Acute lymphoblastic leukemia methylation biomarkers and their applications

Abstract

The present invention relates to an acute lymphoblastic leukemia methylation biomarker and its application. The present invention discloses 15 methylation biomarkers for the diagnosis of acute lymphoblastic leukemia. By studying the differences in methylation modification of these genomic fragments in ALL patients and healthy people, it is found that the above genomic fragment combinations can be used as ALL diagnostic markers. The present invention combines the co-methylation characteristics of multiple methylated cytosines on at least one genomic fragment as a biomarker for judging the onset of ALL with high accuracy and strong specificity, which is of great significance for the prediction of ALL, targeted drug development and companion diagnosis, especially the screening diagnosis of minimal residual disease monitoring (MRD) after treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an acute lymphocytic leukemia methylation biomarker and application thereof. Background Art

[0002] Acute lymphoblastic leukemia (ALL) is a malignant clonal tumor caused by abnormal proliferation of lymphoblasts. It is the most common cancer in children, accounting for 26% of all childhood cancers and 75%-80% of childhood acute leukemia. Among them, B-cell acute lymphoblastic leukemia accounts for 80% of all childhood ALL and is the most common type of ALL. The incidence of adult ALL patients is low, accounting for about 20% of adult acute leukemia.

[0003] Under normal circumstances, blood stem cells, also called immune cells, generated by the bone marrow will differentiate into mature blood cells. Blood stem cells can be transformed into two types: myeloid stem cells and lymphoid stem cells. Among them, myeloid stem cells will differentiate into three types of mature blood cells, including red blood cells that carry oxygen and other substrates to different organs and tissues of the body; platelets that play a role in blood coagulation and granulocytes (white blood cells) that resist exogenous infections and diseases. Abnormalities in myeloid stem cells are the main cause of acute myeloid leukemia (AML); lymphoid stem cells first differentiate into lymphoblasts, and then differentiate into B lymphocytes that produce antibodies to resist foreign infection and T lymphocytes that assist B lymphocytes in producing antibodies, as well as natural killer cells that attack tumor cells and viruses. A large number of stem cells in ALL patients are transformed into lymphoblasts, B lymphocytes or T lymphocytes, also known as leukemia cells. They cannot effectively defend against exogenous infections, resulting in a decrease in the number of white blood cells, red blood cells and platelets in the blood and bone marrow, causing infection, anemia or bleeding. For most tumors, the earlier they are discovered, the simpler their subsequent clinical treatment will be, and the higher the benefit to patients. However, so far, there is no special detection technology method for acute lymphoblastic leukemia in the world. The conventional detection of leukemia is a microscopic examination of bone marrow or blood samples, which identifies and classifies white blood cells by their size, shape and other characteristics. The most important indicator is whether the blood cells are mature. The diagnosis of ALL patients usually requires that at least 20% of the cells in the bone marrow are immature cells. Under normal circumstances, immature cells do not exceed 5% of the bone marrow cells.

[0004] On the other hand, for patients with relapsed and refractory leukemia, there are problems such as difficult treatment monitoring and difficult prognosis. Relapsed treatment is very likely to produce drug resistance, and the treatment effect gradually decreases. The detection of minimal residual disease (MRD) after the patient's medication remission has become a hot topic in the clinical treatment and detection of different tumors. After leukemia patients achieve complete remission (CR) after treatment, although obvious leukemia cells cannot be detected by conventional morphological methods (observing the bone marrow under a microscope with a magnification of 100 times), a small number of residual leukemia cells may still remain in the body. Even if flow cytometry is used for detection, the sensitivity can reach 10 -4 ~10 -5 (That is, 1 leukemia cell can be found in 10,000 to 100,000 cells), but it is impossible to detect earlier cells before the appearance of cell morphological changes. The application of molecular diagnostic methods can detect earlier leukemia cells with genetic mutations or differences in gene expression. Currently, the molecular markers tested in clinical practice are mainly concentrated on cytogenetic abnormalities, such as fusion genes and point mutations. However, patients with such cytogenetic abnormalities and mutation abnormalities only account for a part of the patient population. Given the complexity of leukemia, it is of great significance to find molecular markers that can be used for accurate diagnosis and prognostic stratification.

