New combinations of tis sequences and signal peptide sequences for expression of recombinant proteins

Abstract

The present invention relates to DNA constructs comprising a novel TIS sequence. The TIS sequence is transcribed into an RNA motif that functions as a protein translation initiation site in an mRNA transcript. The DNA construct can further comprise a nucleic acid sequence encoding a signal peptide. Additionally, the DNA construct can further comprise a nucleic acid sequence encoding a recombinant protein or one or more polypeptide chains thereof. The present invention also relates to expression vectors, expression cassettes, and host cells comprising the DNA construct. Furthermore, the present invention relates to a recombinant protein expressed by the host cell and a method of expressing the recombinant protein.

Description

TECHNICAL FIELD

[0001] The present invention relates to DNA constructs comprising a novel TIS sequence. The DNA construct can further comprise a nucleic acid sequence encoding a signal peptide. In addition, the DNA construct can further comprise a nucleic acid sequence encoding a recombinant protein or one or more polypeptide chains thereof. The present invention further relates to expression vectors, expression cassettes and host cells comprising the DNA construct. Furthermore, the present invention relates to a recombinant protein expressed by the host cell and a method of expressing the recombinant protein. BACKGROUND

[0002] The main determinants of steady-state protein concentration levels in recombinant cell lines include: (1) genomic integration site of the expression cassette, (2) promoter strength, (3) translational efficiency of the transcript and (4) protein folding and post-translational modifications that affect degradation rates. To generate recombinant Chinese hamster ovary (CHO) cell lines, random integration sites are typically screened for promoting high expression levels. Expression vectors themselves also comprise regulatory elements such as promoter sequences that generate high transcription and translation initiation sites (TIS) that enable correct translation initiation [1]. Disappointingly, even if all regulatory elements that should promote high expression levels are chosen, protein production can vary depending on the environment. Therefore, there is an urgent need for solutions that guide rational design when generating recombinant cell lines.

[0003] Since protein synthesis consumes a large portion of the cellular energy budget [2], evolution tightly regulates the different phases of protein production. The eukaryotic translation initiation phase requires twelve initiation factors and is considered the rate-limiting step in protein synthesis [3]. This initiation phase is likely to be tightly regulated during evolution to minimize energy consumption. The main elements that regulate translation initiation efficiency are embedded in the mRNA nucleotide sequence surrounding the ATG start codon. This nucleotide bias in the TIS was discovered in the 1980s and is commonly referred to as the Kozak sequence [4]. Since then, ribosome structure studies have elucidated how the TIS sequence interacts with the ribosome, leading to a conformational change that enables translation initiation [5]. Due to the biological impact of the TIS sequence, TIS sequences with different strengths naturally evolved as indicators of true initiation sites and fine-tuning expression levels [6].

[0004] Generally, when designing expression vectors for recombinant production, strong naturally occurring TIS sequences are selected. Among other TIS variants, the mammalian consensus sequence GCCACC preceding the ATG start codon [7] is routinely introduced in ad hoc construct design. This sequence is ubiquitous for naturally occurring highly expressed genes, possibly enhancing organismal robustness by fine-tuning the translation initiation rate of abundant transcripts. In contrast to natural evolution, fed-batch recombinant expression conditions alter the proteome and impose metabolic burden on the cell, which does not at all mimic the natural context [8]. Therefore, recent studies focused on experimental screening through TIS libraries to identify common sequence features that would lead to optimal translation rates in recombinant experiments [9, 10].

[0005] However, the prior art does not propose a unique universal sequence that can be reliably used. Therefore, there is a need for a TIS sequence that can provide better technical effects than the GCCACC ATG sequence.

[0006] Furthermore, mammalian cells are commonly used as hosts for the production of recombinant biopharmaceuticals. Cell lines derived from Chinese hamster ovary (CHO) cells can typically achieve g / L-levels of production. However, despite the progress made in this field, expression levels can vary in an unpredictable and environment-dependent manner, limiting the rational design to achieve desired expression levels during cell line development. To address this issue, the translation initiation site (TIS) is changed in the present invention with the aim of ultimately affecting antibody titers and productivity.

[0007] Objectives of the invention

[0008] It is an object of the present invention to increase the translation initiation rate.

[0009] It is another object of the present invention to increase the translation initiation rate without affecting the protein quality.

[0010] It is another object of the present invention to increase the translation initiation rate while maintaining the biological similarity of the protein.

[0011] It is another object of the present invention to increase the translation initiation rate while maintaining the post-translational modifications.

[0012] It is another object of the present invention to increase the translation initiation rate while maintaining the glycan-based post-translational modifications.

[0013] It is another object of the present invention to increase the translation initiation rate while maintaining the acidic and basic profile of the substance.

[0014] It is another object of the present invention to increase the expression of the recombinant protein.

[0015] It is another object of the present invention to increase the titer of the recombinant protein.

[0016] Another object of the application is to improve the titer of the antibody or fragment thereof.

[0017] Another object of the application is to improve the titer of the monoclonal antibody. SUMMARY

[0018] The objects of the application are achieved by the subject-matter disclosed in the claims and by the subject-matter disclosed in the following aspects of the application.

[0019] A first aspect of the application relates to a DNA construct suitable for expressing a recombinant protein in a mammalian cell, wherein said DNA construct comprises a nucleic acid sequence of SEQ ID No 1, wherein the nucleic acid sequence of SEQ ID No 1 is a TIS sequence.

[0020] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0021] - 6 nucleotides upstream of the ATG start codon; and / or

[0022] - 2 nucleotides downstream of the ATG start codon.

[0023] In a preferred embodiment, the DNA construct further comprises a nucleic acid sequence encoding a signal peptide.

[0024] In a preferred embodiment, the DNA construct further comprises a nucleic acid sequence encoding a recombinant protein or one or more polypeptide chains thereof.

[0025] A second aspect of the application relates to a DNA construct for expressing a recombinant protein in a mammalian cell, wherein said DNA construct comprises:

[0026] - a nucleic acid sequence of SEQ ID No 1, wherein the nucleic acid sequence of SEQ ID No 1 is a TIS sequence; and

[0027] - a nucleic acid sequence encoding a signal peptide.

[0028] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0029] - 6 nucleotides upstream of the ATG start codon; and / or

[0030] - 2 nucleotides downstream of the ATG start codon.

[0031] In a preferred embodiment, the nucleic acid sequence encoding a signal peptide comprises a nucleic acid sequence of SEQ ID No 2.

[0032] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0033] - the ATG start codon in the nucleic acid sequence encoding the first amino acid residue of the signal peptide; and

[0034] - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence encoding the second amino acid residue of the signal peptide.

[0035] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0036] - the ATG start codon in SEQ ID No 2; and

[0037] - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence of SEQ ID No 2.

[0038] A third aspect of the present application relates to a DNA construct for expressing a recombinant protein in a mammalian cell, wherein the DNA construct comprises:

[0039] - the nucleic acid sequence of SEQ ID No 1, wherein the nucleic acid sequence of SEQ ID No 1 is a TIS sequence;

[0040] - a nucleic acid sequence encoding a signal peptide; and

[0041] - a nucleic acid sequence encoding a recombinant protein, preferably a monoclonal antibody, more preferably an IgG4 monoclonal antibody.

[0042] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0043] - 6 nucleotides upstream of the ATG start codon; and / or

[0044] - 2 nucleotides downstream of the ATG start codon.

[0045] In a preferred embodiment, the nucleic acid sequence encoding the signal peptide comprises the nucleic acid sequence of SEQ ID No 2.

[0046] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0047] - the ATG start codon in the nucleic acid sequence encoding the first amino acid residue of the signal peptide; and

[0048] - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence encoding the second amino acid residue of the signal peptide.

[0049] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0050] - the ATG start codon in SEQ ID No 2; and

[0051] - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence of SEQ ID No 2.

[0052] In a preferred embodiment, the nucleic acid sequence encoding the signal peptide is operably linked to the nucleic acid sequence encoding the recombinant protein.

[0053] A fourth aspect of the application relates to a DNA construct for expressing a recombinant protein in a mammalian cell, wherein the DNA construct comprises:

[0054] - a first and a second nucleic acid sequence each comprising the nucleic acid sequence of SEQ ID No 1, wherein the nucleic acid sequence of SEQ ID No 1 is a TIS sequence;

[0055] - a first nucleic acid sequence encoding a signal peptide;

[0056] - a second nucleic acid sequence encoding a signal peptide;

[0057] - a first nucleic acid sequence encoding an antibody heavy chain; and

[0058] - a second nucleic acid sequence encoding an antibody light chain.

[0059] In a preferred embodiment, the nucleic acid sequence of SEQ ID No 1 comprises:

[0060] - 6 nucleotides upstream of the ATG start codon; and / or

[0061] - 2 nucleotides downstream of the ATG start codon.

[0062] In a preferred embodiment, the nucleic acid sequence encoding the signal peptide comprises the nucleic acid sequence of SEQ ID No 2.

[0063] In a preferred embodiment, the first and the second nucleic acid sequence encoding the signal peptide each comprise the nucleic acid sequence of SEQ ID No 2.

