]

[0462]

[0463]

[0464] The single cell clone numbered 9 had a biallelic identical mutation type for the GHR gene (the mutation was a 29 bp deletion, and the deletion region corresponded to positions 339 to 367 of sequence 9), a heterozygous type for the IGF1 gene (the mutation was a 16 bp and 12 bp deletion, and the deletion region corresponded to positions 380 to 395 and 460 to 471 of sequence 15), and a biallelic identical mutation type for the IGF2 gene (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0465] The single cell clone numbered 35 had a biallelic mutation type in the GHR gene (a 29 bp deletion on one chromosome, with the deletion region corresponding to positions 339 to 367 of sequence 9; an 18 bp deletion on the other chromosome, with the deletion region corresponding to positions 353 to 370 of sequence 9), a heterozygous IGF1 gene genotype (a 77 bp deletion, with the deletion region corresponding to positions 384 to 460 of sequence 15), and a biallelic identical mutation type in the IGF2 gene (a 53 bp deletion, with the deletion region corresponding to positions 338 to 390 of sequence 21).

[0466] The single cell clone numbered 36 had a biallelic identical mutation type for the GHR gene (the mutation was a 1 bp deletion, and the deletion region corresponded to position 368 of sequence 9), a heterozygous type for the IGF1 gene (the mutation was a 77 bp deletion, and the deletion region corresponded to positions 384 to 460 of sequence 15), and a biallelic identical mutation type for the IGF2 gene (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0467] The single cell clone numbered 54 had a biallelic different mutation type for the GHR gene (the mutation on one chromosome was a 29 bp deletion, and the deletion region corresponded to positions 339 to 367 of sequence 9; the mutation on the other chromosome was a 1 bp deletion, and the deletion region corresponded to position 368 of sequence 9), the genotype of the IGF1 gene was a heterozygous type (the mutation was a 77 bp deletion, and the deletion region corresponded to positions 384 to 460 of sequence 15), and the genotype of the IGF2 gene was a biallelic identical mutation type (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0468] The single cell clone numbered 63 had a biallelic identical mutation type for the GHR gene (the mutation was a 29 bp deletion, and the deletion region corresponded to positions 339 to 367 of sequence 9), a heterozygous type for the IGF1 gene (the mutation was a 77 bp deletion, and the deletion region corresponded to positions 384 to 460 of sequence 15), and a biallelic identical mutation type for the IGF2 gene (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0469] The single cell clone numbered 65 had a biallelic different mutation type in the GHR gene (the mutation on one chromosome was a 29 bp deletion, and the deletion region corresponded to positions 339 to 367 of sequence 9; the mutation on the other chromosome was an 18 bp deletion, and the deletion region corresponded to positions 353 to 370 of sequence 9), the genotype of the IGF1 gene was a heterozygous type (the mutation was a 77 bp deletion, and the deletion region corresponded to positions 384 to 460 of sequence 15), and the genotype of the IGF2 gene was a biallelic identical mutation type (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0470] The single cell clone numbered 69 had a biallelic mutation type in the GHR gene (a 29-bp deletion on one chromosome, the deletion region corresponding to positions 339 to 367 of sequence 9; an 18-bp deletion on the other chromosome, the deletion region corresponding to positions 353 to 370 of sequence 9). The IGF1 gene genotype was heterozygous (a 16-bp and a 12-bp deletion, the deletion regions corresponding to positions 380 to 395 and 460 to 471 of sequence 15). The IGF2 gene genotype was a biallelic mutation type (a 53-bp deletion on one chromosome, the deletion region corresponding to positions 338 to 390 of sequence 21; a 3-bp deletion and a 1-bp insertion on the other chromosome, the deletion region corresponding to positions 339 to 341 of sequence 21, and the insertion corresponding to nucleotides 392 to 393 of sequence 21).