[0005] A large number of studies at home and abroad have shown that abnormal regulation of DNA methylation runs through the occurrence, development and prognosis of tumors. Plasma free DNA methylation is not only closely related to early tumor occurrence, but also can distinguish tissue origin (PMID: 29035356, PMID: 26392541). Combinations of different gene DNA methylation molecular markers have also been applied to tumor screening, especially early diagnosis of pan-cancer (CN 111742062 A, CN 109680060 A). In the field of hematological diseases, the public invention patent (CN111647661 A) established a method for auxiliary diagnosis of acute myeloid leukemia through the methylation information of a group of specific gene elements CYP26C1-DMR, DGKG-DMR, WT1-DMR and TRIM40-DMR. It was found that the methylation level of AML patients was significantly higher than that of normal people, and the p value of the logistic regression model was used to determine whether the patient was ill. In addition, the published patent applications (CN111411157 A) and (CN109852672 A) found that DNA methylation showed certain specificity in the prognosis of juvenile myelomonocytic leukemia and acute myeloid leukemia through whole genome methylation and whole genome CpG site methylation capture sequencing, respectively. However, in the diagnosis, treatment and minimal residual disease (MRD) monitoring of acute lymphoblastic leukemia, the identification of DNA methylation detection molecular markers is of great clinical significance, but the research is relatively limited. Summary of the invention

[0006] Based on this, one of the objects of the present invention is to provide a methylation biomarker or a combination thereof for detecting acute lymphoblastic leukemia.

[0007] The technical solution to achieve the above purpose is as follows:

[0008] A methylation biomarker or a combination thereof for detecting acute lymphoblastic leukemia, comprising at least one of CG04357841 and / or CG00589581, CG05955436, CG07690127, CG08670465, CG11731671, CG12366968, CG14018153, CG15225364, CG15460454, CG17001566, CG19513987, CG21940655, CG23367351, and CG23375948.

[0009] In some embodiments, the above-mentioned methylation biomarker combination includes at least one selected from CG04357841 and any one of CG14018153, CG19513987, CG23367351, and CG23375948.

[0010] In some embodiments, the above-mentioned methylation biomarker combination includes CG00589581, CG05955436, CG07690127, CG08670465, CG11731671, CG12366968, CG14018153, CG15225364, CG15460454, CG17001566, CG19513987, CG21940655, CG23367351 and CG23375948.

[0011] In some of the embodiments, the sequence of CG04357841 is shown as SEQ ID NO.66 or its complementary sequence, the sequence of CG00589581 is shown as SEQ ID NO.65 or its complementary sequence, the sequence of CG05955436 is shown as SEQ ID NO.67 or its complementary sequence, the sequence of CG07690127 is shown as SEQ ID NO.68 or its complementary sequence, the sequence of CG08670465 is shown as SEQ ID NO.69 or its complementary sequence, the sequence of CG11731671 is shown as SEQ ID NO.70 or its complementary sequence, the sequence of CG12366968 is shown as SEQ ID NO.71 or its complementary sequence, the sequence of CG14018153 is shown as SEQ ID NO.72 or its complementary sequence, the sequence of CG15225364 is shown as SEQ ID NO.73 or its complementary sequence, and the sequence of CG15460454 is shown as SEQ ID NO. The sequence of the above-mentioned CG17001566 is shown in SEQ ID NO.75 or its complementary sequence, the sequence of the above-mentioned CG19513987 is shown in SEQ ID NO.76 or its complementary sequence, the sequence of the above-mentioned CG21940655 is shown in SEQ ID NO.77 or its complementary sequence, the sequence of the above-mentioned CG23367351 is shown in SEQ ID NO.78 or its complementary sequence, and the sequence of the above-mentioned CG23375948 is shown in SEQ ID NO.79 or its complementary sequence.