[0064] In a preferred embodiment, the first and the second nucleic acid sequence each comprising the nucleic acid sequence of SEQ ID No 1 comprises:

[0065] - the ATG start codon in the first and the second nucleic acid sequence encoding the first amino acid residue of the signal peptide; and

[0066] - the first and second nucleotides downstream of the ATG start codon in SEQ ID No 2 of the first and second nucleic acid sequences encoding the signal peptide.

[0067] In a preferred embodiment, the first and second nucleic acid sequences comprising the nucleic acid sequence of SEQ ID No 1 comprise:

[0068] - the ATG start codon in SEQ ID No 2 of the first and second nucleic acid sequences encoding the signal peptide, and

[0069] - the first and second nucleotides downstream of the ATG start codon in SEQ ID No 2 of the first and second nucleic acid sequences encoding the signal peptide.

[0070] In a preferred embodiment, the first nucleic acid sequence encoding the signal peptide is operably linked to the first nucleic acid sequence encoding the heavy chain of the antibody.

[0071] In a preferred embodiment, the second nucleic acid sequence encoding the signal peptide is operably linked to the second nucleic acid sequence encoding the light chain of the antibody.

[0072] In a preferred embodiment, the first nucleic acid sequence encoding the heavy chain of the antibody encodes the amino acid sequence of SEQ ID No 5.

[0073] In a preferred embodiment, the second nucleic acid sequence encoding the light chain of the antibody encodes the amino acid sequence of SEQ ID No 7.

[0074] In a preferred embodiment, the first and second nucleic acid sequences encoding the heavy and light chain of the antibody respectively encode the amino acid sequence of SEQ ID No 5 and SEQ ID No 7.

[0075] In a preferred embodiment, the first nucleic acid sequence encoding the heavy chain of the antibody comprises the sequence of SEQ ID No 4.

[0076] In a preferred embodiment, the second nucleic acid sequence encoding the light chain of the antibody comprises the sequence of SEQ ID No 6.

[0077] In a preferred embodiment, the first and second nucleic acid sequences encoding the heavy and light chain of the antibody respectively comprise the sequence of SEQ ID No 4 and SEQ ID No 6.

[0078] In a preferred embodiment, the DNA construct comprises the nucleic acid sequences of SEQ ID No 8 and SEQ ID No 9. The resulting antibody heavy and light chains can each comprise a cleaved or uncleaved signal peptide. In case the signal peptide is uncleaved, said heavy and light chains with the uncleaved signal peptide each comprise the amino acid sequences of SEQ ID No 10 and SEQ ID No 11, respectively.

[0079] In a preferred embodiment, the DNA construct comprises the nucleic acid sequences of SEQ ID No 12 and SEQ ID No 13. The resulting antibody heavy and light chains can each comprise a cleaved or uncleaved signal peptide. In case the signal peptide is uncleaved, said heavy and light chains with the uncleaved signal peptide each comprise the amino acid sequences of SEQ ID No 10 and SEQ ID No 11, respectively.

[0080] The fifth aspect of the present application relates to a DNA construct comprising a nucleic acid sequence encoding an amino acid sequence, wherein said amino acid sequence comprises:

[0081] - the amino acid sequence of Nivolumab (Opdivo, CAS No 946414-94-4);

[0082] - the signal peptide of SEQ ID No 3 fused to the heavy chain amino acid sequence of Nivolumab; and

[0083] - the signal peptide of SEQ ID No 3 fused to the light chain amino acid sequence of Nivolumab.

[0084] In a preferred embodiment, the heavy chain amino acid sequence of Nivolumab comprises the sequence of SEQ ID No 5.

[0085] In a preferred embodiment, the light chain amino acid sequence of Nivolumab comprises the sequence of SEQ ID No 7.

[0086] The sixth aspect of the present application relates to an expression vector comprising the DNA construct according to any one of the first to fifth aspects of the present application.

[0087] In a preferred embodiment, the expression vector comprises one or more of the following nucleic acid elements:

[0088] - a promoter,

[0089] - a terminator,

[0090] - a selection marker,

[0091] - a replication origin, and / or

[0092] - an antibiotic resistance marker,

[0093] wherein the expression vector further comprises at least one multiclonal site which can be cleaved by a restriction enzyme, preferably the restriction enzyme is EcoRI, Ndel, Notl, Xhol, PspXI, PaeR71, Bbsl, StyI, Avrll, Banl, Acc65I, Kpnl, Eco53kl, SacI, BamHI, Xbal, Sail, AccI, Pstl, SbfI, SphI or HindIII.

[0094] In a preferred embodiment, the selection marker comprises a gene encoding dihydrofolate reductase DHFR or glutamine synthetase GS.

[0095] A seventh aspect of the present application relates to an expression cassette comprising the DNA construct according to any one of the first to fifth aspects of the present application.

[0096] An eighth aspect of the present application relates to a host cell comprising the DNA construct according to any one of the first to fifth aspects of the present application, wherein the host cell is preferably a eukaryotic cell, more preferably a mammalian cell.

[0097] In a preferred embodiment, the host cell is a Chinese hamster ovary CHO cell.

[0098] In a preferred embodiment, the host cell is a CHO-DG44 cell or a CHO GS - / - cell.

[0099] A ninth aspect of the present application relates to a recombinant protein expressed from the DNA construct according to any one of the first to fifth aspects of the present application. The recombinant protein can comprise one or more polypeptide chains.

[0100] In a preferred embodiment, the recombinant protein is an antibody, an antibody fragment, an enzyme and a hormone.

[0101] In a preferred embodiment, the recombinant protein is a monoclonal antibody, a polyclonal antibody, a chimeric antibody, or a fragment of said monoclonal antibody, polyclonal antibody, chimeric antibody.

[0102] In a preferred embodiment, the recombinant protein is Nivolumab. Nivolumab is a human IgG4 monoclonal antibody. It is a therapeutic antibody, marketed under the brand name Opdivo, and is a drug used to treat a number of cancers. This includes melanoma, lung cancer, renal cell carcinoma, Hodgkin's lymphoma, head and neck cancer, colon cancer, and liver cancer. It is usually used by slow injection into a vein.

[0103] The tenth aspect of the application relates to an RNA expressed from the DNA construct according to any one of the first to fifth aspects of the application.

[0104] The eleventh aspect of the application relates to a method of expressing a recombinant protein, the method comprising the steps of:

[0105] a. cloning one or more open reading frames encoding a recombinant protein or one or more polypeptide chains thereof into one or more DNA constructs according to any one of the first to third aspects of the application; and

[0106] b. transfecting the resulting nucleic acid sequence into a host cell, wherein the host cell is preferably a eukaryotic cell, more preferably a mammalian cell.

[0107] In a preferred embodiment, the method further comprises the step of integrating the transfected nucleic acid sequence into the genome of the host cell.

[0108] The thirteenth aspect of the application relates to a method of expressing a recombinant protein, the method comprising the steps of:

[0109] a. cloning the DNA construct according to the fourth or fifth aspect of the application; and

[0110] b. transfecting the resulting nucleic acid sequence into a host cell, wherein the host cell is preferably a eukaryotic cell, more preferably a mammalian cell.

[0111] In a preferred embodiment, the method further comprises the step of integrating the transfected nucleic acid sequence into the genome of the host cell.

[0112] The fourteenth aspect of the application relates to a DNA construct for expressing a signal peptide in any type of host cell, including prokaryotic, eukaryotic and / or yeast cells, wherein the DNA construct comprises a nucleic acid sequence encoding a signal peptide, wherein the nucleic acid sequence encoding the signal peptide comprises the nucleic acid sequence of SEQ ID No 2. The nucleic acid sequence of SEQ ID No 2 encodes a signal peptide comprising the amino acid sequence of SEQ ID No 3. Further aspects relate to expression vectors, expression cassettes and host cells comprising the DNA construct. BRIEF DESCRIPTION OF DRAWINGS

[0113] Figure 1 : Increased likelihood of identifying high antibody producing cell cultures containing TIS EVO micro libraries containing TIS CON (black) or TIS EVO (hollow) micro libraries on the day of harvest.

[0114] Figure 2: Possibility of identifying high antibody producing cell cultures containing micro library of TIS EVO : Figure represents the average productivity, average Qp (pg / c / d) of micro library containing TIS CON (black) or TIS EVO (hollow) on the day of harvest.

[0115] Figure 3 : Comparison of titers and specific productivity of CHO-DG44 cell lines expressing monoclonal antibodies (mAbs) - Final cumulative titer values (g / L) of cell lines carrying TIS CON (black dots) or TIS EVO (hollow dots).

[0116] Figure 4 : Comparison of titers and specific productivity of CHO-DG44 cell lines expressing mAbs - Final cumulative specific productivity, Qp, (pg / c / d) of cell lines carrying TIS CON (black dots) or TIS EVO (hollow dots).

[0117] Figure 5 : Glycan profile of commercially available Nivolumab (i.e. these samples were produced without using TIS CON and TIS EVO ).

