A CRISPR / Cas9 vector for improving the gene editing efficiency of eggplant

Abstract

The present invention relates to a CRISPR / Cas9 vector for improving the gene editing efficiency of eggplants, belonging to the field of biotechnology. The present invention constructs a CRISPR / Cas9 vector capable of highly expressing sgRNA, and establishes a set of CRISPR / Cas9 systems for improving the gene editing efficiency of eggplants. Compared with the existing eggplant editing vectors, the gene editing vector constructed in the present invention can more efficiently perform directional editing on eggplant genes and can be applied in eggplant breeding improvement and gene function research.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a CRISPR / Cas9 vector for improving the gene editing efficiency of eggplant. Background Art

[0002] Eggplant is one of the main solanaceous vegetables in China. With the continuous improvement of cultivation facilities and techniques, the existing eggplant varieties can no longer meet the needs of people, and it is urgent to specifically create new eggplant germplasms. Traditional cross-breeding and modern molecular breeding methods cannot quickly achieve the genetic improvement of eggplant due to disadvantages such as long breeding cycles.

[0003] As an important means for gene function research and precise molecular breeding, the CRISPR / Cas9 gene editing technology has received increasing attention. This technology has multiple advantages such as simple operation, wide recognition of target sites, flexibility and high efficiency, and the ability to edit multiple target sites simultaneously. U6 RNA is a small non-coding RNA, and the corresponding U6 promoter-driven transcription of sgRNA is one of the prerequisites for the successful editing of the CRISPR / Cas9 system, that is, the transcriptional activity of the U6 promoter directly affects the expression of sgRNA, thereby affecting the gene editing efficiency. Currently, U6 promoters of multiple species have been applied in the CRISPR / Cas9 system. Research shows that the same U6 promoter is not applicable to all species, especially in species with a relatively distant genetic relationship, where the editing efficiency is low or even directly inapplicable. So far, there has been no research report on the U6 promoter applicable to eggplant.

[0004] Therefore, the present invention clones the endogenous U6 promoter of eggplant with high transcriptional activity and constructs the corresponding CRISPR / Cas9 editing vector, thereby establishing an efficient CRISPR / Cas9 gene editing system for eggplant, which has important value for the gene function research and genetic breeding of eggplant. Summary of the Invention

[0005] In view of the above problems, the present invention explores the technology of implementing site-directed editing of eggplant using a gene editing system specific to the eggplant U6 promoter, and provides a CRISPR / Cas9 vector for improving the gene editing efficiency of eggplant.

[0006] Technical Solution

[0007] The present invention provides a CRISPR / Cas9 vector for improving the gene editing efficiency of eggplant, including the following steps: using the SmU6-1 promoter with high transcriptional activity to drive the expression of sgRNA, and obtaining the recombinant vector pSmP1C for editing eggplant genes; the SmU6-1 promoter sequence is as shown in SEQ ID NO:1.

[0008] The expression of sgRNA driven by the SmU6-1 promoter was achieved by amplifying the SmU6-1 promoter and then performing double digestion with EcoRI and XbaI on the promoter and the backbone vector pP1C.4 respectively. The digested promoter fragment and vector fragment were ligated to obtain the new recombinant vector pSmP1C.

[0009] For the amplification of the eggplant SmU6-1 promoter, EcoRI and XbaI linkers were added to both ends of the cloned SmU6-1 promoter, and the primers were:

[0010] F2: 5’_CGGAATTCGACAACATCTGCCATTGGA_3’

[0011] R2: 5’_GCTCTAGAGAACTCATTACTTCGCTAGG_3’

[0012] In the CRISPR / Cas9-mediated eggplant gene editing vector, the SmU6-1 promoter can efficiently initiate the transcription of gRNA, and it is the eggplant U6 promoter with high transcriptional activity identified in the present invention.

[0013] The SmU6-1 promoter with high transcriptional activity was used to construct the SmU6::GUS vector, detect the transcriptional activity of the U6 promoter, and screen out the U6-1 promoter with high transcriptional activity.

