Composition, kit, use and method for detecting and typing rotavirus

Abstract

The present invention belongs to the field of molecular biological detection, and more specifically, relates to a composition, a kit, a use and a method for detecting and typing group A, group B and group C rotavirus. The present invention provides a composition capable of detecting and typing rotavirus; at the same time, a kit containing the composition, the use of the composition, and a method for detecting and typing rotavirus are also provided. Using the composition of the present invention, one tube can be used to simultaneously detect and type these three viruses in one test, with low cost, high throughput, less time consumption, a sensitivity of 100 copies / ml, and good specificity. At the same time, the amplification efficiency is consistent during detection, and the detection results are consistent. The sensitivity and specificity are further increased.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological detection, and more specifically, relates to a composition, a kit, a use and a method for detecting and typing group A, group B and group C rotavirus. Background Art

[0002] Rotavirus (RV) belongs to the family Reoviridae. Rotavirus is a double-stranded RNA virus. It is the main pathogen causing viral diarrhea in humans, mammals and poultry. It is prevalent in summer, autumn and winter every year. The route of infection is fecal-oral. The genes contained in the inner capsid of rotavirus are composed of 11 RNA fragments, which can encode 6 structural proteins, namely VP1-VP4, VP6 and VP7. These proteins constitute the capsid of rotavirus. According to the antigenicity of VP6, rotavirus can be divided into AH categories. Among them, group A rotavirus that harms infants and young children is the most common. The infection incidence rate is extremely high, and the range is very wide. It is highly contagious and has become one of the most frequent viruses in pediatric rotavirus infection. The virus is distributed worldwide, and basically all children born have been infected with rotavirus. In addition to group A rotavirus, group B and group C rotaviruses have also caused sporadic and outbreaks of diarrhea in children and adults worldwide.

[0003] Because rotavirus infection is universal, even improved sanitary conditions cannot effectively prevent the spread of rotavirus among susceptible populations. Moreover, there are many different viruses that cause diarrhea in infants. Some can heal themselves, but some can cause serious death. The symptoms they show are not very different, making it difficult to distinguish. Every year, about 900,000 infants and young children die from rotavirus infection worldwide, accounting for 85% of the global deaths from diarrhea. However, vaccines still have insurmountable defects in terms of immune efficacy and safety in specific regions and populations. Therefore, there are currently no effective RV prevention and control measures, and it is necessary to develop rapid and accurate early detection methods.

[0004] At present, the most common method for detecting RV nucleic acid is PCR, based on which multiple PCR gel running, multiple probe labeled PCR, melting curve method, chip hybridization method, etc. have emerged. However, due to the different nucleotide sequences of primers and probes designed for different groups of rotavirus, there must be differences in amplification efficiency, resulting in inconsistent test results for samples of the same concentration. At the same time, the sensitivity of existing rotavirus detection technology is not high and the specificity is poor.

[0005] Therefore, there is a need in the art for a rotavirus detection method with high sensitivity and good specificity. At the same time, this method also makes the virus amplification efficiency of each group consistent, and the detection results are consistent, further increasing the sensitivity and specificity. Summary of the invention

[0006] In view of this, in a first aspect, the present invention provides a composition capable of detecting and typing rotavirus, the composition also comprising:

[0007] A group A rotavirus upstream primer as shown in SEQ ID NO: 1, a group A rotavirus downstream primer as shown in SEQ ID NO: 2, and a group A rotavirus probe as shown in SEQ ID NO: 3;

[0008] A group B rotavirus upstream primer as shown in SEQ ID NO:4, a group B rotavirus downstream primer as shown in SEQ ID NO:5, and a group B rotavirus probe as shown in SEQ ID NO:6; and

[0009] A group C rotavirus upstream primer as shown in SEQ ID NO:7, a group C rotavirus downstream primer as shown in SEQ ID NO:8, and a group C rotavirus probe as shown in SEQ ID NO:9; and

[0010] The upstream adapter primer of rotavirus of groups A, B and C is shown as SEQ ID NO:10, and the downstream adapter primer of rotavirus of groups A, B and C is shown as SEQ ID NO:11.