[0118] Figure 6 : Glycan profile of Nivolumab variants derived from micro library containing TIS CON .

[0119] Figure 7 : Glycan profile of Nivolumab variants derived from micro library containing TIS EVO .

[0120] Figure 8 : Charge distribution of Nivolumab variants derived from TIS CON micro library. The originator is labeled as AAX2414.

[0121] Figure 9 : Charge distribution of Nivolumab variants derived from TIS EVO micro library. The originator is labeled as AAX2414. DETAILED DESCRIPTION

[0122] In the art, TIS sequences are sometimes referred to as RNA sequences that function as protein translation initiation sites (TIS) in mRNA transcripts [9]. However, in the present invention, the term TIS sequence refers to a DNA sequence that is transcribed into said RNA sequence.

[0123] Since the prior art research has not presented a unique universal sequence that can be reliably used, the inventors designed a new type of nucleic acid TIS sequence (herein referred to as TIS EVO ), which provides better technical effects than the prior art GCCACC ATG GA sequence (herein marked as TIS CON ) in a recombinant expression system for producing antibodies in mammalian cells.

[0124] The new TIS sequence referred to herein as TIS EVO comprises the nucleic acid sequence TCGGTC ATG GC, also referred to as SEQ ID No 1 in the present invention.

[0125] In the present invention, the term nucleic acid refers to at least two nucleotides covalently linked together. Furthermore, the sequence of the complementary strand is disclosed in addition to the disclosed single strand. Thus, the nucleic acid sequence also includes the complementary strand of the disclosed single strand.

[0126] The nucleic acid sequence of SEQ ID No 1 is comprised in a DNA construct suitable for expressing a recombinant protein in mammalian cells. The TIS EVO nucleic acid sequence of SEQ ID No 1 comprises:

[0127] - 6 nucleotides upstream (immediately following) the ATG start codon (i.e. comprising the nucleotides from position -6 to -1, where the A of the ATG start codon is position +1 ), and

[0128] - 2 nucleotides downstream (immediately following) the ATG start codon (i.e. comprising the nucleotides from +4 to +5, where the G of the ATG start codon is position +3).

[0129] In the present invention, the term DNA construct refers to an artificially constructed nucleic acid fragment to be inserted into a host cell (e.g. by using an expression vector or expression cassette).

[0130] The TIS EVO nucleic acid sequence is transcribed into the RNA sequence UCGGUCAUGGC (also referred to herein as SEQ ID No 14), which acts as a protein translation initiation site in the mRNA transcript. In other words, the TIS EVO nucleic acid sequence is a Kozak-like sequence.

[0131] The above-mentioned DNA construct can further comprise a nucleic acid sequence encoding a signal peptide. The nucleic acid sequence of SEQ ID No 1 in such a DNA construct can comprise:

[0132] - an ATG start codon in the nucleic acid sequence encoding the first amino acid residue of the signal peptide; and

[0133] - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence encoding the second amino acid residue of the signal peptide.

[0134] In the present application, the term signal peptide refers to a leader peptide fused to the N-terminus of the recombinant protein to be expressed. The signal peptide facilitates the secretion of the recombinant protein out of the host cell in which it is produced. The signal peptide is usually cleaved from the remaining peptide upon secretion from the cell.

[0135] In one embodiment of the present application, the nucleic acid sequence encoding the signal peptide according to the present application comprises a modification of the nucleic acid sequence expressing the signal peptide which expresses a signal peptide having a methionine (M) as the first amino acid at the N-terminus of the signal peptide. Such a signal peptide can be selected from those described in Kober et al.

[11] , Haryadi R. et al.

[12] , US10066019, Ramezani A. et al.

[15] and Peng L. et al.

[16] all of which relate to the expression of recombinant proteins in eukaryotic host cells using a signal peptide. The modification according to the present application relates to the alteration of the first codon downstream of the ATG start codon by exchanging the first two nucleotides to GC. The resulting signal peptide will comprise MA as the first two amino acids at the N-terminus of the signal peptide.

[0136] In one embodiment of the present application, the nucleic acid sequence encoding the signal peptide comprises the nucleic acid sequence of SEQ ID No 2. The nucleic acid sequence of SEQ ID No 1 will in this DNA construct comprise:

[0137] - the ATG start codon in SEQ ID No 2; and

[0138] - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence of SEQ ID No 2.

[0139] The DNA construct can further comprise a nucleic acid sequence encoding a recombinant protein. In this DNA construct, the nucleic acid sequence encoding the signal peptide can be operably linked to the nucleic acid sequence encoding the recombinant protein. The recombinant protein can be an antibody, a multimeric protein, a monomeric protein, an enzyme and / or a hormone. However, other recombinant proteins can also be contemplated.

[0140] The term antibody in the present application refers to a monoclonal antibody, a polyclonal antibody, a chimeric antibody or a fragment thereof. A fragment of such an antibody (also referred to herein as an antibody fragment) is a portion of an intact antibody that contains the antigen-binding site or variable region. The antibody fragment can be a Fab fragment, a Fab' fragment, a Fab'-SH fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a diabody, a triabody and / or a single-chain Fv (scFv) molecule.

[0141] In one embodiment of the present application, the DNA construct comprises:

[0142] - two nucleic acid sequences of SEQ ID No 1 ;

[0143] - two nucleic acid sequences encoding a signal peptide; and

[0144] - a recombinant protein;

[0145] wherein the nucleic acid sequences encoding a signal peptide can be the same or different sequences, i.e. the signal peptides can be the same or different signal peptides. The construction of vectors expressing the same or different signal peptides is known in the art, as described by Kober et al.

[11] , Haryadi R. et al.

[12] and Li F. et al.

[13] . The recombinant protein is preferably an antibody. Furthermore, each nucleic acid sequence encoding a signal peptide is operably linked to the two nucleic acid sequences of the recombinant protein (e.g. the nucleic acid sequences encoding the heavy and light chains).

[0146] In one embodiment of the application, the DNA construct comprises:

[0147] - a first and a second nucleic acid sequence each comprising a nucleic acid sequence of SEQ ID No 1,

[0148] - a first nucleic acid sequence encoding a signal peptide;

[0149] - a second nucleic acid sequence encoding a signal peptide;

[0150] - a first nucleic acid sequence encoding an antibody heavy chain; and

[0151] - a second nucleic acid sequence encoding an antibody light chain.

[0152] In this DNA construct, the first and the second nucleic acid sequence of SEQ ID No 1 comprise:

[0153] - an ATG start codon in the first and the second nucleic acid sequence encoding a signal peptide; and

[0154] - the first two nucleotides downstream of the ATG start codon in the first and the second nucleic acid sequence encoding a signal peptide.

[0155] The first nucleic acid sequence encoding a signal peptide is operably linked to the first nucleic acid sequence encoding an antibody heavy chain. Similarly, the second nucleic acid sequence encoding a signal peptide is operably linked to the second nucleic acid sequence encoding an antibody light chain.

[0156] In one embodiment of the application, the DNA construct encoding the first and the second nucleic acid sequence of a signal peptide can each comprise a nucleic acid sequence of SEQ ID No 2. In this DNA construct, the first and the second nucleic acid sequence of SEQ ID No 1 comprise:

[0157] - the ATG start codon in SEQ ID No 2 of the first and second nucleic acid sequence encoding a signal peptide,

[0158] - the two first nucleotides downstream of the ATG start codon in SEQ ID No 2 of the first and second nucleic acid sequence encoding a signal peptide.

[0159] The first nucleic acid sequence encoding an antibody heavy chain can comprise the nucleic acid sequence of SEQ ID No 4. The second nucleic acid sequence encoding an antibody light chain can comprise the nucleic acid sequence of SEQ ID No 6.

[0160] The first nucleic acid sequence encoding an antibody heavy chain can comprise the nucleic acid sequence of SEQ ID No 4. The second nucleic acid sequence encoding an antibody light chain can comprise the nucleic acid sequence of SEQ ID No 6.

[0161] The DNA construct can comprise the nucleic acid sequence of SEQ ID No 8 or SEQ ID No 12, wherein said sequence comprises:

[0162] - the first nucleic acid sequence comprising the nucleic acid sequence of SEQ ID No 1 ;

[0163] - the first nucleic acid sequence encoding a signal peptide comprising the nucleic acid sequence of SEQ ID No 2; and

[0164] - the first nucleic acid sequence encoding an antibody heavy chain comprising the nucleic acid sequence of SEQ ID No 4;

[0165] wherein the first nucleic acid sequence of SEQ ID No 1 comprises:

[0166] - the ATG start codon in SEQ ID No 2 of the first nucleic acid sequence encoding a signal peptide; and

[0167] - the two first nucleotides downstream of the ATG start codon.

[0168] The DNA construct can comprise the nucleic acid sequence of SEQ ID No 9 or SEQ ID No 13, wherein said sequence comprises:

[0169] - the second nucleic acid sequence comprising the nucleic acid sequence of SEQ ID No 1 ;

[0170] - the second nucleic acid sequence encoding a signal peptide comprising the nucleic acid sequence of SEQ ID No 2; and

[0171] - the second nucleic acid sequence encoding an antibody light chain comprising the nucleic acid sequence of SEQ ID No 6,

[0172] wherein the second nucleic acid sequence of SEQ ID No 1 comprises:

[0173] - the ATG start codon in SEQ ID No 2 of the second nucleic acid sequence encoding the signal peptide; and

[0174] - the first two nucleotides downstream of the ATG start codon.

