Multiplex KASP Marker Primer Set for Major Genes Controlling Wheat Kernel Hardness and Its Application

Abstract

The present application discloses a multiplex KASP marker primer set for major genes of wheat grain hardness and its application. The primer set consists of primer F3 with a nucleotide sequence as shown in SEQ ID NO.3, primer F4 with a nucleotide sequence as shown in SEQ ID NO.4, and universal primer R1 with a nucleotide sequence as shown in SEQ ID NO.5. By using this primer set for multiplex PCR detection, the Pina-D1 and Pinb-D1 genes in wheat samples can be detected simultaneously. Compared with ordinary KASP marker detection, the efficiency is doubled while the cost is reduced by half, which is beneficial for large-scale breeding screening.

Description

Technical Field

[0001] The present application relates to the field of wheat breeding, and in particular to a KASP marker related to wheat grain hardness and its application. Background Art

[0002] Grain hardness is an important indicator for wheat quality evaluation. It can reflect the texture of wheat endosperm and not only affects the wheat milling process, but also has a great influence on the amount of water added to the wheat, flour yield, flour particle size, the number of damaged starch granules and food processing quality. It is also an important factor affecting wheat classification and pricing at home and abroad (Wang Lekai, Zhao Naixin, Gao Chunxia. "Introduction to the main quality indicators of wheat and their usage", Journal of Wheat Crops, 2003, 23(1):1; Chen Feng, Li Genying, Geng Hongwei, Xia Lanqin, Xia Xianchun, He Zhonghu, "Review and Prospect of Research on Wheat Grain Hardness and Its Molecular Genetic Basis", Chinese Agricultural Science, 2005, 38(6):1088-1094). Proindoline a (Pina-D1) and Puroindoline b (Pinb-D1), located on wheat chromosome 5DS, are the major genes controlling grain hardness reported in existing reports. When both Pina-D1 and Pinb-D1 are wild-type (Pina-D1a / Pinb-D1a), the grains are soft; when either subunit is missing or mutated, the grains become hard (Hu Wenjing, Wu Hongya, Dong Yachao, Wu Di, Gao Derong. "Analysis of the distribution characteristics of hardness genes in wheat varieties (lines) in Jiangsu Province", Journal of Yangzhou University, 2020, 41, DOI: 10.16872 / j.cnki.1671-4652.2020.06.005).

[0003] Molecular marker-assisted selection (MAS) allows for targeted selection of traits at the DNA level, resulting in stable results and enabling selection at the seedling stage, reducing the cost of phenotypic evaluation and improving wheat breeding efficiency. The STS markers Pina-D1 and Pinb-D1 have been previously reported (Giroux, M., Morris, CA. "Glycine to serine change in puroindolineb is associated with wheat grain hardness and low levels of starch-surface friabilin." Theoretical and Applied Genetics, 1997, 95, 857-864). However, existing markers offer low screening efficiency. STS markers based on conventional PCR amplification and electrophoresis techniques can only test a maximum of 96 samples per run, with a daily throughput of only a few hundred samples, which is insufficient for large-scale breeding screening.

[0004] KASP (Kompetitive Allele Specific PCR) labeling technology is based on the specific matching of primer terminal bases to SNP typing, which can accurately determine the double allele of SNP sites. It has the characteristics of low cost and high throughput. Its single amplification throughput is more than 10,000 copies, and no electrophoresis amplification is required. The detection results can be directly obtained through fluorescence typing. It is particularly suitable for molecular marker detection of a large number of samples, which is consistent with breeding selection and has broad application prospects in breeding. Rasheed et al. successfully developed KASP markers for Pina-D1 and Pinb-D1 (RASHEED A, WENW, GAO F, ZHAI S, JIN H, LIU J, GUO Q, ZHANG Y, DREISIGACKER S, XIA X. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics, 2016, 129(10): 1-18), and has been widely used in wheat material screening (Hu Wenjing, Wu Hongya, Dong Yachao, Wu Di, Gao Derong. Analysis of the distribution characteristics of hardness genes in wheat varieties (lines) in Jiangsu Province. Journal of Yangzhou University, 2020, 41, DOI: 10.16872 / j.cnki.1671-4652.2020.06.005; Wang Junchan, Wu Xujiang, Hu Wenjing, Zhang Xiao, Zhang Yong, Gao Derong, Bie Tongde, Zhang Boqiao. KASP detection of functional genes of important traits in Yangmai series varieties (lines). Journal of Jiangsu Agricultural Sciences, 2019, 35(6): 1271-1283).