[0014] Beneficial Effects

[0015] The present invention provides an eggplant U6 promoter for transcribing gRNA. This promoter is the promoter of the homologous gene of the Arabidopsis U6 gene obtained from the eggplant genome and can efficiently initiate the transcription of gRNA. The present invention provides a gene editing tool that can perform gene editing on eggplant and has a higher editing efficiency compared with the Arabidopsis U6-1 promoter. Description of the Drawings

[0016] Figure 1 It is a schematic diagram of the pSmP1C vector;

[0017] Figure 2 It is a schematic diagram of the backbone vector pP1C.4;

[0018] Figure 3 It is an electrophoresis diagram of the PCR amplification of the eggplant U6 gene promoter;

[0019] Figure 4 It is the first-generation sequencing diagram of the WRKY4 gene in the example; Detailed Embodiments

[0020] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described below in conjunction with specific embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0021] S1. Cloning of the eggplant U6 promoter, which includes the following steps:

[0022] S1-1. The present invention uses the Arabidopsis U6 RNA sequence to search for U6 RNA in the eggplant genome and finds its corresponding U6 promoter, and designs specific primers, and the primer sequences are: SEQ ID NO:2-SEQ ID NO:11.

[0023] S1-2. Prepare the reaction system for PCR amplification and complete the amplification of the U6 promoter according to the preset reaction procedure: Specifically, the total volume of the PCR reaction system is 50 μl, and the specific composition is as follows: Max DNA Polymerase (TaKaRa) 25 μl, 2 μl each of the upstream and downstream primers (10 μM), 3 μl of DNA template, and 18 μl of ddH2O. The PCR reaction procedure is: pre-denaturation at 98 °C for 3 min; denaturation at 98 °C for 10 s; annealing at 56 °C for 10 s; extension at 72 °C for 10 s; a total of 35 cycles; finally, extension at 72 °C for 5 min; store at 4 °C.

[0024] S2. Identification of the transcriptional activity of the eggplant U6 promoter, which includes the following steps:

[0025] S2-1. Use primers with linker enzyme cleavage sites to amplify the U6 promoter fragment and purify it. The primer sequences are as SEQ ID NO:2-SEQ ID NO:11; perform PCR amplification with reference to S1-2.

[0026] S2-2. Perform double enzyme cleavage of the amplified fragment and the vector 35S::GUS with HindIII and BamHI. The specific enzyme cleavage system is as follows: 1.5 μl each of HindIII and BamHI, 5 μl of 10×FastDigest Buffer, 2 μg of the PCR product and the vector plasmid, and add water to 50 μl. Enzyme cleavage conditions: react at 37 °C for 2 hours, and recover the enzyme cleavage product.

[0027] S2-3. After ligating the enzyme cleavage products, perform colony PCR detection and sequencing using SEQ ID NO:2-SEQ ID NO:11. The sequencing primer is SEQ ID NO:12, and thus SmU6-1::GUS-SmU6-5::GUS is obtained. The specific ligation system is as follows: Mix the fragment and the vector enzyme cleavage products at a molar ratio of 5:1, add 1 μl of T4 ligase and 1 μl of ligase buffer, and incubate overnight at 16 °C.

[0028] S2-4. Use electroporation to transfer the constructed SmU6::GUS fusion vector into Agrobacterium tumefaciens GV3101, and perform colony PCR identification using SEQ ID NO:2 - SEQ ID NO:11 to obtain the bacterial solution containing the fusion vector.

[0029] S2-5. Inject the bacterial solution into tobacco using a syringe, sample after co-culturing for 24 h. Place the sample in GUS staining solution and shake for staining for 12 h.

[0030] S2-6. Decolorize the stained leaves with 75% ethanol, change the decolorizing solution every 3 - 4 h until the green color of the leaves completely fades. Screen for the highly transcribed promoter SmU6-1 according to the leaf staining situation.

[0031] S3. Replace the AtU6 promoter in pP1C.4

[0032] S3-1. Amplify the SmU6-1 promoter. Specifically, use primers with restriction enzyme sites as adapters to amplify the U6 promoter fragment and purify it. The primer sequences are: SEQ ID NO:13 and SEQ ID NO:14; perform PCR amplification with reference to S1-2.