[0175] The DNA construct can comprise the nucleic acid sequences of SEQ ID No 8 and SEQ ID No 9. Alternatively, the DNA construct can comprise the nucleic acid sequences of SEQ ID No 12 and SEQ ID No 13. SEQ ID Nos 12 and 13 differ from the nucleic acids of SEQ ID Nos 8 and 9, respectively, only in that the nucleic acids of SEQ ID Nos 12 and 13 each further comprise a restriction site.

[0176] The above disclosed DNA construct can be integrated into an expression vector suitable for transfection into a mammalian cell. Such a vector can comprise the following nucleic acid elements:

[0177] - a promoter,

[0178] - a terminator,

[0179] - a selection marker,

[0180] - an origin of replication, and / or

[0181] - an antibiotic resistance marker.

[0182] The expression vector can further comprise at least one multiclonal site which can be cleaved by a restriction enzyme, such as EcoRI, Ndel, Notl, Xhol, PspXI, PaeR71, Bbsl, StyI, Avrll, Banl, Acc65l, Kpnl, Eco53kl, SacI, BamHI, Xbal, Sail, AccI, Pstl, SbfI, Sphl and / or Hindlll.

[0183] Li F. et al.

[13] and Noh S.H. et al.

[14] describe expression vectors for mammalian cells and the nucleic acid elements typically comprised in such expression vectors, while the use of these expression vectors in the present application is described in the embodiments of the expression vector described hereinafter.

[0184] The expression vector can include one or more promoters. The promoter can be any promoter that is capable of driving gene expression and modulating gene expression. Preferably, the promoter can be one that has shown to be effective for expression of a recombinant protein in mammalian cells, such as CHO cells. In a further preferred embodiment, the promoter is effective for expression of a recombinant protein in CHO-DG44 cells. Particular examples of promoters that can be used in the present application are the cytomegalovirus (CMV) promoter and / or the elongation factor alpha (EF1a) promoter.

[0185] In an expression vector having a DNA construct comprising:

[0186] - a first nucleic acid sequence encoding a heavy chain of an antibody,

[0187] - a second nucleic acid sequence encoding a light chain of an antibody,

[0188] The expression vector can comprise a first promoter for expression of the first nucleic acid sequence as a first transcript and a second promoter for expression of the second nucleic acid sequence as a second transcript. The first transcript is then translated into a heavy chain polypeptide and the second transcript is translated into a light chain polypeptide, the resulting antibody will be produced from the heavy and light chain polypeptides. In such an expression vector, the first and second promoters in embodiments of the present application can be the same or different. In such an expression vector, one preferred embodiment involves the use of two CMV promoters, i.e., each for the first and second nucleic acid sequences encoding the heavy and light chains of an antibody.

[0189] In one embodiment of the expression vector, an intron sequence in the 5' untranslated region is included after the promoter to increase export of the transcribed mRNA from the host cell nucleus to the cytoplasm; in addition, one or more 3' polyadenylation signal sequences can also be included in the expression vector to maximize mRNA levels. Some examples of polyadenylation signal sequences that can be included in the expression vector are the SV40 late or early polyadenylation signal sequences and the bovine growth hormone polyadenylation sequence.

[0190] In the present application, a metabolic selection marker (e.g., a gene encoding dihydrofolate reductase (DHFR)) can be used as a selection marker in the expression vector to be transfected into CHO-DG44 cells. The DNA construct can be amplified using the DHFR inhibitor methotrexate (MTX).

[0191] Another marker is a gene encoding glutamine synthetase (GS), which can be used as a selection marker in the expression vector to be transfected into CHO GS - / - cells. GS catalyzes the conversion of ammonia and glutamate to glutamine, while MSX inhibits the activity of the GS protein.

[0192] The origin of replication that can be used in the present application can be selected from the group consisting of pUC origin, pBR 322 origin; pACYC origin, pSC101 origin and ColE1 origin. However, derivatives of these origins of replication as well as other origins of replication used in the art can also be used. One example of a eukaryotic origin of replication that can be used is the SV40 origin of replication.

[0193] The antibiotic resistance marker comprises a gene whose product confers resistance to an antibiotic, such as a gene for resistance to chloramphenicol, ampicillin, zeocin, bleomycin, gentamycin, streptomycin, tetracycline, kanamycin and neomycin. Thus, some examples of antibiotic resistance markers used in expression vectors are a chloramphenicol resistance gene, a kanamycin resistance gene, an ampicillin resistance gene, a zeocin resistance gene, a bleomycin resistance gene, a gentamycin resistance gene, a gentamycin resistance gene, a streptomycin resistance gene, a tetracycline resistance gene and a neomycin resistance gene. The use of these antibiotic resistance markers in expression vectors is known in the art, see for example Li F. et al.

[13] and US8138324.

[0194] Other antibiotic selection markers that can be used are puromycin acetyltransferase, blasticidin deaminase, histidinol dehydrogenase, hygromycin phosphotransferase, zeocin resistance gene, bleomycin resistance gene and aminoglycoside phosphotransferase. These markers use puromycin, blasticidin, histidinol, hygromycin, zeocin, bleomycin and neomycin (G418) as selective agents, respectively.

[0195] The expression vector can also comprise one or more transcription termination regions. The transcription termination region is usually located downstream of the coding sequence to provide efficient transcription termination.

[0196] In the present embodiment for expressing the heavy and light chains of an antibody, the expression vector of the present application comprises the following nucleic acid elements, which are also indicated in the chapter "Cell line development" of Li F. et al.

[13] :

[0197] - a first and a second nucleic acid sequence encoding the heavy and light chains of the antibody to be expressed;

[0198] - two CMV promoters, i.e. a first and a second nucleic acid sequence encoding the heavy and light chains of the antibody, respectively;

[0199] - an intron sequence comprising a 5' untranslated region downstream of each CMV promoter;

[0200] - a 3' polyadenylation signal sequence downstream of each of said 5' untranslated regions;

[0201] - a gene encoding a selection marker DHFR;

[0202] - a DNA construct comprising a TIS sequence (i.e. a Kozak sequence) and a signal peptide upstream of each of the first and second nucleic acid sequences encoding the antibody heavy and light chains; and

[0203] - an antibiotic resistance marker.

[0204] The above disclosed DNA constructs can also be comprised in an expression cassette suitable for transfection into a mammalian cell. Such expression cassettes can comprise the following nucleic acid elements:

[0205] - a promoter,

[0206] - a terminator, and

[0207] - a selection marker.

[0208] The host cell lines used in the present application can be developed as described in Li F. et al.

[13] and Noh S.H. et al.

[14] . The host cells of the above embodiments accommodating the expression vectors and expression cassettes are preferably mammalian host cells derived from human, hamster or murine cell lines. In a preferred embodiment of the present application, CHO cells, such as CHO-DG44 cells or CHO GS - / - cells can be used.

[0209] As already discussed above, the various embodiments of the DNA constructs, expression vectors, host cells and methods can be used to express a recombinant protein or one or more polypeptide chains thereof. One example of a protein that can be expressed is an antibody, antibody fragment, enzyme and hormone.

[0210] It is noted that in the present application the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise. The present application also contemplates other embodiments that include ("comprising,") the embodiments or elements presented herein, "consisting of" and "consisting essentially of the same, whether explicitly set forth or not.

[0211] The present application has multiple aspects, which are illustrated in the non-limiting "Examples" section. It should be noted that in the "Examples" section, DNA constructs encoding the heavy and light chains of nivolumab ( ) have been cloned into expression vectors comprising a TIS CON sequence and into expression vectors comprising a TIS EVO sequence.

[0212] It should be understood that these examples related to nivolumab, although showing preferred embodiments of the present invention, are given only in an illustrative manner. Through the embodiments of the present invention disclosed above and the following examples, those skilled in the art can determine the fundamental characteristics of the present invention, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present invention to adapt it to various types of therapeutic antibodies (such as mAbs or fragments thereof) and immunoglobulins (i.e., IgG, IgM, IgD, IgA and IgE). Therefore, based on the foregoing description, various modifications of the present invention other than those shown and described herein will be obvious to those skilled in the art. These modifications should also fall within the scope of the appended claims.

[0213] Example

[0214] Examples 1 and 3 described below show that by replacing the TIS of SEQ ID No 1 EVO Introduce expression vector and use TIS CON Compared with the mini-libraries transfected with WT cells, the probability of identifying mini-libraries producing high mAb (nivolumab) is increased.

[0215] Surprisingly, among the monoclonal cell lines producing >4.2 g / L mAb, ten out of fourteen carried TIS EVO In addition, with the commonly used TIS CON The top ten cell lines compared to the top ten TIS EVO The cell line produced an average of 0.56 g / L more mAb (nivolumab) while maintaining quality and biosimilarity. This study highlights the importance and significance of the TIS sequence in the development of CHO cell lines.