[0005] Multiplex PCR can identify multiple gene loci simultaneously in a single reaction system, significantly saving time and reagents and making it more suitable for large-scale screening during breeding (Xu Likui, Pan Binrong, Yue Gaohong, Mei Xixue, Liu Yongan, Zhang Zongchen, Zhou Zhihui. Multiplex PCR molecular identification technology for powdery mildew-resistant glutinous wheat [J]. Journal of Nuclear Agricultural Sciences, 2014, 28:1203-1207). Currently, multiplex PCR markers are mostly based on conventional PCR systems, while multiplex PCR markers using the KASP marker system have not yet been reported. Summary of the Invention

[0006] To address the above issues, the present application provides a set of multiple KASP marker primer sets for major wheat grain hardness genes and their applications, and simultaneously completes the identification of the two genes Pina-D1 and Pinb-D1, thereby improving the existing detection efficiency.

[0007] Specifically, this application is implemented through the following technical solutions:

[0008] First, the present application provides a set of multiple KASP marker primer sets for wheat grain hardness major effect genes, which consists of primer F3 with a nucleotide sequence as shown in SEQ ID NO.3, primer F4 with a nucleotide sequence as shown in SEQ ID NO.4, and universal primer R1 with a nucleotide sequence as shown in SEQ ID NO.5.

[0009] Secondly, the present application provides the application of the above-mentioned multiple KASP marker primers in the simultaneous detection of Pina-D1 and Pinb-D1 genes. That is, a wheat sample is PCR amplified using a multiple KASP marker primer set consisting of primers F3, F4, and R1, and then the amplified product is subjected to fluorescence detection; if the fluorescence detection result is type A (blue), it indicates that the genotype of the sample wheat is Pina-D1a / Pinb-D1b (i.e., it contains both Pina-D1a and Pinb-D1b allelic variants); if the fluorescence detection result is type B (red), it indicates that the genotype of the sample wheat is Pina-D1b / Pinb-D1a (i.e., it contains both Pina-D1a and Pinb-D1b allelic variants). If the fluorescence detection result is type C (green), it means that the genotype of the sample wheat is Pina-D1a / Pinb-D1a (i.e., it contains both Pina-D1a and Pinb-D1a allelic variations). If the fluorescence detection result is type D (black), it means that the genotype of the sample wheat is Pina-D1b / Pinb-D1b (i.e., it contains both Pina-D1b and Pinb-D1a allelic variations) or blank.

[0010] The PCR amplification refers to: the total PCR reaction system is 5 μL, including 2×KASP Master Mix 2.5 μL, KASPAssay Mix 0.07 μL, and wheat template DNA 2.43 μL with a concentration of 20 ng / μL;

[0011] Each 100 μL of the KASP Assay Mix includes: 12 μL of primer F3 with a concentration of 100 μM, 12 μL of primer F4 with a concentration of 100 μM, and 30 μL of primer R1 with a concentration of 100 μM, with the remainder being made up with ddH 2 O.

[0012] The PCR reaction program was as follows: 94°C for 15 min; 94°C for 20 s, 61-55°C for 1 min, decreasing by 0.6°C each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 26 cycles;

[0013] The nucleotide sequence of the primer F3 is shown in SEQ ID NO.3, the nucleotide sequence of the primer F4 is shown in SEQ ID NO.4, and the nucleotide sequence of the primer R1 is shown in SEQ ID NO.5.

[0014] The KASP marker primer set in this application is applicable to all varieties of wheat.

[0015] The KASP marker consists of two forward-specific primers and one reverse universal primer. The two forward-specific primers specifically bind to the target sequence for amplification, thereby enabling genotyping. Pina-D1 and Pinb-D1 share 70.2% sequence homology. The applicant designed forward-specific primers at the divergent sequences and a universal primer at the homologous sequences. This allows for simultaneous identification of both genes in a single PCR reaction. Compared to conventional KASP marker testing, this method doubles efficiency while halving the cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Develop schematics for primers;

[0017] Figure 2 is the primer evaluation result;

[0018] Figure 3 To mark the detection results of Pin1 and Pin2;

[0019] Figure 4 These are the test results of 360 high-generation lines. DETAILED DESCRIPTION

[0020] The sources of the experimental materials involved in the following examples are:

[0021] The 22 wheat varieties, including Ningmai 9 (Pina-D1a / Pinb-D1a), Ningmai 23 (Pina-D1b / Pinb-D1a), and Yangmai 158 (Pina-D1a / Pinb-D1b), are all conventional wheat varieties (see the document "Wang Huadun, Gao Chunlei, Zhang Peng, Zhang Yu, Zhang Pingping, Ma Hongxiang. Molecular detection of grain hardness and puroindoline gene allelic variation in wheat varieties in the middle and lower reaches of the Yangtze River [J]. Journal of Triticeae Crops, 2017, 37: 438-444"). The specific wheat names involved in the examples are shown in Table 1. Some materials are set up in duplicate. 360 high-generation lines are from the field selection nursery of the Academy of Agricultural Sciences (F5 generation). These materials are all obtained by hybridizing existing bred varieties or lines and through continuous multi-generation field selection. Their sources are detailed in Table 3. All materials in the following examples are preserved and provided by the wheat genetics and breeding team of the Jiangsu Academy of Agricultural Sciences.

[0022] Table 1 Biomaterial information

[0023]

[0024]

[0025] The seeds of all the test materials in Table 1 were germinated at room temperature for about 7 days, and young leaves were cut. Genomic DNA was extracted using the conventional CTAB method (this extraction method is a conventional method. The extraction method used in this example is described in the literature "Porebski S, Bailey L, Baum B. Modification of CTAB DNA Extraction Protocol for Plants Containing High Polysaccharide and Polyphenol Components. Plant Molecular Biology Reporter, 1997, 15: 8-15").

[0026] The diagnostic markers of the major genes for grain hardness, Pina-D1 and Pinb-D1, were synthesized based on the report of RASHEED et al. (see the document “RASHEED A, WEN W, GAO F, ZHAI S, JIN H, LIU J, GUO Q, ZHANG Y, DREISIGACKER S, XIAX. Development and validation of KASP assays for genes underpinning keyeconomic traits in bread wheat. Theoretical and Applied Genetics, 2016, 129(10): 1-18”).

[0027] The gene sequences for Pina-D1a (DQ363911), Pinb-D1a (DQ363913), and Pinb-D1b (DQ363914) were obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). Pina-D1a gene deletion is considered a Pina-D1b phenotype. Sequence alignment was performed, and specific primers of approximately 20 bp in length were selected at the differential SNP site. Universal primers of approximately 20 bp in length were selected in the homologous sequence region. If the homologous sequence regions of the two genes were not completely identical, degenerate bases were used. Finally, the designed primers were evaluated using Primer 6.0 software.

[0028] The KASP labeling system consists of two specific primers (F1 / F2) and one universal primer (R). The specific sequence GAAGGTGACCAAGTTCATGCT, which binds to FAM fluorescence, was added to the front end of F1 (SEQ ID NO. 1), resulting in primer F3 (SEQ ID NO. 3). The specific sequence GAAGGTCGGAGTCAACGGATT, which binds to HEX fluorescence, was added to the front end of F2 (SEQ ID NO. 2), resulting in primer F4 (SEQ ID NO. 4). Both primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0029] The total KASP (PCR) reaction system was 5 μL, including 2× KASP Master Mix 2.5 μL (LGC Biosearch Technologies), KASP Assay Mix 0.07 μL, and 2.43 μL of template DNA at a concentration of 20 ng / μL;

[0030] Each 100 μL of the KASP Assay Mix includes: 12 μL of primer F3 at a concentration of 100 μM, 12 μL of primer F4 at a concentration of 100 μM, and 30 μL of universal primer R (ie, primer R1 or primer R2) at a concentration of 100 μM, with the remainder being supplemented with ddH 2 O.

[0031] The KASP Assay Mix (KASP) PCR reaction program was: 94°C for 15 min; 94°C for 20 s, 61-55°C for 1 min, with a 0.6°C decrease between cycles, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 26 cycles. PCR results were analyzed using a KASP fluorescence analyzer (LGC, model PHERAstar plus).

[0032] Primer sequences involved in the embodiment:

[0033] Primer F3 (SEQ ID NO.3): GAAGGTGACCAAGTTCATGCTTGACAACCTCCCTTCCACCA;

[0034] Primer F4 (SEQ ID NO. 4): GAAGGTCGGAGTCAACGGATTTCATGCTCACAGCCGCC.