[0471] The single cell clone numbered 75 had a biallelic identical mutation type for the GHR gene (the mutation was an 18 bp deletion, and the deletion region corresponded to positions 353 to 370 of sequence 9), a heterozygous type for the IGF1 gene (the mutation was a 7 bp and 3 bp deletion, and the deletion region corresponded to positions 380 to 386 and 459 to 461 of sequence 15), and a biallelic identical mutation type for the IGF2 gene (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0472] The single cell clone numbered 79 had a biallelic identical mutation type for the GHR gene (the mutation was an 18 bp deletion, and the deletion region corresponded to positions 353 to 370 of sequence 9), a heterozygous type for the IGF1 gene (the mutation was a 77 bp deletion, and the deletion region corresponded to positions 384 to 460 of sequence 15), and a biallelic identical mutation type for the IGF2 gene (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0473] The single cell clone numbered 81 had a biallelic identical mutation type for the GHR gene (the mutation was a 29 bp deletion, and the deletion region corresponded to positions 339 to 367 of sequence 9), a heterozygous type for the IGF1 gene (the mutation was a 77 bp deletion, and the deletion region corresponded to positions 384 to 460 of sequence 15), and a biallelic identical mutation type for the IGF2 gene (the mutation was a 53 bp deletion, and the deletion region corresponded to positions 338 to 390 of sequence 21).