[0216] In addition, Example 2 shows that when compared with the EVO and TIS CON expressed in any of the expression vector systems (i.e., original nivolumab) compared to TIS EVO The expressed nivolumab has similar post-translational modifications. This clearly shows that when TIS EVO The quality and biosimilarity of nivolumab were maintained.

[0217] For experimental details of the following examples, please read the separate "Materials and Methods" section. All publications, patent applications, patents, and other references mentioned in this document are incorporated by reference in their entirety.

[0218] The “Examples” and “Materials and Methods” sections disclosed herein are illustrative only and are not intended to be limiting.

[0219] Example 1. TIS EVO Increased mAb production in fed-batch cultures of minilibraries

[0220] To compare the impact of TIS sequence variants during CHO-DG44 cell line development, cells were transfected with TIS ATG GA(TIS CON ) changed to TCGGTC ATG GC(TIS EVO ) new TIS sequence, while introducing nucleotide changes in the expression vector.

[0221] In parallel experiments, cells were transfected with TIS EVO or TIS CON vectors (i.e. vectors containing TIS EVO or TIS CON sequences) by electroporation and integrants were selected by seeding 4000 to 8000 viable cells per well in 96-well plates 24 hours post transfection. After screening for the best growing colonies, titers were measured in static cultures and top minilibraries were expanded and adapted to suspension. The top 12 minilibraries were further evaluated in fed-batch studies in shake flasks based on cell specific productivity (pg / cell / pay) and total titer (g / L). Notably, 7 out of the top 12 minilibraries were transfected with TIS EVO In addition, upon analyzing the data of the fed-batch studies, it was found that for minilibraries containing TIS EVO , in addition to increased colony formation in 96-well plates, higher titers and clear signs of higher cell specific productivity were seen. Fed-batch results indicated that the top three high producing minilibraries had integrated the vector with TIS EVO ( Figure 1 and 2 ). The average maximum viable cell density (VCD) / ml was lower for minilibraries with TIS CON (20.1*10 6 cells / ml) compared to TIS EVO (15.2*10 6 cells / ml) and viability was prolonged for TIS EVO integrants ( Figure 1 and 2 , x-axis). These results indicate that mRNA with TIS EVO improves longevity, likely by more efficiently recruiting ribosomes, thereby increasing cell specific productivity and titer, but slightly hinders VCD (less ribosomes available for rapid growth).

[0222] Example 2. TIS EVO and TIS​​CON Comparable mAb glycan profiles and charge distributions of mini-libraries

[0223] To evaluate the use of TIS EVO To determine whether the increased productivity and titer of transfected cells affected protein quality, the charge distribution of acidic and basic species in the mini-library was analyzed ( Figure 8 and 9 ), glycan profile ( Figures 5 to 7 ) and size distribution, i.e., post-translational modifications (PTMs). Figures 5 to 9 As shown, the resulting data from the Water RapiFluor-MS workflow show that the EVO and TIS CON expressed in any expression vector system (i.e. original mAb) were compared with the TIS EVO and TIS CON Nivolumab expressed with the same expression vector system showed similar PTM patterns and charge distributions, clearly demonstrating that alterations in translation initiation rates did not affect either protein quality or biosimilarity.

[0224] Figures 5 to 8 The glycans disclosed in have the following Oxford Notation names

[18] :

[0225] -A2;

[0226] -F(6)A2 (same as FA2 in reference 20);

[0227] -A2[3]G1;

[0228] -A2[6]G1;

[0229] -F(6)A2[3]G1 (same as FA2[3]G1 in reference 20);

[0230] -F(6)A2[6]G1 (same as FA2[6]G1 in reference 20);

[0231] -F(6)A2G2 (same as FA2G2 in reference 20)

[0232] -M5; and

[0233] -F(6)A1.

[0234] In the case of TIS EVO Increased mAb production in monoclonal cell lines

[0235] To generate monoclonal cell lines, the top 8 mini-pools (based on titer and protein quality) were seeded as single cells using fluorescence-activated cell sorting (FACS) and single cell images were taken to further ensure monoclonality. The top 48 clones based on monoclonality, cell growth, and productivity were expanded and adapted to suspension culture prior to evaluation in ambr 15 microbial reactors. Cultures were harvested when viability was <70% or at the latest on day 14 of cultivation. Upon analysis of the total yield and cell specific productivity of the mAb producing monoclonal cell lines, it was observed that cell lines containing TIS EVO and TIS CON differed significantly in titer and specific productivity Figure 3 and 4 ). Of the 48 cultured clones, 14 clones produced cumulative titer values > 4.2 g / L, of which 10 clones contained TIS EVO . The highest yielding cell line also contained TIS EVO and produced 6.1 g / L mAb Figure 3 under a generic non-optimized fed-batch process. Furthermore, upon analysis of cell specific productivity, 10 of the 14 high producers contained TIS EVO , the best TIS EVO variant produced ~ 60 pg / c / d mAb Figure 4 . In summary, these results demonstrate that our rationally designed TIS CON has advantages in both the likelihood of identifying high producers during mini-pool generation and in identifying monoclonal DG44 cell lines with higher productivity and titer compared to the commonly used standard TIS EVO .

[0236] Materials and Methods

[0237] Vector engineering and transfection

[0238] The expression vectors used for comparing TIS CON and TIS EVO , i.e. the TIS CON vector and the TIS EVO vector, both comprise the following nucleic acid elements which are also disclosed in the chapter “Cell line development” of Li F. et al.

[13] :

[0239] - a first and a second nucleic acid sequence encoding the heavy and light chain of an antibody to be expressed;

[0240] - two CMV promoters, i.e. each for the first and the second nucleic acid sequence encoding the heavy and light chain of an antibody;

[0241] - an intronic sequence comprising a 5’ untranslated region after each CMV promoter;

[0242] - a 3' polyadenylation (polyA) signal sequence is comprised after each of said 5' untranslated regions;

[0243] - a gene encoding a selection marker DHFR;

[0244] - a nucleic acid sequence encoding a signal peptide upstream (i.e. upstream) of each of the first and second nucleic acid sequences encoding the heavy and light chains of the antibody to be expressed;

[0245] - a TIS sequence (i.e. Kozak sequence) upstream of the signal peptide nucleic acid sequence; and

[0246] - an antibiotic resistance marker.

[0247] The first and second nucleic acid sequences encoding the heavy and light chains of Nivolumab (Opdivo®) ) were each cloned into an expression vector comprising two TIS CON sequences or two TIS EVO sequences, as described in the following paragraphs. The first nucleic acid sequence encoding the heavy chain of Nivolumab comprises the sequence of SEQ ID No 4, while the second nucleic acid sequence encoding the light chain of Nivolumab comprises the sequence of SEQ ID No 6. Thus, the first nucleic acid sequence encodes a heavy chain comprising the amino acid sequence of SEQ ID No 5, while the second nucleic acid sequence encodes a light chain comprising the amino acid sequence of SEQ ID No 7.

[0248] In the vector comprising two TIS CON sequences (i.e. TIS CON vector), the nucleic acid sequence encoding each signal peptide comprises the nucleic acid sequence of the signal peptide for expressing the amino acid sequence MDLLHKNMKHLWFFLLLVAAPRWVLS. This signal peptide has been previously disclosed in Haryadi R. et al.

[12] and US10066019 for expressing polypeptide chains of therapeutic antibodies.

[0249] To design the TIS EVO sequence, the GCCACC sequence of the TIS CON sequence was changed to a TCGGTC sequence. In addition, the first codon downstream of the ATG start codon encoding the first amino acid of the signal peptide was changed from GAT to GCT, resulting in an amino acid substitution at this position. These combined changes resulted in a TIS ATG sequence comprising a TCGGTC EVO sequence of GC nucleotides (SEQ ID No 1).

[0250] The vector comprising two TIS EVOThe expression vector of the sequence (SEQ ID No 1) was engineered to comprise two nucleic acid sequences each comprising a coding signal peptide comprising the nucleic acid sequence of SEQ ID No 2. The nucleic acid sequence of SEQ ID No 1 each comprises:

[0251] - the ATG start codon in the sequence of SEQ ID No 2; and

[0252] - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence of SEQ ID No 2.

[0253] The nucleic acid sequence of SEQ ID No 2 encodes a new signal peptide of the amino acid sequence MALLHKNMKHLWFFLLLVAAPRWVLS (SEQ ID No 3) which has not been previously disclosed in any prior art document.

[0254] To test the activity of the TIS EVO , DNA constructs comprising the nucleic acid sequences of SEQ ID No 8 and SEQ ID No 9 encoding respectively the heavy and light chains of Nivolumab were cloned into an expression vector. The DNA construct used for this purpose comprises the nucleic acid sequences of SEQ ID No 12 and SEQ ID No 13 comprising (i) the nucleic acid sequences of SEQ ID No 8 and SEQ ID No 9 encoding respectively the heavy and light chains of the antibody, (ii) restriction sites able to be cloned into an expression vector.