[0035] Example 1 Development and Validation of Multiple KASP Labeling with Pina-D1 and Pinb-D1

[0036] 1. Development of Multiple KASP Labeling for Pina-D1 and Pinb-D1

[0037] The AlignX function module of Vector NTI software was used to align the sequences of Pina-D1a, Pina-D1b, Pinb-D1a, and Pinb-D1b. Pina-D1a and Pina-D1b were not different, so the primer was designed based on Pina-D1a. There was one base difference between Pinb-D1a and Pinb-D1b. A sequence of about 20 bp in length was artificially selected near this differential base as the specific primer F2 (SEQ ID NO. 2) for Pinb-D1a. Furthermore, a sequence of about 20 bp in length was selected from the region near F2 where the sequence differences between Pinb-D1a and Pinb-D1a were large as the specific primer F1 (SEQ ID NO. 2) for Pina-D1a. A sequence of about 20 bp in length was selected from the homologous sequence region as the development universal primer R, and two universal primers R1 and R2 (as shown in FIG. Figure 1 The homologous sequence regions of Pinb-D1a and Pinb-D1a genes are not completely identical, and degenerate bases are used in the differences. Primer 6.0 software was used for primer evaluation (the evaluation results are shown in Figure 2 After multiple rounds of sequence position and length adjustment, two KASP marker primer sequences Pin1 and Pin2 were finally determined (Table 2).

[0038] Table 2 Pin1 and Pin2 primer sequences

[0039]

[0040]

[0041] Two newly developed markers (Pin1 and Pin2) were used to perform genotyping on 22 accessions (some of which were replicated). PCR amplification was performed using primers labeled Pin1 and Pin2, respectively, and the PCR results were scanned and analyzed using a KASP fluorescence analyzer (LGC model: PHERAstar plus).

[0042] PCR reaction system (5 μL): 2× KASP Master Mix 2.5 μL (LGC Biosearch Technologies), KASP Assay Mix 0.07 μL, and wheat template DNA 2.43 μL at a concentration of 20 ng / μL;

[0043] The PCR reaction program was as follows: 94°C for 15 min; 94°C for 20 s, 61-55°C for 1 min, with the temperature decreasing by 0.6°C each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 26 cycles.

[0044] The KASP Assay Mix for labeling Pin1 was prepared as follows: per 100 μL of KASP Assay Mix, 12 μL of 100 μM primer F3 (SEQ ID NO. 3), 12 μL of 100 μM primer F4 (SEQ ID NO. 4), and 30 μL of 100 μM primer R1 (SEQ ID NO. 5), with the remainder made up with ddH2O.

[0045] The KASP AssayMix for labeling Pin2 was prepared as follows: per 100 μL of KASP AssayMix, 12 μL of 100 μM primer F3 (SEQ ID NO. 3), 12 μL of 100 μM primer F4 (SEQ ID NO. 4), and 30 μL of 100 μM primer R2 (SEQ ID NO. 6), with the remainder made up with ddH2O.

[0046] Fluorescence detection results are as follows Figure 3 As shown in (3) and (4): All materials of Pin2 were amplified into one group and typing was not successfully completed; Pin1 successfully completed typing: A (Pina-D1a / Pinb-D1b, blue), B (Pina-D1b / Pinb-D1a, red), C (Pina-D1a / Pinb-D1a, green), D (Pina-D1b / Pinb-D1b and blank, black). The results are listed in Table 1. Ningmai No. 8, Ningmai No. 9, etc. are type C, Ningmai 23 is type B, Yangmai 158, Yangmai 16, etc. are type A. The results of different repeated tests on the same material are consistent.

[0047] 2. Validation of Multiple KASP Labeling of Pina-D1 and Pinb-D1

[0048] Table 3 Diagnostic markers of Pina-D1 and Pinb-D1

[0049]

[0050]

[0051] The above 22 materials were detected using the diagnostic markers of Pina-D1 (the primer set sequences are shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9 in Table 3, respectively) and Pinb-D1 (the primer set sequences are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 in Table 3, respectively) (RASHEED A, WEN W, GAO F, ZHAI S, JINH, LIU J, GUO Q, ZHANG Y, DREISIGACKER S, XIA X. Development and validation of KASPassays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics, 2016, 129(10): 1-18). Figure 3 (1)-(4) are the test results of Pina-D1, Pinb-D1, Pin1 and Pin2 respectively. The diagnostic marker of Pina-D1 distinguishes the two allelic variants of Pina-D1a and Pina-D1b (blue Pina-D1a, red Pina-D1b), and the diagnostic marker of Pinb-D1 distinguishes the two allelic variants of Pinb-D1a and Pinb-D1b (blue Pinb-D1a, red Pinb-D1b). The results showed that the test results of the two markers were completely consistent with the test results of Pin1 (Table 1 and Figure 3 ), indicating that the multiplex KASP marker Pin1 can replace the diagnostic markers of Pina-D1 and Pinb-D1. Furthermore, the multiplex marker Pin1 can simultaneously detect both Pina-D1 and Pinb-D1 genes, greatly improving detection efficiency.