[0011] In some specific embodiments, the upstream linker primer SEQ ID NO:10 of the present invention is respectively connected to the 5' end of SEQ ID NO:1, 4, and 7 to form an upstream primer of the composition of the present invention for detection; the downstream linker primer SEQ ID NO:11 of the present invention is respectively connected to the 5' end of SEQ ID NO:2, 5, and 8 to form a downstream primer of the composition of the present invention for detection.

[0012] For example, the upstream primer is:

[0013] TCTCGTTCCAGGATTCATC GATCACAACCAGCTCATGACAAC (Group A); TCTCGTTCCAGGATTCATC CAAATACTCAGCGAGTGTGGTG (Group B); TCTCGTTCCAGGATTCATC TCCGTTCTATGTGATTCTCATTCAG (Group C).

[0014] For another example, the downstream primer is:

[0015] GACATCGCAGTCCAGAAC AATTGCACACGAATAGTCGAATCC (Group A); GACATCGCAGTCCAGAAC TTGGAATCCGGTGTCGATCTAG (Group B); GACATCGCAGTCCAGAACGAAATCCCGGTTGAAAAACAGTTC (Group C).

[0016] The composition of the present invention can be used to simultaneously detect and type the three viruses in one test using one tube, with low cost, high throughput, less time consumption, a sensitivity of 100 copies / ml, and good specificity. At the same time, the amplification efficiency is consistent during detection, and the detection results are consistent, further increasing the sensitivity and specificity.

[0017] The composition of the present invention may also include one or more of the above primers and probes. For example, the composition of the present invention may only include primers and probes for detecting any two viruses, specifically, for example, SEQ ID NOs: 1 to 6, etc.; for example, the composition of the present invention may only include primers and probes for detecting any one virus, specifically, for example, SEQ ID NOs: 1 to 3, etc.

[0018] Furthermore, the composition comprises: an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for monitoring.

[0019] In a specific embodiment, the composition further comprises: an internal standard upstream primer as shown in SEQ ID NO:12, an internal standard downstream primer as shown in SEQ ID NO:13, and an internal standard probe as shown in SEQ ID NO:14.

[0020] In some specific embodiments, the group A rotavirus probe as shown in SEQ ID NO:3, the group B rotavirus probe as shown in SEQ ID NO:6, the group C rotavirus probe as shown in SEQ ID NO:9, and the internal standard probe as shown in SEQ ID NO:14 have signal substances.

[0021] The term "signal substance" refers to a substance that can give any signal for analysis in response to PCR detection. The signal substance includes but is not limited to a fluorescent group.

[0022] Furthermore, the fluorescent groups of the probes in the composition do not interfere with each other.

[0023] In the present invention, "no mutual interference" means that the fluorescent groups used in each probe in the composition are different and will not affect each other's detection, that is, different channels can be used for detection. For example, FAM, HEX, ROX and CY5 can be used. The absorbance values ​​of these fluorescent groups are not close, and different detection channels can be selected, so they will not interfere with each other.

[0024] In the present invention, the fluorescent group may be selected from FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3 and JOE, but is not limited thereto.

[0025] In the present invention, the 3' end of the probe is also connected to a quenching group, such as BHQ1 or BHQ2.

[0026] In a specific embodiment, the fluorescent group of the group A rotavirus probe as shown in SEQ ID NO:3 is FAM; the fluorescent group of the group B rotavirus probe as shown in SEQ ID NO:6 is HEX; and the fluorescent group of the group C rotavirus probe as shown in SEQ ID NO:9 is CY5.

[0027] In a specific embodiment, the fluorescent group of the internal standard probe as shown in SEQ ID NO: 12 is ROX.

[0028] Further, the amount of the primer in the composition is 15-100 nM; the amount of the probe in the composition is 5-75 nM. Preferably, the amount of the primer in the composition is 15-50 nM; the amount of the probe in the composition is 5-30 nM. More preferably, the amount of the primer in the composition is 30 nM; the amount of the probe in the composition is 15 nM.

[0029] In a particular embodiment, the components of the composition of the present invention are present in the same package.

[0030] In a specific embodiment, the composition of the present invention is present in a mixed form in the same package.