[0255] Thus, the DNA construct comprising the nucleic acid sequences of SEQ ID No 8 and SEQ ID No 12 each comprises:

[0256] - a first nucleic acid sequence comprising the nucleic acid sequence of SEQ ID No 1 (TIS EVO );

[0257] - a first nucleic acid sequence comprising the nucleic acid sequence of SEQ ID No 2 encoding a signal peptide; and

[0258] - a first nucleic acid sequence comprising the nucleic acid sequence of SEQ ID No 4 encoding a heavy chain of the antibody;

[0259] wherein the first nucleic acid sequence of SEQ ID No 1 comprises:

[0260] - the ATG start codon in the first nucleic acid sequence of SEQ ID No 2 encoding a signal peptide; and

[0261] - the first two nucleotides downstream of the ATG start codon.

[0262] Similarly, the DNA constructs comprising the nucleic acid sequences of SEQ ID No 9 and SEQ ID No 13 each comprise:

[0263] - a second nucleic acid sequence (TIS) comprising the nucleic acid sequence of SEQ ID No 1 EVO );

[0264] - a second nucleic acid sequence encoding a signal peptide comprising the nucleic acid sequence of SEQ ID No 2; and

[0265] - a second nucleic acid sequence encoding an antibody light chain comprising the nucleic acid sequence of SEQ ID No 6;

[0266] The second nucleic acid sequence of SEQ ID No 1 comprises:

[0267] - the ATG start codon in SEQ ID No 2 of the second nucleic acid sequence encoding a signal peptide; and

[0268] - the first two nucleotides downstream of the ATG start codon.

[0269] To test TIS CON To test the activity of TIS, two DNA constructs containing nucleic acid sequences encoding the heavy chain (SEQ ID No 4) and light chain (SEQ ID No 6) of nivolumab were cloned into expression vectors. EVO Similar to the vector of nivolumab, the nucleic acid sequences encoding the heavy chain (SEQ ID No 4) and light chain (SEQ ID No 6) of nivolumab are each operably linked to a nucleic acid sequence expressing the signal peptide MDLLHKNMKHLWFFLLLVAAPRWVLS. Each nucleic acid sequence expressing the signal peptide is operably linked to the TIS sequence of GCCACC.

[0270] Therefore, TIS CON Vector and TIS EVO The vectors differ only in the following ways (where differences in nucleic acid and amino acid sequence are underlined):

[0271] -TIS CON The vector contains two TIS residues GCCACCATGGA CON sequence, and TIS EVO The vector contains two T C GGT CATGG C TIS EVO sequence; and

[0272] -TIS CON The vector contains two nucleic acid sequences, each of which expresses the amino acid sequence MD signal peptide of LLHKNMKHLWFFLLLVAAPRWVLS, while TIS EVO The vector comprises two nucleic acid sequences, each expressing the amino acid sequence M A signal peptide of LLHKNMKHLWFFLLLVAAPRWVLS.

[0273] Fed-batch cultivation for minilibrary and clone evaluation

[0274] A fed-batch procedure according to the general procedure run criteria for minilibrary and clone evaluation. Cells were inoculated at a density of 3x10 5 cells / mL in 25 mL chemically defined production medium using 125 mL shake flasks (minilibrary) or ambrl5 micro bioreactors (clone). Feed A, Feed B and glucose were added according to the standard feeding scheme. Cell density, viability, product concentration, glucose and lactate were controlled. Cells were cultivated for up to 14 days or until the viability dropped below 70%.

[0275] References

[0276] 1. Noh, S. M., Shin, S., and Lee, G. M. (2020). Cell Line Development for Therapeutic Protein Production. In Cell Culture Engineering (eds G. M. Lee, H. Faustrup Kildegaard, S. Y. Lee, J. Nielsen, and G. Stephanopoulos)

[0277] 2. Lynch, M., and Marinov, G. K. (2015). The bioenergetic costs of a gene. Proceedings of the National Academy of Sciences of the United States of America, 112(51), 15690-15695.

[0278] 3. Shah, P., Ding, Y., Niemczyk, M., Kudla, G., and Plotkin, J. B. (2013). Rate-limiting steps in yeast protein translation. Cell, 153(7), 1589-1601.

[0279] 4. Kozak M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell, 44(2), 283-92.

[0280] 5. Svidritskiy, E., Brilot, A. F., Koh, C. S., Grigorieff, N., and Korostelev, A. A. (2014). Structures of yeast 80S ribosome-tRNA complexes in the rotated and nonrotated conformations. Structure (London, England: 1993), 22(8), 1210-1218.

[0281] 6. Acevedo, J. M., Hoermann, B., Schlimbach, T., and Teleman, A. A. (2018). Changes in global translation elongation or initiation rates shape the proteome via the Kozak sequence. Scientific reports, 8(1), 4018.

[0282] 7. Kozak M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic acids research, 15(20), 8125-8148.

[0283] 8. Kallehauge, T. B. et al. (2017) Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion. Sci. Rep. 7, 40388

[0284] 9. Noderer, W. L., Flockhart, R. J., Bhaduri, A., Diaz de Arce, A. J., Zhang, J., Khavari, P. A., and Wang, C. L. (2014). Quantitative analysis of mammalian translation initiation sites by FACS-seq. Molecular systems biology, 10(8), 748.

[0285] 10. Petersen, S. D., Zhang, J., Lee, J. S., Jakociunas, T., Grav, L. M., Kildegaard, H. F., Keasling, J. D., and Jensen, M. K. (2018). Modular 5'-UTR hexamers for context-independent tuning of protein expression in eukaryotes. Nucleic acids research, 46(21)

[0286] 11. Kober, L., Zehe, C., and Bode, J. (2013). Optimized signal peptides for the development of high expressing CHO cell lines. Biotechnol. Bioeng., 110: 1164-1173

[0287] 12. Haryadi, R., Ho, S., Kok, Y. J., Pu, H. X., Zheng, L., Pereira, N. A., Li, B., Bi, X., Goh, L. T., Yang, Y., and Song, Z. (2015). Optimization of heavy chain and light chain signal peptides for high level expression of therapeutic antibodies in CHO cells. PloS one, 10(2), e0116878.

[0288] 13. Li, F., Vijayasankaran, N., Shen, A. Y., Kiss, R. and Amanullah, A. (2010). Cell culture processes for monoclonal antibody production. mAbs, 2(5), 466-479.

[0289] 14. Noh, S. M., Shin, S. and Lee, G. M. (2020). Cell Line Development for Therapeutic Protein Production. In Cell Culture Engineering (eds G. M. Lee, H. Faustrup Kildegaard, S. Y. Lee, J. Nielsen and G. Stephanopoulos).

[0290] 15. Ramezani, A., Maymand, E. M., Yazdanpanah-Samani, M., Hosseini, A., Toghraie, F. S. and Ghaderi, A. (2017). Improving Pertuzumab production by gene optimization and proper signal peptide selection. Protein expression and purification, 135, 24-32

[0291] 16. Peng, L., Yu, X., Li, C., Cai, Y., Chen, Y., He, Y., Yang, J., Jin, J. and Li, H. (2016). Enhanced recombinant factor VII expression in Chinese hamster ovary cells by optimizing signal peptides and fed-batch medium. Bioengineered, 7(3), 189-197