[0033] S3-2. Perform double digestion of the amplified fragment and the vector pP1C.4 with EcoRI and XbaI. The specific digestion system is as follows: 1.5 μl of EcoRI and XbaI each, 5 μl of 10×FastDigest Buffer, 2 μg of PCR product and vector plasmid, add water to 50 μl. Digestion conditions: React at 37°C for 2 hours, and recover the digested product.

[0034] S3-3. Perform colony PCR and sequencing on the ligated product of the digested product. The sequencing primer is SEQ ID NO:15, and screen to obtain the editing vector pSmP1C.

[0035] S4. Design primers for the SmWRKY4 target site

[0036] S4-1. According to the target site design principle of the CRISRP / Cas9 technology, select the gRNA target site in the first exon of the SmWRKY4 gene. The sequence is: 5’-CAGCTCCAAATCAGCCGTAC-3’.

[0037] S4-2. Design primers for amplifying the sgRNA cloning box driven by the Arabidopsis thaliana U6 promoter for the target site sequence as: SEQ ID NO:16 and SEQ ID NO:17.

[0038] S4-3. Design primers for amplifying the sgRNA cloning cassette that drives the expression of sgRNA with the SmU6-1 promoter according to the target site sequence as: SEQ ID NO:18 and SEQ ID NO:19.

[0039] S5. Using a high-fidelity DNA polymerase, with the pSmP1C vector as the template, SEQ ID NO:16 and SEQ ID NO:17 as primers, perform PCR amplification to obtain the cloning cassette of sgRNA containing the AtU6 promoter and the SmWRKY4 target site.

[0040] S6. Using a high-fidelity DNA polymerase, with the pSmP1C vector as the template, SEQ ID NO:18 and SEQ ID NO:19 as primers, perform PCR amplification to obtain the cloning cassette of sgRNA containing the SmU6-1 promoter and the SmWRKY4 target site.

[0041] S7. After purifying the two sgRNA cloning cassette products, perform double digestion of the products and pSmP1C with EcoRI and XbaI. After gel electrophoresis, cut the gel to recover the digested products.

[0042] S8. Use a recombinase to recombine the linearized vector and the recovered sgRNA cloning cassette fragment, perform colony PCR detection and send for sequencing. The primer used for sequencing is SEQ ID NO:15 to obtain the vectors pP1C.4-SmWRKY4 and pSmP1C-SmWRKY4 targeting the SmWRKY4 gene.

[0043] S9. Use the electrotransformation method to transform pP1C.4-SmWRKY4 and pSmP1C-SmWRKY4 into the competent cells of the Agrobacterium strain EHA105 respectively, and perform screening and identification.

[0044] S10. On the ultra-clean workbench, first soak the eggplant seeds in 75% ethanol for 30 s, then disinfect them with 10% NaClO for 20 min, and rinse the seeds 5 times with sterile water to ensure that the residual disinfectant is washed away. Inoculate the eggplant seeds in the 1 / 2MS medium and culture them in the dark at 28 °C until germination, then transfer them to light culture.

[0045] S11. Ten days after seed germination, when the cotyledons are fully expanded, use a blade to cut the cotyledons into explant segments of 4 mm × 4 mm, place the cotyledons face up in the co-culture medium and pre-culture for 1 d.

[0046] S12. Streak the Agrobacterium containing the editing vector on the YEP medium containing antibiotics, pick a single colony and inoculate it into the YEP liquid medium containing antibiotics, and culture it overnight at 28 °C and 200 r / min until OD 600It was 1.0. Centrifuge at 4000 r / min for 10 min, pour out the supernatant, and add liquid medium containing 200 μM acetosyringone for resuspension until OD 600 was 0.2 - 0.3.

[0047] S13. Immerse the explants in the suspension, gently shake the culture dish, and infect in the dark for 5 min. After the bacterial liquid remaining on the surface of the explants is blotted dry, place the explants with the back side up on the co-culture medium and co-culture in the dark for 2 d.

[0048] S14. After co-culturing for 2 d, transfer the explants onto the callus induction medium to induce callus.