[0031] In a second aspect, the present invention provides use of the above-mentioned composition of the present invention in preparing a kit for detecting and typing rotavirus.

[0032] In a third aspect, the present invention provides a kit for detecting and typing rotavirus, wherein the kit comprises the composition of the present invention.

[0033] Furthermore, the kit also includes a nucleic acid release reagent, dNTP, reverse transcriptase, DNA polymerase, uracil DNA glycosylase, PCR buffer and Mg 2+ At least one of .

[0034] Furthermore, the amount of the primer in the composition is 15-100 nM; the amount of the probe in the composition is 5-75 nM; and the amount of the dNTP is 0.2-0.3 mM.

[0035] Furthermore, the concentration of the reverse transcriptase is 5U / μL to 15U / μL, for example, the reverse transcriptase can be mouse leukemia reverse transcriptase (MMLV); the concentration of the DNA polymerase is 5U / μL to 15U / μL, for example, the DNA polymerase can be Taq enzyme; uracil DNA glycosylase (UNG enzyme) 0.05U / μL to 0.8U / μL.

[0036] In a specific embodiment, the kit further comprises the following components and amounts in addition to the above-mentioned composition of the present invention:

[0037] Components Volume / concentration in each reaction <![CDATA[Mg 2+ ]]> 3mM dNTPs 0.2mM Reverse transcriptase 5U Taq enzyme (5U / μl) 10U UNG enzyme 0.6U Primers 30nM Probe 15nM PCR buffer (1.5x) 28μl DEPC water Make up to 40 μl

[0038] Furthermore, the kit also includes a positive control and a quantitative reference.

[0039] In a fourth aspect, a method for detecting and typing rotavirus is provided, the method comprising the following steps:

[0040] 1) Release nucleic acid from the sample to be tested;

[0041] 2) using the composition of the present invention or the kit of the present invention as described above to perform fluorescent quantitative PCR on the nucleic acid obtained in step 1);

[0042] 3) Obtain and analyze the results.

[0043] In the present invention, the sample used for detection can be feces, anal swab, blood, etc., but is not limited thereto.

[0044] Furthermore, the reaction conditions of the fluorescent quantitative PCR are:

[0045] UNG enzyme reaction, temperature is 50℃, time is 2-4 minutes, 1 cycle; reverse transcription, temperature is 50℃, time is 25-35 minutes, 1 cycle; pre-denaturation, temperature is 95℃, time is 1-10 minutes, 1 cycle; denaturation, temperature is 95℃, time is 10-20 seconds, annealing, extension and fluorescence collection, temperature is 58℃, time is 30-50 seconds, 10-20 cycles; denaturation, temperature is 95℃, time is 10-20 seconds, annealing, extension and fluorescence collection, temperature is 55℃, time is 20-40 seconds, 20-40 cycles.

[0046] In a specific embodiment, a method for detecting and typing rotavirus for non-diagnostic purposes is provided, the method comprising the following steps:

[0047] 1) Release nucleic acid from the sample to be tested;

[0048] 2) using the composition of the present invention or the kit of the present invention as described above to perform fluorescent quantitative PCR on the nucleic acid obtained in step 1);

[0049] 3) Obtain and analyze the results.

[0050] In this context, the term "non-diagnostic purpose" means that the method is not intended to obtain information on whether an individual is infected with rotavirus and suffers from a related disease. For example, the method can detect whether rotavirus exists in a simple cell culture. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 The test results of the rotavirus gradient sample of group A of the composition of the present invention;

[0052] Figure 2 The test results of the group B rotavirus gradient sample of the composition of the present invention;

[0053] Figure 3 The test results of the rotavirus gradient sample of group C of the composition of the present invention;

[0054] Figure 4 is the sensitivity test result of the composition of the present invention;

[0055] Figure 5 is the test result of the composition of the present invention (with a linker primer);

[0056] Figure 6 is the test result of the composition of the present invention (without the adapter primer);

[0057] Figure 7 The concentration gradient sample test results of the composition of the present invention (without the adapter primer);

[0058] Figure 8 The concentration gradient sample test results of the composition of the present invention (with adapter primers);