[0292] 17. https: / / www.ludger.com / docs / info-guides / ludger-igg-glycan-names.pdf SEQUENCE LISTING <110> XBRANE BIOPHARMACEUTICALS, INC. <120> New combinations of TIS sequences and signal peptide sequences for expression of recombinant proteins <130> 2020Q105-2 <160> 14 <170> BiSSAP 1.3.6 <210> 1 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> Kozak sequence - DNA <400> 1 tcggtcatgg c 11 <210> 2 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> Signal peptide - DNA sequence <400> 2 atggctctgc tgcacaagaa catgaagcac ctgtggttct ttctgctgct ggtggccgct 60 cctagatggg tgctgtct 78 <210> 3 <211> 26 <212> PRT <213> Artificial Sequence <220> <223> Signal peptide aa sequence <400> 3 Met Ala Leu Leu His Lys Asn Met Lys His Leu Trp Phe Phe Leu Leu 1 5 10 15 Leu Val Ala Ala Pro Arg Trp Val Leu Ser 20 25 <210> 4 ​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​<211> 1326 <212> DNA <213> Artificial Sequence <220> <223> Nivolumab - Heavy Chain - DNA Sequence <400> 4 caggtgcagc tggttgaatc tggtggcgga gtggtgcagc ctggcagatc tctgagactg 60 gattgcaagg cctccggcat caccttctcc aactctggca tgcactgggt ccgacaggcc 120 cctggaaaag gactggaatg ggtcgccgtg atttggtacg acggctctaa gcggtactac 180 gccgactccg tgaagggcag attcaccatc tctcgggaca actccaagaa caccctgttt 240 ctgcagatga actccctgag agccgaggac accgccgtgt actactgtgc caccaacgat 300 gattattggg gccagggcac actggtcacc gtgtcctctg cttctaccaa gggaccctct 360 gtgttccctc tggctccttg ctccagatcc acctctgagt ctaccgctgc tctgggctgc 420 ctggtcaagg attactttcc tgagcctgtg accgtgtctt ggaactctgg tgctctgacc 480 tccggcgtgc acacatttcc agctgtgctg cagtcctccg gcctgtactc tctgtcctct 540 gtcgtgaccg tgccttctag ctctctgggc accaagacct acacctgtaa cgtggaccac 600 aagccttcca acaccaaggt ggacaagcgc gtggaatcta agtacggccc tccttgtcct 660 ccatgtcctg ctccagaatt cctcggcgga ccttccgtgt tcctgtttcc tccaaagcct 720 aaggacaccc tgatgatctc tcggacccct gaagtgacct gcgtggtggt ggatgtgtct 780 caagaggacc ccgaggtgca gttcaattgg tacgtggacg gcgtggaagt gcacaacgcc 840 aagaccaagc ctagagagga acagttcaac tccacctaca gagtggtgtc cgtgctgacc 900 gtgctgcacc aggattggct gaacggcaaa gagtacaagt gcaaggtgtc caacaagggc 960 ctgccttcca gcatcgaaaa gaccatctcc aaggctaagg gccagcctcg ggaacctcag 1020 gtttacaccc tgcctccaag ccaagaggaa atgaccaaga accaggtgtc cctgacctgc 1080 ctcgtgaagg gattctaccc ttccgatatc gccgtggaat gggagtccaa tggccagcct 1140 gagaacaact acaagacaac ccctcctgtg ctggactccg acggctcctt ctttctgtat 1200 tcccgcctga ccgtggacaa gtctagatgg caagagggca acgtgttctc ctgctctgtg 1260 atgcacgagg ccctgcacaa ccactacacc cagaagtccc tgtctctgtc cctgggcaaa 1320 tgatag 1326 <210> 5 <211> 440 <212> PRT <213> Artificial Sequence <220> <223> Nivolumab‑heavy chain‑ protein sequence <400> 5 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile Thr Phe Ser Asn Ser 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Tyr Asp Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Asn Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 100 105 110 Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser 115 120 125 Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp 130 135 140 Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr 145 150 155 160 Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr 165 170 175 Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys 180 185 190 Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp 195 200 205 Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala 210 215 220 Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 225 230 235 240 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 245 250 255 Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val 260 265 270 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 275 280 285 Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin 290 295 300 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly 305 310 315 320 Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 325 330 335 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr 340 345 350 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 355 360 365 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 370 375 380 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 385 390 395 400 Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe 405 410 415 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 420 425 430 Ser Leu Ser Leu Ser Leu Gly Lys 435 440 <210> 6 <211> 648 <212> DNA <213> Artificial Sequence <220> <223> Nivolumab - Heavy Chain - DNA Sequence <400> 6 gagatcgtgc tgacccagtc tcctgccaca ttgtctctga gtcctggcga gagagctacc 60 ctgtcttgca gagcttccca gtccgtgtcc tcctacctgg cctggtatca gcagaaacct 120 ggacaggccc ctcggctgct gatctacgat gcctctaata gagccacagg catccccgcc 180 agattctctg gctctggatc tggcaccgac ttcaccctga ccatctctag cctggaacct 240 gaggacttcg ccgtgtacta ctgccagcag tcctccaact ggcctagaac ctttggccag 300 ggcaccaagg tggaaatcaa gagaaccgtg gctgcccctt ccgtgttcat cttcccacca 360 tctgacgagc agctgaagtc cggcacagct tctgtcgtgt gcctgctgaa caacttctac 420 cctcgggaag ccaaggtgca gtggaaggtg gacaatgccc tgcagtccgg caactcccaa 480 gagtctgtga ccgagcagga ctccaaggac tctacctaca gcctgtcctc cacactgacc 540 ctgtctaagg ccgactacga gaagcacaag gtgtacgcct gtgaagtgac ccaccaggga 600 ctgtctagcc ccgtgaccaa gtctttcaac agaggcgagt gctgatag 648 <210> 7 <211> 214 <212> PRT <213> Artificial Sequence <220> <223> Nivolumab‑light chain‑protein sequence <400> 7 Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro 65 70 75 80 Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210 <210> 8 <211> 1410 <212> DNA <213> Artificial Sequence <220> <223> Kozak - SP - Protein Heavy Chain - DNA <400> 8 tcggtcatgg ccctgctgca caagaacatg aagcacctgt ggttctttct gctgctggtg 60 gccgctccta gatgggtgtt gtctcaggtg cagctggttg aatctggtgg cggagtggtg 120 CAGCCTGGCAGATCTCTGAGACTGGATTCG AAGGCCTCCGGCATCACCTTCTCCA ACTCT 180 GGCATGCACCTGGGTCCGACAGGCCCCTGGAAGGACTGGAATGGGTCGCCGTGATTTGG 240 TACGACGGCTCTAAGCGGTACTACGCCGACTCCGTGAAGGGCAGATTCACCATCTCTCGG 300 GACAACGCCAAGAACACCCCTTTCTGCAGATGAACCTCCCTGAGAGCCGAGGACACCGCC 360 GTGTACTACTGTGCCACCAACGATGATTTATTGGGGCCAGGGCACACTGGTCACCCTGTCC 420 TCTGCTTCTACCAAGGGACCCCTGTGTTCCCTCTGGCTCCTTGCTCCAGATCCACCTCT 480 GAGTCTACCGCTGCTCTGGGCTGCCTGGTC AAGGATTACTTTCCCTGAGCCTGTGACCGTG 540 TCTTGGAACTCTGGTGCTCTGACCTCCGGCGTGCACACATTTCCAGCTGTGCTGCAGTCC 600 TCCGGCCTGTACTCTCTGTCCTCTGTCGTGACCCTGCCTTCTAGCTCTCTGGGCACCAAG 660 ACCTACACCTGTAACGTGGACCACAAGCCTTCCAACACC AAGGTGGACAAGCGCCTGGAA 720 TCTAAGTACGGCCCTCCTTGTCC TCCATGTCC TGCTCCAGAATTCC TCGGC GGACCTTCC 780 GTGTTCTCTGTTTCCTCCAAAGCCTAAGGACACCCTGATGATCTCTCGGACCCCTGAAGTG 840 acctgcgtgg tggtggatgt gtctcaagag gaccccgagg tgcagttcaa ttggtacgtg 900 gacggcgtgg aagtgcacaa cgccaagacc aagcctagag aggaacagtt caactccacc 960 tacagagtgg tgtccgtgct gaccgtgctg caccaggatt ggctgaacgg caaagagtac 1020 aagtgcaagg tgtccaacaa gggcctgcct tccagcatcg aaaagaccat ctccaaggct 1080 aagggccagc ctcgggaacc tcaggtttac accctgcctc caagccaaga ggaaatgacc 1140 aagaaccagg tgtccctgac ctgcctcgtg aagggattct acccttccga tatcgccgtg 1200 gaatgggagt ccaatggcca gcctgagaac aactacaaga caacccctcc tgtgctggac 1260 tccgacggct ccttctttct gtattcccgc ctgaccgtgg acaagtctag atggcaagag 1320 ggcaacgtgt tctcctgctc tgtgatgcac gaggccctgc acaaccacta cacccagaag 1380 tccctgtctc tgtccctggg caaatgatag 1410 <210> 9 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> Kozak - SP - Protein Light Chain - DNA <400> 9 tcggtcatgg ccctgctgca caagaacatg aagcacctgt ggttctttct gctgctggtg 60 gccgctccta gatgggtgct gtctgagatc gtgctgaccc agtctcctgc cacattgtct 120 ctgagtcctg gcgagagagc taccctgtct tgcagagctt cccagtccgt gtcctcctac 180 ctggcctggt atcagcagaa acctggacag gcccctcggc tgctgatcta cgatgcctct 240 aatagagcca caggcatccc cgccagattc tctggctctg gatctggcac cgacttcacc 300 ctgaccatct ctagcctgga acctgaggac ttcgccgtgt actactgcca gcagtcctcc 360 aactggccta gaacctttgg ccagggcacc aaggtggaaa tcaagagaac cgtggctgcc 420 ccttccgtgt tcatcttccc accatctgac gagcagctga agtccggcac agcttctgtc 480 gtgtgcctgc tgaacaactt ctaccctcgg gaagccaagg tgcagtggaa ggtggacaat 540 gccctgcagt ccggcaactc ccaagagtct gtgaccgagc aggactccaa ggactctacc 600 tacagcctgt cctccacact gaccctgtct aaggccgact acgagaagca caaggtgtac 660 gcctgtgaag tgacccacca gggactgtct agccccgtga ccaagtcttt caacagaggc 720 gagtgctgat ag 732 <210> 10 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> SP - Protein heavy chain - Protein <400> 10 Met Ala Leu Leu His Lys Asn Met Lys His Leu Trp Phe Phe Leu Leu 1 5 10 15 Leu Val Ala Ala Pro Arg Trp Val Leu Ser Gln Val Gln Leu Val Glu 20 25 30 Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser Leu Arg Leu Asp Cys 35 40 45 Lys Ala Ser Gly Ile Thr Phe Ser Asn Ser Gly Met His Trp Val Arg 50 55 60 Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Val Ile Trp Tyr Asp 65 70 75 80 Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile 85 90 95 Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe Leu Gln Met Asn Ser Leu 100 105 110 Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Thr Asn Asp Asp Tyr 115 120 125 Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser 145 150 155 160 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 Pro Ala Val Leu Gin Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val 210 215 220 Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys 225 230 235 240 Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly 245 250 255 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 260 265 270 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gin Glu 275 280 285 Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 290 295 300 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg 305 310 315 320 Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys 325 330 335 Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu 340 345 350 Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr 355 360 365 Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin Val Ser Leu 370 375 380 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 385 390 395 400 Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 405 410 415 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp 420 425 430 Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser Val Met His 435 440 445 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu 450 455 460 Gly Lys 465 <210> 11 <211> 240 <212> PRT <213> Artificial Sequence <220> <223> SP ‑ protein <400> 11 Met Ala Leu Leu His Lys Asn Met Lys His Leu Trp Phe Phe Leu Leu 1 5 10 15 Leu Val Ala Ala Pro Arg Trp Val Leu Ser Glu Ile Val Leu Thr Gln 20 25 30 Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser 35 40 45 Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala Trp Tyr Gln Gln 50 55 60 Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Asp Ala Ser Asn Arg 65 70 75 80 Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 85 90 95 Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr 100 105 110 Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg Thr Phe Gly Gln Gly Thr 115 120 125 Lys Val Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe 130 135 140 Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys 145 150 155 160 Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val 165 170 175 Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln 180 185 190 Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser 195 200 205 Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His 210 215 220 Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 240 <210> 12 <211> 1422 <212> DNA <213> Artificial Sequence <220> <223> Restriction sites - SP - Protein Heavy Chain - DNA <400> 12 ggtacctcgg tcatggccct gctgcacaag aacatgaagc acctgtggtt ctttctgctg 60 ctggtggccg ctcctagatg ggtgttgtct caggtgcagc tggttgaatc tggtggcgga 120 gtggtgcagc ctggcagatc tctgagactg gattgcaagg cctccggcat caccttctcc 180 aactctggca tgcactgggt ccgacaggcc cctggaaaag gactggaatg ggtcgccgtg 240 atttggtacg acggctctaa gcggtactac gccgactccg tgaagggcag attcaccatc 300 tctcgggaca actccaagaa caccctgttt ctgcagatga actccctgag agccgaggac 360 accgccgtgt actactgtgc caccaacgat gattattggg gccagggcac actggtcacc 420 gtgtcctctg cttctaccaa gggaccctct gtgttccctc tggctccttg ctccagatcc 480 acctctgagt ctaccgctgc tctgggctgc ctggtcaagg attactttcc tgagcctgtg 540 accgtgtctt ggaactctgg tgctctgacc tccggcgtgc acacatttcc agctgtgctg 600 cagtcctccg gcctgtactc tctgtcctct gtcgtgaccg tgccttctag ctctctgggc 660 accaagacct acacctgtaa cgtggaccac aagccttcca acaccaaggt ggacaagcgc 720 gtggaatcta agtacggccc tccttgtcct ccatgtcctg ctccagaatt cctcggcgga 780 ccttccgtgt tcctgtttcc tccaaagcct aaggacaccc tgatgatctc tcggacccct 840 gaagtgacct gcgtggtggt ggatgtgtct caagaggacc ccgaggtgca gttcaattgg 900 tacgtggacg gcgtggaagt gcacaacgcc aagaccaagc ctagagagga acagttcaac 960 tccacctaca gagtggtgtc cgtgctgacc gtgctgcacc aggattggct gaacggcaaa 1020 gagtacaagt gcaaggtgtc caacaagggc ctgccttcca gcatcgaaaa gaccatctcc 1080 aaggctaagg gccagcctcg ggaacctcag gtttacaccc tgcctccaag ccaagaggaa 1140 atgaccaaga accaggtgtc cctgacctgc ctcgtgaagg gattctaccc ttccgatatc 1200 gccgtggaat gggagtccaa tggccagcct gagaacaact acaagacaac ccctcctgtg 1260 ctggactccg acggctcctt ctttctgtat tcccgcctga ccgtggacaa gtctagatgg 1320 caagagggca acgtgttctc ctgctctgtg atgcacgagg ccctgcacaa ccactacacc 1380 cagaagtccc tgtctctgtc cctgggcaaa tgatagaagc tt 1422 <210> 13 <211> 744 <212> DNA <213> Artificial Sequence <220> <223> Restriction Site - SP - Light Chain - DNA <400> 13 ggatcctcgg tcatggccct gctgcacaag aacatgaagc acctgtggtt ctttctgctg 60 ctggtggccg ctcctagatg ggtgctgtct gagatcgtgc tgacccagtc tcctgccaca 120 ttgtctctga gtcctggcga gagagctacc ctgtcttgca gagcttccca gtccgtgtcc 180 tcctacctgg cctggtatca gcagaaacct ggacaggccc ctcggctgct gatctacgat 240[[ID=2,3]] gcctctaata gagccacagg catccccgcc agattctctg gctctggatc tggcaccgac 300 ttcaccctga ccatctctag cctggaacct gaggacttcg ccgtgtacta ctgccagcag 360 tcctccaact ggcctagaac ctttggccag ggcaccaagg tggaaatcaa gagaaccgtg 420 gctgcccctt ccgtgttcat cttcccacca tctgacgagc agctgaagtc cggcacagct 480 tctgtcgtgt gcctgctgaa caacttctac cctcgggaag ccaaggtgca gtggaaggtg 540 gacaatgccc tgcagtccgg caactcccaa gagtctgtga ccgagcagga ctccaaggac 600 tctacctaca gcctgtcctc cacactgacc ctgtctaagg ccgactacga gaagcacaag 660 gtgtacgcct gtgaagtgac ccaccaggga ctgtctagcc ccgtgaccaa gtctttcaac 720 agaggcgagt gctgatagct cgag 744 <210> 14 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> TIS RNA <400> 14 ucggucaugg c 11