[0474] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. Sequence Listing <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Gene editing system for constructing triple-gene combined mutations in miniature pig nuclear transfer donor cells and its application <130> GNCYX212503 <160> 41 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg tagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca fathercttt agttgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740. aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggccttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc catatatgg 2460 tgcactctca gtacaatctg ctctgatgcc ccatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagttctc cagaagcgtt aatgtctggc ttctgataaa gcggggccatg ttaagggcgg 2820 ttttttcctg ttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaacgagag aggatgctca cgatacggggt tactgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaacaac tggcggtag gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaca cggaaccga agaccattca tgttgttgct caggtcgcag 3180 acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cagtaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgctctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgaggggcgt gcaagattcc gataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaagcggt cctcgccgaa atgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggaga fatheractg ttgatgggtg tctggtcaga gacatcaaga fathercgccg gacattagt gcaggcagct tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560. gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccaccgggga aacggtctga 4680. taagagacac cggcatactc tgcgacatcg fathercgtta ctggtttcac attcaccacc ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800. atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtagttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980 gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040 aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 5160 ttcccctcta gaataattt tgtttaactt taagaaggag atatacatat gaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 3 <211> 1547 <212> PRT <213> Artificial Sequence <400> 3 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 225 230 235 240 Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290 295 300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Light Light Ala Gly Gln Ala Light Light Light Light 1540 1545 <210> 4 <211> 1399 <212> PRT <213> Artificial Sequence(Artificial Sequence) <400> 4 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485,490,495 Val Asp Lys Gly Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515,520,525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565,570,575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Asn Ala Lys Leu And Thr Gln Arg Lys Phe 900 905 910 Asp Asn With Thr Lys Ala Glu Arg Gly Gly Ser Glu With Asp Lys 915,920,925 Only Gly Phe With Lys Arg Gln Leu Val Glu Thr Arg Gln With Thr Lys 930,935,940 His Gln Ile Leu Asp Ser Arg With Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys With Arg Glu Val Val Lys With Thr Lys Ser Ser Lys 965,970,975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980,985,990 Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Asp Leu Ile Ile Leu Pro Lys Lys 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Leu Glu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Served Glu Phe Served Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro With Arg Glu Gln Ala Glu Asn With His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 The Asp Arg Lys Arg Tyr Serves Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375[[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 638 <212> PRT <213> Sus scrofa <400> 8 Met Asp Leu Trp Gln Leu Leu Leu Thr Leu Ala Val Ala Gly Ser Ser 1 5 10 15 Asp Ala Phe Ser Gly Ser Glu Ala Thr Pro Ala Val Leu Val Arg Ala 20 25 30 Ser Gln Ser Leu Gln Arg Val His Pro Gly Leu Glu Thr Asn Ser Ser 35 40 45 Gly Lys Pro Lys Phe Thr Lys Cys Arg Ser Pro Glu Leu Glu Thr Phe 50 55 60 Ser Cys His Trp Thr Asp Gly Val Arg His Gly Leu Gln Ser Pro Gly 65 70 75 80 Ser Ile Gln Leu Phe Tyr Ile Arg Arg Ser Thr Gln Glu Trp Thr Gln 85 90 95 Glu Trp Lys Glu Cys Pro Asp Tyr Val Ser Ala Gly Glu Asn Ser Cys 100 105 110 Tyr Phe Asn Ser Ser Tyr Thr Ser Ile Trp Ile Pro Tyr Cys Ile Lys 115 120 125 Leu Thr Ser Asn Gly Gly Thr Val Asp Gln Lys Cys Phe Ser Val Glu 130 135 140 Glu Ile Val Gln Pro Asp Pro Pro Ile Gly Leu Asn Trp Thr Leu Leu 145 150 155 160 Asn Ile Ser Leu Thr Gly Ile His Ala Asp Ile Gln Val Arg Trp Glu 165 170 175 Pro Pro Pro Asn Ala Asp Val Gln Lys Gly Trp Ile Val Leu Glu Tyr 180 185 190 Glu Leu Gln Tyr Lys Glu Val Asn Glu Thr Gln Trp Lys Met Met Asp 195 200 205 Pro Val Leu Ser Thr Ser Val Pro Val Tyr Ser Leu Arg Leu Asp Lys 210 215 220 Glu Tyr Glu Val Arg Val Arg Ser Arg Gln Arg Asn Ser Glu Lys Tyr 225 230 235 240 Gly Glu Phe Ser Glu Val Leu Tyr Val Thr Leu Pro Gln Met Ser Pro 245 250 255 Phe Ala Cys Glu Glu Asp Phe Arg Phe Pro Trp Phe Leu Ile Ile Ile 260 265 270 Phe Gly Ile Phe Gly Leu Thr Val Ile Leu Phe Leu