[0059] Figures 9-11 The results of the comparative amplification primers and probes of the present invention are shown below;

[0060] Figures 12-13 This is the detection result of the comparative adapter primer of the present invention;

[0061] Fig.14 It is the detection result of combining the prior art adapter primer with the amplification primer and probe of the present invention. DETAILED DESCRIPTION

[0062] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0063] Example 1. Primers and probes used in the composition of the present invention

[0064] The primer and probe sequences used in the composition of the present invention are shown in Table 1 below:

[0065] Table 1

[0066]

[0067] Among them, the fluorescent group of the group A rotavirus probe shown in SEQ ID NO:3 is FAM; the fluorescent group of the group B rotavirus probe shown in SEQ ID NO:6 is HEX; the fluorescent group of the group C rotavirus probe shown in SEQ ID NO:9 is CY5; the fluorescent group of the internal standard probe shown in SEQ ID NO:14 is ROX, and the 3' end of the probe also has a BHQ1 or BHQ2 quenching group.

[0068] Example 2: Method for detecting and typing rotavirus

[0069] The test samples of the present invention are feces and anal swabs. The nucleic acid is extracted according to the instructions of a commercial nucleic acid extraction kit or according to a self-established extraction method. The PCR reaction system is prepared in the manner shown in Table 2.

[0070] Table 2

[0071] Component name Single serving quantity / concentration RVA-F 0.3μM RVA-R 0.3μM RVA-P 0.15μM RVB-F 0.3μM RVB-R 0.3μM RVB-P 0.15μM RVC-F 0.3μM RVC-R 0.3μM RVC-P 0.15μM ALDO-F 0.3μM ALDO-R 0.3μM ALDO-P 0.15μM UNG enzyme 0.6Unit Reverse transcriptase 5Unit DNA polymerase 10Unit Mg2+ 3mM dNTPs(U) 0.2mM PCR buffer 28μL DEPC water Make up the volume to 40 μL Sample nucleic acid 10μL Total 50μL

[0072] And perform PCR amplification according to the program shown in Table 3:

[0073] Table 3

[0074]

[0075] Result analysis:

[0076] After the reaction is completed, adjust the Start value, End value and Threshold value of the Baseline (users can adjust according to actual conditions, the Start value can be set between 3 and 15, the End value can be set between 5 and 20, and the amplification curve of the negative control can be adjusted to make it flat or below the threshold line), and click the Analyze button of the PCR software for analysis.

[0077] The results are shown in Table 4:

[0078] Table 4

[0079]

[0080] Example 3: Sensitivity of the composition of the present invention in detecting rotavirus

[0081] The samples of rotavirus of groups A, B and C were diluted in a gradient, and the concentration gradient was 2.0E+02 copies / mL to 2.0E+07 copies / mL. The composition described in Example 1 was used to test it according to the method described in Example 2. The test results are as follows: Figures 1 to 3 shown.

[0082] The detection limit sample (100 copies / ml) was selected, and the composition described in Example 1 of the present invention was used to perform the test on the same bench according to the method of Example 2 of the present invention, and the test was repeated 20 times to verify the minimum detection limit of the kit. The results are shown in Table 5 and Figure 4 shown.

[0083] Table 5

[0084]

[0085] From the above table 5, Figure 4 It can be seen that samples with a rotavirus group A / group B / group C concentration of 100 copies / ml were tested 20 times each by the patented kit, and the positive detection rate was 100%. Therefore, the detection limit of the patented kit can reach 100 copies / mL.

[0086] Example 4: Analytical specificity of the composition of the present invention for detecting rotavirus

[0087] The composition described in Example 1 of the present invention was used, and the method of Example 2 of the present invention was used to detect on the same instrument. By analyzing the positive and negative conformity of the detection, the following pathogens were cross-reacted and verified: norovirus, herpes simplex virus type 1 / 2, enteric adenovirus, varicella-zoster virus, rotavirus, hepatitis A virus, astrovirus, Epstein-Barr virus, rubella virus, measles virus, influenza A virus, parainfluenza virus, influenza B virus, cytomegalovirus, respiratory syncytial virus, mumps virus, hepatitis E virus, group B Streptococcus, Klebsiella pneumoniae, Escherichia coli, Neisseria meningitidis, Streptococcus pneumoniae, Staphylococcus aureus, Salmonella, Shigella, Vibrio, Haemophilus influenzae, Moraxella catarrhalis, viridans streptococcus, Neisseria, mucoid Roseburia, Proteus, etc., and the specificity of the composition was analyzed. The results are shown in Table 6 below.