[0052] Example 2 Application of Multiple KASP Labeling Pin1

[0053] The multiple KASP marker Pin1 (primer set consisting of primers F3, F4 and universal primer R1) was used to rapidly identify 360 high-generation lines. The sources of these 360 ​​wheat lines are shown in Table 4. The test results are shown in Tables 4 and Figure 4 shown.

[0054] Table 4. Origin and multiplex PCR test results of 360 wheat samples

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069] The above experiments identified a total of 168 Pina-D1a / Pinb-D1a types, 3 Pina-D1b / Pinb-D1a types, and 189 Pina-D1a / Pinb-D1b types. Figure 4 Type A (Pina-D1a / Pinb-D1b, blue), Type B (Pina-D1b / Pinb-D1a, red), Type C (Pina-D1a / Pinb-D1a, green), and Type D (Pina-D1b / Pinb-D1b and blank, black). This assay performed a single amplification reaction using a single 384-well plate, whereas STS labeling requires four amplifications and four electrophoresis runs. Conventional KASP labeling requires twice as many consumables and reagents. Therefore, multiple KASP labeling with Pin1 can significantly improve efficiency and reduce testing costs. Sequence Listing <110> Jiangsu Academy of Agricultural Sciences <120> Multiple KASP marker primer sets for major wheat kernel hardness genes and their application <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 tgacaacctc ccttccacca 20 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <400> 2 tcatgctcac agccgcc 17 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <400> 3 gaaggtgacc aagttcatgc ttgacaacct cccttccacc a 41 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <400> 4 gaaggtcgga gtcaacggat ttcatgctca cagccgcc 38 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 atgaaggatt tyccrgtcac ctg 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 cttgctctkg tagcgagcac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 aactgccaac aacttcgcta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 ttgtctagta ccccgctctg 20 <210> 9 <211> twenty three <212> DNA <213> Artificial Sequence <400> 9 atgaaggccc tcttcctcat agg 23 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 ctcatgctca cagccgcc 18 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <400> 11 cctcatgctc acagccgct 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 gtcacctggc ccacaaaatg 20

Claims

1. A multiplex KASP marker primer set for the major gene of wheat grain hardness, characterized in that, The primer set consists of primer F3 with a nucleotide sequence as shown in SEQ ID NO.3, primer F4 with a nucleotide sequence as shown in SEQ ID NO.4, and universal primer R1 with a nucleotide sequence as shown in SEQ ID NO.

5.

2. Use of the primer set according to claim 1 in simultaneously detecting the Pina-D1 genotype and Pinb-D1 genotype of wheat; the Pina-D1 genotype is the Pina-D1a or Pina-D1b genotype; the Pinb-D1 genotype is the Pinb-D1a or Pinb-D1b genotype.

3. The application according to claim 2, characterized in that, The specific steps are as follows: Perform PCR amplification on the wheat sample using the multiplex KASP marker primer set composed of the primer F3, primer F4, and primer R1, and then perform fluorescence detection on the amplification product; if the fluorescence detection result is blue, it indicates that the genotype of the sample wheat is Pina-D1a / Pinb-D1b , if the fluorescence detection result is red, it indicates that the genotype of the sample wheat is Pina-D1b / Pinb-D1a , if the fluorescence detection result is green, it indicates that the genotype of the sample wheat is Pina-D1a / Pinb-D1a , if the fluorescence detection result is black, it indicates that the genotype of the sample wheat is Pina-D1b / Pinb-D1b or blank.

4. The application according to claim 3, characterized in that The PCR amplification refers to: PCR reaction system: 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, and 2.43 μL of wheat template DNA with a concentration of 20 ng / μL; Among them, every 100 μL of the KASP Assay Mix includes: 12 μL of the primer F3 with a concentration of 100 μM, 12 μL of the primer F4 with a concentration of 100 μM, 30 μL of the primer R1 with a concentration of 100 μM, and the balance is made up with ddH2O; The PCR reaction program is: 94°C for 15 min; 94°C for 20 s, 61 - 55°C for 1 min, with a decrease of 0.6°C for each cycle, for a total of 10 cycles; 94°C for 20 s, 55°C for 1 min, for a total of 26 cycles.

Images