Leu Ile Phe Ser 275 280 285 Lys Gln Gln Arg Ile Lys Met Leu Ile Leu Pro Pro Val Pro Val Pro 290 295 300 Lys Ile Lys Gly Ile Asp Pro Asp Leu Leu Lys Glu Gly Lys Leu Glu 305 310 315 320 Glu Val Asn Thr Ile Leu Ala Ile His Asp Asn Tyr Lys His Glu Phe 325 330 335 Tyr Ser Asp Asp Ser Trp Val Glu Phe Ile Glu Leu Asp Ile Asp Asp 340 345 350 Pro Asp Glu Lys Thr Glu Gly Ser Asp Thr Asp Arg Leu Leu Asn Asn 355 360 365 Asp His Glu Lys Ser Leu Thr Ile Leu Gly Ala Lys Asp Asp Asp Ser 370 375 380 Gly Arg Thr Ser Cys Tyr Glu Pro Asp Ile Leu Glu Thr Asp Phe Asn 385 390 395 400 Ala Asn Asp Val Cys Asp Gly Thr Ala Glu Val Ala Gln Pro Gln Arg 405 410 415 Leu Lys Gly Glu Ala Asp Leu Leu Cys Leu Asp Gln Lys Asn Gln Asn 420 425 430 Asn Ser Pro Ser Asn Asp Ala Ala Pro Ala Thr Gln Gln Pro Ser Val 435 440 445 Ile Leu Ala Glu Glu Asn Lys Pro Arg Pro Leu Ile Ile Ser Gly Thr 450 455 460 Asp Ser Thr His Gln Thr Ala His Thr Gln Leu Ser Asn Pro Ser Ser 465 470 475 480 Leu Ala Asn Ile Asp Phe Tyr Ala Gln Val Ser Asp Ile Thr Pro Ala 485 490 495 Gly Ser Val Val Leu Ser Pro Gly Gln Lys Asn Lys Ala Gly Ile Ser 500 505 510 Gln Cys Asp Met His Leu Glu Val Val Ser Pro Cys Pro Ala Asn Phe 515 520 525 Ile Met Asp Asn Ala Tyr Phe Cys Glu Ala Asp Ala Lys Lys Cys Ile 530 535 540 Ala Met Ala Pro His Val Glu Val Glu Ser Arg Val Ala Pro Ser Phe 545 550 555 560 Asn Gln Glu Asp Ile Tyr Ile Thr Thr Glu Ser Leu Thr Thr Thr Ala 565 570 575 Gly Arg Ser Gly Thr Ala Glu Cys Ala Pro Ser Ser Glu Met Pro Val 580 585 590 Pro Asp Tyr Thr Ser Ile His Ile Val Gln Ser Pro Gln Gly Leu Val 595 600 605 Leu Asn Ala Thr Ala Leu Pro Leu Pro Asp Lys Glu Phe Leu Ser Ser 610 615 620 Cys Gly Tyr Val Ser Thr Asp Gln Leu Asn Lys Ile Met Pro 625 630 635 <210> 9 <211> 730 <212> DNA <213> Sus scrofa <400> 9 tagctgttct cttatccat cccgctcacc ctccaaataa actgcctgta cccaatcct 60 catctctagt actggttct taaataagcc ctaagaaata atgttgggaa taaaaacaca 120 atggtttgtc cctggaatta agggccgaca gaggaatgat tgacagaac cgctctgaag 180 ctgtgaccca ggaaaacatt tctagaagtg gttgttctc accactttaa atatgtgttt 240 cattaggacc atcatcacc ctcctgatct catgccttgc cttcttttt tattcggcag 300 attctctgg aaagcctaaa ttcaccagt gccgttcacc tgaactagag actttcat 360 gccactggac agatggggtc cgtcacggtt tacagagccc tggatccata cagctgttct 420 atattagaag gtacagcctt catgccttc tgactttct ctccatgaat tttctgatta 480 aaatgtactg agtcatatgc atagtagga acggaatga tttatttga tgatctaaat 540 gtattcattc atttattca aaatattaa tgaagccctt attgtctgtt gcacactatt 600 ttgggcactg gagatacagg atgattaca aaagataag gtctctggtc tcctggagat 660 ttgttcccag ctggtgaga cagataaca aaaaatttt ttaatttaat gtcagctggt 720 aatatgggtt 730 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 cagggcucug uaaaccguga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 gacggacccc aucuguccag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 aagucucuag uucaggugaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 uggacagaug ggguccguca guuuuagagc uagaaauagc aauaaaau aaggcuaguc 60 cguaucaac ugaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 130 <212> PRT <213> His sow <400> 14 Met His Ile Thr Ser Ser Ser His Leu Phe Tyr Leu Ala Leu Cys Leu 1 5 10 15 Leu Ser Phe Thr Ser Ser Ala Thr Ala Gly Pro Glu Thr Leu Cys Gly 20 25 30 Ala Glu Leu Val Asp Ala Leu Gln Phe Val Cys Gly Asp Arg Gly Phe 35 40 45 Tyr Phe Asn Lys Pro Thr Gly Tyr Gly Ser Ser Ser Arg Arg Ala Pro 50 55 60 Gln Thr Gly Ile Val Asp Glu Cys Phe Arg Ser Cys Asp Leu Arg 65 70 75 80 Arg Leu Glu Met Tyr Cys Ala Pro Leu Lys Pro Ala Lys Ser Ala Arg 85 90 95 Ser Val Arg Ala Gln Arg His Thr Asp Met Pro Lys Ala Gln Lys Glu 100 105 110 Val His Leu Lys Asn Thr Ser Arg Gly Ser Ser Gly Asn Lys Asn Tyr 115 120 125 Arg Met 130 <210> 15 <211> 782 <212> DNA <213> On sow <400> 15 tgggcataga caagatcctt gactacaggt gattaagaac ctaaggagaa ttagcacaaa 60 taaatgcatg atgagtgagg tctgccaacg aatgtggcac tgactgcagg agaaacgtg 120 gaacccagaa ggacctacag ggtcaggaat tgttggagaa gcttcaagaa gaggttgact 180 tacaactgtg tgggttgaca agaggtggga agaggagagt ctgcaggggc caggtggaac 240 tgtgacgata gtgtattatt ccactctaaa gccaggcccc tctgcatttg atttgaacag 300 acaagcccac agggtacggc tccagcagc ggagggcgcc acagacgggc atcgtggatg 360 agtgctgctt ccggagctgt gatctgagga ggctggagat gtactgtgca cccctcaagc 420 ctgccaagtc ggcccgctcc gtccgtgccc agcgccacac ggacatgccc aaggctcaga 480 aggtaagcca gcctgggcgg ggtcagccat cctcaagaga cttatcagtg tgagtgtgcc 540 aaacagttat tgtacccctg gttctctccc tgagaggtcc aactcttcca tcactccaca 600 ttgcaaatcc tcccttccac tgctctggac ctctgatcac caaaagatgg tggagaagag 660 tgactaaacc tgggctttgg tatcagacaa aactgaaggt ttaccttcac ccatcaccag 720 ctgacagccc ttggccaaat aatgtatcct tccaagcctt agtttcatca gtaaagatgg 780 ga 782 <210> 16 <211> 100 <212> RNA <213> Artificial Sequence <400> 16 gagccuuggg cauguccgug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 17 <211> 100 <212> RNA <213> Artificial Sequence <400> 17 gcuuccggag cugugaucug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 18 <211> 100 <212> RNA <213> Artificial Sequence <400> 18 ggcgccacag acgggcaucg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 19 <211> 100 <212> RNA <213> Artificial Sequence <400> 19 cguccgugcc cagcgccaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 20 <211> 181 <212> PRT <213> Sus scrofa <400> 20 Met Gly Ile Pro Met Arg Lys Pro Leu Leu Val Leu Leu Val Phe Leu 1 5 10 15 Ala Leu Ala Ser Cys Cys Tyr Ala Ala Tyr Arg Pro Ser Glu Thr Leu 20 25 30 Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys Gly Asp Arg 35 40 45 Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Asn Arg Arg Ser Arg 50 55 60 Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu Ala Leu Leu 65 70 75 80 Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu Arg Asp Val Ser Thr 85 90 95 Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys 100 105 110 Phe Phe Arg Tyr Asp Thr Trp Lys Gln Ser Ala Gln Arg Leu Arg Arg 115 120 125 Gly Leu Pro Ala Leu Arg Ala Arg Arg Gly Arg Thr Leu Ala Lys 130 135 140 Glu Leu Glu Ala Val Arg Glu Ala Lys Arg His Arg Pro Leu Thr Ala 145 150 155 160 Arg Pro Thr Arg Asp Pro Ala Ala His Gly Gly Ala Ser Pro Glu Ala 165 170 175 Ser Gly His Arg Lys 180 <210> 21 <211> 758 <212> DNA <213> His sow <400> 21 ccaaacagcc ttgggtcgag gcccaagagg ctgggcccgg tttaggacg gggagggagg 60 cgccaagagg ccaggggctg gtcccgagca cgcccgcacc cgctcacccc cgctgtcccc 120 tctccttccc cggggggccc ctgtgcaccc cactctcact tcttctgctc gaggccacga 180 ggctggctgt ccccgcaagg tgaccgggcg tcctgtctgg agggcggggg ccggggcggc 240 tgggggcacc gtccgtgccc ggggcccctg tgctgacgtg ccctcccctt ggtcctgtgg 300 gacttccagg caggccggca agccgcgtga accgccgcag ccgtggcatc gtggaagagt 360 gctgcttccg tagctgcgac ctggccctgc tggagaccta ctgcgccacc cccgccaagt 420 ccgagaggga cgtgtcgacc cctccgaccg tgcttccggt aaggcagccc ctctctcggc 480 agcgcccccc ccccgggggg ggctgtctcc tctgagccgg gggaccgggg cgcagccggc 540 tcttgggctt caagtgctgc cagaggggcc ttccccgctg gggaccctgg ccagaagcca 600 gggcagtctt cgctctgtcg cagggcaggc aggcaggagg accccgcaga ggttgttgtt 660 ctgggacagg ggctgggggg ccaggccccc ccctgacggg cccttcccct ctcaggacaa 720 cttccccaga taccccgtgg gcaagttctt ccgctatg 758 <210> 22 <211> 100 <212> RNA <213> Artificial Sequence <400> 22 agcacucuuc cacgaugcca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 23 <211> 100 <212> RNA <213> Artificial Sequence <400> 23 ggcgcaguag gucuccagca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 24 <211> 100 <212> RNA <213> Artificial Sequence <400> 24 ccacccccgc caaguccgag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 25 <211> 100 <212> RNA <213> Artificial Sequence <400> 25 cuuccacgau gccacggcug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 26 <211> 100 <212> RNA <213> Artificial Sequence <400> 26 ccgccgcagc cguggcaucg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 27 <211> 100 <212> RNA <213> Artificial Sequence <400> 27 cacggcugcg gcgguucacg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 28 <211> 100 <212> RNA <213> Artificial Sequence <400> 28 ccacgaugcc acggcugcgg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 29 <211> 100 <212> RNA <213> Artificial Sequence <400> 29 aguaggucuc cagcagggcc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 30 <211> 225 <212> DNA <213> Artificial Sequence <400> 30 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggacgg accccatctg tccaggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 31 <211> 225 <212> DNA <213> Artificial Sequence <400> 31 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggaagtc tctagttcag gtgaagtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 32 <211> 225 <212> DNA <213> Artificial Sequence <400> 32 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggagcc ttgggcatgt ccgtggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 33 <211> 225 <212> DNA <213> Artificial Sequence <400> 33 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggcttc cggagctgtg atctggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 34 <211> 225 <212> DNA <213> Artificial Sequence <400> 34 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggggcgc agtaggtctc cagcagtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 35 <211> 225 <212> DNA <213> Artificial Sequence <400> 35 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggccacg atgccacggc tgcgggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 36 <211> 102 <212> RNA <213> Artificial Sequence <400> 36 gggacggacc ccaucugucc agguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 37 <211> 102 <212> RNA <213> Artificial Sequence <400> 37 ggaagucucu aguucaggug aaguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 38 <211> 102 <212> RNA <213> Artificial Sequence <400> 38 gggagccuug ggcauguccg ugguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 39 <211> 102 <212> RNA <213> Artificial Sequence <400> 39 gggcuuccgg agcugugauc ugguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 40 <211> 102 <212> RNA <213> Artificial Sequence <400> 40 ggggcgcagu aggucuccag caguuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 41 <211> 102 <212> RNA <213> Artificial Sequence <400> 41 ggccacgaug ccacggcugc ggguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims

1. A kit comprising GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7, and NCN protein; The GHR-E5-gRNA2 is an sgRNA, and its target sequence binding region is set forth as nucleotides 3-22 of SEQ ID NO: 36; the GHR-E5-gRNA3 is an sgRNA, and its target sequence binding region is set forth as nucleotides 3-22 of SEQ ID NO: 37; the IGF1-E4-gRNA1 is an sgRNA, and its target sequence binding region is set forth as nucleotides 3-22 of SEQ ID NO: 38; the IGF1-E4-gRNA2 is an sgRNA, and its target sequence binding region is set forth as nucleotides 3-22 of SEQ ID NO: 39; the IGF2-E4-gRNA2 is an sgRNA, and its target sequence binding region is set forth as nucleotides 3-22 of SEQ ID NO: 40; the IGF2-E4-gRNA7 is an sgRNA, and its target sequence binding region is set forth as nucleotides 3-22 of SEQ ID NO: 41; and the NCN protein is set forth in SEQ ID NO: 3; The preparation method of the NCN protein comprises the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography; (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein; The plasmid pKG-GE4 is shown in SEQ ID NO: 1; The uses of the kit are as follows (a) or (b) or (c) or (d) or (e) or (f) or (g): (a) preparing recombinant porcine fibroblasts; (b) preparing miniature pigs; (c) breeding pigs with reduced body size; (d) preparing a pig model with growth retardation; (e) preparing a cell model with growth retardation, a tissue model with growth retardation, or an organ model with growth retardation; (f) preparing a pig model with growth and development disorders; (g) preparing a cell model with growth and development disorders, a tissue model with growth and development disorders, or an organ model with growth and development disorders.