[0088] Table 6

[0089]

[0090]

[0091] Example 5: Amplification efficiency of the composition of the present invention

[0092] The composition for detecting rotavirus according to Example 1 of the present invention was used to detect rotavirus of groups A, B and C according to the method described in Example 2. The detection results are as follows: Figure 5 Only the primers and probes described in Example 1 of the present invention (without the linker primer) were used to detect rotaviruses of groups A, B and C. The detection results are shown in Figure 6 As shown in the figure, it can be seen that the CT values ​​of the tests without the adapter primers are quite different, and the amplification efficiencies are quite different. However, the CT values ​​of the tests with the adapter primers are basically the same, and the amplification efficiencies are similar.

[0093] Example 6, adapter primer and sensitivity

[0094] The rotavirus A, B, and C primer probe combinations of the present invention were used to conduct comparative tests before and after the connection of the adapter primers (the present invention composition), and mixed samples of 10,000, 1,000, and 100 copies / mL were detected, respectively, and each sample was repeated 10 times to detect the sensitivity of the two (the amplification results were as follows: Figure 7 and 8 The results are shown in Table 7.

[0095] Table 7

[0096]

[0097] As can be seen from Table 7, the primer-probe combination without the use of adapter primers cannot achieve 100% detection at a concentration of 1000 copies / mL, while the primer-probe combination using the adapter primers (i.e., the composition of the present invention) can still achieve 100% detection at a concentration of 100 copies / mL, demonstrating that the adapter primers designed by the present invention can significantly increase the sensitivity of the composition detection.

[0098] Example 7: Comparative Example of the Composition of the Present Invention Detection of Rotavirus

[0099] During the primer and probe design process, the inventors also designed the remaining primers and probes (the primers numbered 2 in Table 8 constitute a combination, the primers numbered 3 constitute a combination, and the primers numbered 4 constitute another combination) and were also used to detect the virus (mixed samples of Group A, Group B, and Group C, with a concentration of 1000 copies / mL) according to the method shown in Example 2. The results are as follows: Figures 9-11 The specific sequence is shown in Table 8. As can be seen from the figure, the primers and probes of the comparative example cannot detect each virus well.

[0100] Table 8

[0101]

[0102]

[0103] In the process of linker design, the inventors also designed the remaining linker primers 1 and 2 and used the linker primer 3 for rotavirus reported in the prior art (Chinese patent application number CN201911112786.5) (as shown in Table 9), and combined them with the primer probe of the present invention to perform detection according to the method described in Example 2. The experimental results are as follows Figures 12-14 As shown in the figure, it can be seen that the adapter primers in all comparative examples cannot effectively improve the amplification efficiency of the primers and probes of the present invention.