Claims

1. A DNA construct for expressing nivolumab in a mammalian cell, wherein, The DNA construct comprises: - a nucleic acid sequence as depicted in SEQ ID No 1, wherein the nucleic acid sequence as depicted in SEQ ID No 1 is a TIS sequence; - a nucleic acid sequence encoding a signal peptide, wherein the nucleic acid sequence encoding a signal peptide is a nucleic acid sequence as depicted in SEQ ID No 2; and - a nucleic acid sequence encoding the nivolumab, and wherein the nucleic acid sequence encoding the nivolumab comprises: - a first nucleic acid sequence encoding a heavy chain of nivolumab; and - a second nucleic acid sequence encoding a light chain of nivolumab; and wherein the nucleic acid sequence encoding a signal peptide is operably linked to: - the first nucleic acid sequence encoding a heavy chain of nivolumab; and - the second nucleic acid sequence encoding a light chain of nivolumab, and wherein the nucleic acid sequence as depicted in SEQ ID No 1 comprises: - an ATG start codon in SEQ ID No 2; and - the first two nucleotides downstream of the ATG start codon in the nucleic acid sequence as depicted in SEQ ID No 2.

2. The DNA construct of claim 1, wherein, The TIS sequence is transcribed into an RNA motif that acts as a protein translation initiation site in an mRNA transcript.

3. The DNA construct of claim 1 or 2, wherein, The TIS sequence is a Kozak sequence that is transcribed into an RNA motif that acts as a protein translation initiation site in an mRNA transcript.

4. The DNA construct of claim 1 or 2, wherein, The first and second nucleic acid sequences encoding a heavy chain and a light chain of nivolumab respectively encode an amino acid sequence as depicted in SEQ ID No 5 and SEQ ID No 7.

5. The DNA construct of claim 1 or 2, wherein, The first and second nucleic acid sequences encoding a heavy chain and a light chain of nivolumab respectively are nucleic acid sequences as depicted in SEQ ID No 4 and SEQ ID No 6.

6. An expression vector comprising the DNA construct of any one of claims 1 to 5.

7. An expression cassette comprising the DNA construct of any one of claims 1 to 5.

8. A host cell comprising the DNA construct of any one of claims 1 to 5, wherein, The host cell is a mammalian cell.

9. The host cell of claim 8, wherein, The host cell is a CHO cell.

10. The host cell of claim 9, wherein, The host cell is a CHO-DG44 cell or a CHO GS cell.

11. A method of expressing nivolumab, the method comprising the steps of: transfecting the resulting nucleic acid sequence of one or more DNA constructs of any one of claims 1 to 5 into a mammalian host cell, the method being a method for non-disease treatment or diagnostic purposes.

12. The method of claim 11, wherein, The host cell is a CHO cell.

13. The method of claim 12, wherein, The host cell is a CHO-DG44 cell or a CHO GS cell.

14. The method of any one of claims 11 to 13, further comprising the step of integrating the transfected nucleic acid sequence into the genome of the host cell.

Images