2. Use of GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7, and NCN protein in preparing a kit; GHR-E5-gRNA2 is the GHR-E5-gRNA2 described in claim 1; GHR-E5-gRNA3 is the GHR-E5-gRNA3 described in claim 1; IGF1-E4-gRNA1 is the IGF1-E4-gRNA1 described in claim 1; IGF1-E4-gRNA2 is the IGF1-E4-gRNA2 described in claim 1; IGF2-E4-gRNA2 is the IGF2-E4-gRNA2 described in claim 1; IGF2-E4-gRNA7 is the IGF2-E4-gRNA7 described in claim 1; NCN protein is the NCN protein described in claim 1; The uses of the kit are as follows (a) or (b) or (c) or (d) or (e) or (f) or (g): (a) preparing recombinant porcine fibroblasts; (b) preparing miniature pigs; (c) breeding pigs with reduced body size; (d) preparing a pig model with growth retardation; (e) preparing a cell model with growth retardation, a tissue model with growth retardation, or an organ model with growth retardation; (f) preparing a pig model with growth and development disorders; (g) preparing a cell model with growth and development disorders, a tissue model with growth and development disorders, or an organ model with growth and development disorders.

3. A method for preparing recombinant cells, comprising the following steps: co-transfecting porcine fibroblasts with GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7, and NCN protein to obtain recombinant cells; GHR-E5-gRNA2 is the GHR-E5-gRNA2 described in claim 1; GHR-E5-gRNA3 is the GHR-E5-gRNA described in claim 1 GHR-E5-gRNA3; IGF1-E4-gRNA1 is the IGF1-E4-gRNA1 described in claim 1; IGF1-E4-gRNA2 is the IGF1-E4-gRNA2 described in claim 1; IGF2-E4-gRNA2 is the IGF2-E4-gRNA2 described in claim 1; IGF2-E4-gRNA7 is the IGF2-E4-gRNA7 described in claim 1; NCN protein is the NCN protein described in claim 1.

4. The method according to claim 3, wherein: The ratios of porcine fibroblasts, GHR-E5-gRNA2, GHR-E5-gRNA3, IGF1-E4-gRNA1, IGF1-E4-gRNA2, IGF2-E4-gRNA2, IGF2-E4-gRNA7 and NCN protein are as follows: 100,000 porcine cells: 0.4-0.6μg GHR-E5-gRNA2: 0.4-0.6μg GHR-E5-gRNA3: 0.4-0.6μg IGF1-E4-gRNA1: 0.4-0.6μg IGF1-E4-gRNA2: 0.4-0.6μg IGF2-E4-gRNA2: 0.4-0.6μg IGF2-E4-gRNA7: 5-7μg NCN protein.

Citation Information

Patent Citations

  • CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects

    CN112522255A

  • sgRNA (Subgnomic Ribonucleic Acid) for specific recognition of porcine IGF2 (Lnsulin-like growth factors-2) gene intron and encoding DNA (Deoxyribose Nucleic Acid) and application of sgRNA for specific recognition of porcine IGF2 gene intron

    CN105925579A

  • Application of gRNA target combinations in construction of hemophilia model pig cell line

    CN112442515A