[0104] Table 9

[0105] Sequence Listing <110> Shengxiang Biotechnology Co., Ltd. <120> Composition, kit, use and method for detecting and typing rotavirus <160> 47 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 gatcacaacc agctcatgac aac 23 <210> 2 <211> twenty three <212> DNA <213> Artificial sequence <400> 2 aattgcacac gaatagtcga atcc 23 <210> 3 <211> 26 <212> DNA <213> Artificial sequence <400> 3 tgatcctgcg ttcagccaca tggtac 26 <210> 4 <211> twenty two <212> DNA <213> Artificial sequence <400> 4 caaatactca gcgagtgtgg tg 22 <210> 5 <211> twenty two <212> DNA <213> Artificial sequence <400> 5 ttggaatccg gtgtcgatct ag 22 <210> 6 <211> 25 <212> DNA <213> Artificial sequence <400> 6 aatgcttatc gcctcgttcg ctgct 25 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <400> 7 tccgttctat gtgattctca ttcag 25 <210> 8 <211> twenty four <212> DNA <213> Artificial sequence <400> 8 gaaatcccgg ttgaaaaaca gttc 24 <210> 9 <211> 30 <212> DNA <213> Artificial sequence <400> 9 atcgctgaat ctcttctgac gtttgctact 30 <210> 10 <211> 19 <212> DNA <213> Artificial sequence <400> 10 tctcgttcca ggattcatc 19 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <400> 11 gacatcgcag tccagaac 18 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 tgtagggctg aggtgagaac 20 <210> 13 <211> twenty one <212> DNA <213> Artificial sequence <400> 13 ctgggattac aagcgtgaac c 21 <210> 14 <211> 28 <212> DNA <213> Artificial sequence <400> 14 tcaggattcc atcagacaat aagaccgc 28 <210> 15 <211> 44 <212> DNA <213> Artificial sequence <400> 15 tctcgttcca ggattcatca caaccagctc atgacaactt aatg 44 <210> 16 <211> 41 <212> DNA <213> Artificial sequence <400> 16 gacatcgcag tccagaactg cacacgaata gtcgaatcca g 41 <210> 17 <211> 27 <212> DNA <213> Artificial sequence <400> 17 agcgacctga atttctgatc ctgcgtt 27 <210> 18 <211> 44 <212> DNA <213> Artificial sequence <400> 18 tctcgttcca ggattcatct tgaatagatc acaaccagct catg 44 <210> 19 <211> 42 <212> DNA <213> Artificial sequence <400> 19 gacatcgcag tccagaaccg cattaattgc acacgaatag tc 42 <210> 20 <211> 30 <212> DNA <213> Artificial sequence <400> 20 aagaatatgc aataccagtt ggaccagtct 30 <210> twenty one <211> 44 <212> DNA <213> Artificial sequence <400> twenty one tctcgttcca ggattcatca cattgaatag atcacaacca gctc 44 <210> twenty two <211> 41 <212> DNA <213> Artificial sequence <400> twenty two gacatcgcag tccagaacgc gcattaattg cacacgaata g 41 <210> twenty three <211> 30 <212> DNA <213> Artificial sequence <400> twenty three cgaatccagcgacctgaatttctgatcctg 30 <210> twenty four <211> 41 <212> DNA <213> Artificial sequence <400> twenty four tctcgttcca ggattcatca atactcagcg agtgtggtgt c 41 <210> 25 <211> 40 <212> DNA <213> Artificial sequence <400> 25 gacatcgcag tccagaacta cgaatcccgt gtcgatccgg 40 <210> 26 <211> 25 <212> DNA <213> Artificial sequence <400> 26 tgctttatcgc ctcgttcgct gctaa 25 <210> 27 <211> 44 <212> DNA <213> Artificial sequence <400> 27 tctcgttcca ggattcatcg ctccaaatac gaatctcaat acag 44 <210> 28 <211> 43 <212> DNA <213> Artificial sequence <400> 28 gacatcgcag tccagaacta attggcgcat ttatggtata agg 43 <210> 29 <211> 25 <212> DNA <213> Artificial sequence <400> 29 atgattacaa cgcactggct tctcg 25 <210> 30 <211> 44 <212> DNA <213> Artificial sequence <400> 30 tctcgttcca ggattcatct tacactcctt ataccataaa tgcg 44 <210> 31 <211> 43 <212> DNA <213> Artificial sequence <400> 31 gacatcgcag tccagaacca tttggttcta aaacacgtct ttc 43 <210> 32 <211> 25 <212> DNA <213> Artificial sequence <400> 32 tggctgtacg aatctctaccgatga 25 <210> 33 <211> 43 <212> DNA <213> Artificial sequence <400> 33 tctcgttcca ggattcatcg aactgttttt caaccgggat ttc 43 <210> 34 <211> 43 <212> DNA <213> Artificial sequence <400> 34 gacatcgcag tccagaacca ttctcttcac agatgcgatt aac 43 <210> 35 <211> 30 <212> DNA <213> Artificial sequence <400> 35 acactatcca attacactgt cgctcaagaa 30 <210> 36 <211> 42 <212> DNA <213> Artificial sequence <400> 36 tctcgttcca ggattcatca tccaattaca ctgtcgctca ag 42 <210> 37 <211> 42 <212> DNA <213> Artificial sequence <400> 37 gacatcgcag tccagaacgt aggccgcata gaagatgttt ag 42 <210> 38 <211> 30 <212> DNA <213> Artificial sequence <400> 38 tctacattac cattctcttc acagatgcga 30 <210> 39 <211> 44 <212> DNA <213> Artificial sequence <400> 39 tctcgttcca ggattcatct ccgttctatg tgattctcat tcag 44 <210> 40 <211> 42 <212> DNA <213> Artificial sequence <400> 40 gacatcgcag tccagaacga aatcccggtt gaaaaacagt tc 42 <210> 41 <211> 30 <212> DNA <213> Artificial sequence <400> 41 atcgctgaat ctcttctgac gtttgctact 30 <210> 42 <211> 20 <212> DNA <213> Artificial sequence <400> 42 cagcctatct attcgtaacc 20 <210> 43 <211> 19 <212> DNA <213> Artificial sequence <400> 43 ccggctgtgt ccactcaac 19 <210> 44 <211> 20 <212> DNA <213> Artificial sequence <400> 44 aatagtggca acaccactcg 20 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <400> 45 acccaccagc aattctactt 20 <210> 46 <211> 19 <212> DNA <213> Artificial sequence <400> 46 gatccaatcg cgtacttgc 19 <210> 47 <211> 19 <212> DNA <213> Artificial sequence <400> 47 tgccatgcat aaccgcagt 19