[0049] S15. After 2 weeks, transfer the callus onto the bud induction medium for bud induction until the buds grow to 1 cm, cut the buds and place them in the RMS medium for rooting. Subculture is carried out once every 2 weeks during bud induction. Finally, 17 regenerated plants driven by eggplant U6-driven sgRNA and 18 regenerated plants driven by Arabidopsis U6 promoter-driven sgRNA are obtained.

[0050] S16. Extract the genomic DNA of the regenerated plants by the CTAB method for PCR verification and sequencing; the specific steps are as follows: perform PCR reaction using the detection primers Cas9-F: 5’_AAGCCCATCAGAGAGCAGG_3’ and Cas9-R: 5’_TGTCGCCTCCCAGCTGAG_3’ of Cas9, reaction system: 10 μl of PCR mix, 1 μl of each primer, 1 μl of DNA, 7 μl of ddH2O; reaction program: 94 °C for 3 min; 94 °C for 30 s, 56 °C for 30 s, 72 °C for 20 s, 28 cycles; extend at 72 °C for 5 min and store at 4 °C; finally, 15 positive regenerated plants driven by eggplant U6-driven sgRNA and 14 positive regenerated plants driven by Arabidopsis U6 promoter-driven sgRNA are obtained.

[0051] S17. Primers SmWRKY4-F: 5’_CGGCATTGAACAGTACCAGA_3’ and SmWRKY4-R: 5’_CCAGATGTCAGCCTCCATTT_3’ were designed respectively upstream and downstream of the target site, and PCR reaction was carried out. The reaction system and procedure were the same as those in S1-2. After purifying the PCR products, they were sent for sequencing. The sequencing results showed that among the positive regenerated plants driven by eggplant U6 to express sgRNA, 4 plants were gene-edited plants, so the editing efficiency was 27%. Among the positive regenerated plants driven by Arabidopsis U6 promoter to express sgRNA, 3 plants were gene-edited plants, and the editing efficiency was 21%. As shown in the partial sequencing results, it was found through analysis that in the mutant lines 1# and 2# driven by eggplant U6 to express sgRNA, there were 1bp base deletion and 2bp base deletion respectively, the line 3# had 1bp insertion, and the line 4 had both deletion and substitution. This result indicates that compared with the Arabidopsis U6 promoter, the endogenous U6 promoter of eggplant can drive sgRNA more efficiently, thus obtaining more plants with site-directed mutations at the gRNA target sites. The above description is only a specific implementation case of this invention patent, but any changes or modifications made by referring to this invention patent application are covered by the patent scope of this invention.

Claims

1. A CRISPR / Cas9 vector for improving the gene editing efficiency of eggplant, characterized in that, The SmU6-1 promoter drives the expression of sgRNA, wherein the sequence of the SmU6-1 promoter is as shown in SEQ ID NO:

1.

2. The CRISPR / Cas9 vector according to claim 1, wherein The steps for constructing the CRISPR / Cas9 vector are as follows: Using the pP1C.4 vector as the backbone, replace the Arabidopsis thaliana U6 promoter in pP1C.4 with the SmU6-1 promoter to obtain the CRISPR / Cas9 vector, named pSmP1C. The SmU6-1 is a sequence obtained by recloning the promoter sequence of the Solanum melongena U6-1 gene homologous to the Arabidopsis thaliana U6 gene. The primer sequences in the cloning process are: F1: 5’_GACAACATCTGCCATTGGA_3’ R1: 5’_GAACTCATTACTTCGCTAGG_3.

3. The CRISPR / Cas9 vector according to claim 2, wherein To replace the Arabidopsis thaliana U6 promoter in pP1C.4 with the SmU6-1 promoter, the specific steps are to amplify the SmU6-1 promoter, then perform EcoRI and XbaI digestion on the amplification product and the pP1C.4 vector respectively, and ligate the digestion products to obtain the editing vector pSmP1C; The amplification primers for the SmU6-1 promoter: F2: 5’_CGgaattcGACAACATCTGCCATTGGA_3’ R2: 5’_GCtctagaGAACTCATTACTTCGCTAGG_3’.

4. The application of the CRISPR / Cas9 vector for improving the gene editing efficiency of Solanum melongena as claimed in claim 1 in gene editing of Solanum melongena.

Images