Claims

1. A composition capable of detecting and typing rotavirus, the composition comprising: A group A rotavirus upstream primer, a group A rotavirus downstream primer, and a group A rotavirus probe as shown in SEQ ID NO: 3; A group B rotavirus upstream primer, a group B rotavirus downstream primer, and a group B rotavirus probe as shown in SEQ ID NO:6; and A group C rotavirus upstream primer, a group C rotavirus downstream primer, and a group C rotavirus probe as shown in SEQ ID NO:9; and The upstream linker primer SEQ ID NO: 10 is connected to the 5' end of SEQ ID NO: 1, 4, and 7, respectively, to form the upstream primers of rotavirus of group A, group B, and group C; the downstream linker primer SEQ ID NO: 11 is connected to the 5' end of SEQ ID NO: 2, 5, and 8, respectively, to form the downstream primers of rotavirus of group A, group B, and group C.

2. The composition according to claim 1, wherein The composition further comprises: an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for monitoring.

3. The composition according to claim 1, wherein The composition further comprises: an internal standard upstream primer as shown in SEQ ID NO:12, an internal standard downstream primer as shown in SEQ ID NO:13, and an internal standard probe as shown in SEQ ID NO:

14.

4. The composition according to claim 1, wherein The group A rotavirus probe shown in SEQ ID NO: 3, the group B rotavirus probe shown in SEQ ID NO: 6, the group C rotavirus probe shown in SEQ ID NO: 9, and the internal standard probe shown in SEQ ID NO: 14 have signal substances.

5. The composition according to claim 1, wherein The amount of the primer in the composition is 15-100 nM; the amount of the probe in the composition is 5-75 nM.

6. Use of the composition according to any one of claims 1 to 5 in preparing a kit for detecting and typing rotavirus.

7. A kit for detecting and typing rotavirus, comprising the composition according to any one of claims 1 to 5.

8. The kit according to claim 7, wherein The kit further includes a nucleic acid release reagent, dNTP, reverse transcriptase, DNA polymerase, uracil DNA glycosylase, PCR buffer and Mg 2+ At least one of .

9. The kit according to claim 7 or 8, wherein The kit also includes a positive control and a quantitative reference.

10. A method for detecting and typing rotavirus for non-diagnostic purposes, the method comprising the following steps: 1) Release nucleic acid from the sample to be tested; 2) performing fluorescent quantitative PCR on the nucleic acid obtained in step 1) using the composition according to any one of claims 1 to 5; 3) Obtain and analyze the results.

Images