[0012] In some of the embodiments, the above-mentioned methylation biomarker combination includes at least one selected from SEQ ID NO.66 or its complementary sequence and SEQ ID NO.72 or its complementary sequence, SEQ ID NO.79 or its complementary sequence, SEQ ID NO.76 or its complementary sequence, and SEQ ID NO.78 or its complementary sequence.

[0013] In some embodiments, the above-mentioned DNA methylation marker combination includes the sequences shown in SEQ ID NO.65-SEQ ID NO.79 or the completely complementary sequences of SEQ ID NO.65-SEQ ID NO.79.

[0014] One of the purposes of the present invention is to provide a use of the above-mentioned methylation biomarker or a combination thereof in the preparation of a kit for detecting, classifying or predicting, monitoring treatment, prognosing or otherwise evaluating acute lymphoblastic leukemia.

[0015] One of the purposes of the present invention is to provide a detection kit for acute lymphoblastic leukemia.

[0016] The technical solution to achieve the above purpose is as follows:

[0017] An acute lymphocytic leukemia detection kit comprises a reagent for detecting the methylation status of the above-mentioned methylation biomarkers or a combination thereof.

[0018] In some of the embodiments, the above-mentioned kit is prepared by polymerase chain reaction technology, in situ hybridization technology, enzymatic mutation detection technology, chemical shearing mismatch technology, mass spectrometry analysis technology, gene chip technology or gene sequencing technology or a combination thereof.

[0019] In some of the embodiments, the detection technology used in the above-mentioned kit includes any one of RT-PCR, immune PCR, nested PCR, fluorescence PCR, in situ PCR, membrane-bound PCR, anchored PCR, fixed PCR, in situ PCR, asymmetric PCR, long-distance PCR, parachute PCR, and gradient PCR.

[0020] In some embodiments, the detection technology used in the above kit is fluorescent PCR, including upstream and downstream primers for each methylation biomarker, and the upstream and downstream primers are respectively:

[0021] SEQ ID NO.17 and SEQ ID NO.18 for SEQ ID NO.65, and / or SEQ ID NO.29 and SEQ ID NO.30 for SEQ ID NO.66, and / or SEQ ID NO.1 and SEQ ID NO.2 for SEQ ID NO.67, and / or SEQ ID NO.3 and SEQ ID NO.4 for SEQ ID NO.68, and / or SEQ ID NO.5 and SEQ ID NO.6 for SEQ ID NO.69, and / or SEQ ID NO.23 and SEQ ID NO.24 for SEQ ID NO.70, and / or SEQ ID NO.19 and SEQ ID NO.20 for SEQ ID NO.71, and / or SEQ ID NO.15 and SEQ ID NO.16 for SEQ ID NO.72, and / or SEQ ID NO.7 and SEQ ID NO.8 for SEQ ID NO.73, and / or SEQ ID NO.9 and SEQ ID NO.10 for SEQ ID NO.74, and / or SEQ ID NO. NO.75, and / or SEQ ID NO.25 and SEQ ID NO.26 for SEQ ID NO.75, and / or SEQ ID NO.11 and SEQ ID NO.12 for SEQ ID NO.76, and / or SEQ ID NO.21 and SEQ ID NO.22 for SEQ ID NO.77, and / or SEQ ID NO.27 and SEQ ID NO.28 for SEQ ID NO.78, and / or SEQ ID NO.13 and SEQ ID NO.14 for SEQ ID NO.79.

[0022] In some embodiments, the acute lymphoblastic leukemia detection kit includes upstream and downstream primers: SEQ ID NO.17 and SEQ ID NO.18 for SEQ ID NO.65, and SEQ ID NO.29 and SEQ ID NO.30 for SEQ ID NO.66, and SEQ ID NO.1 and SEQ ID NO.2 for SEQ ID NO.67, and SEQ ID NO.3 and SEQ ID NO.4 for SEQ ID NO.68, and SEQ ID NO.5 and SEQ ID NO.6 for SEQ ID NO.69, and SEQ ID NO.23 and SEQ ID NO.24 for SEQ ID NO.70, and SEQ ID NO.19 and SEQ ID NO.20 for SEQ ID NO.71, and SEQ ID NO.15 and SEQ ID NO.16 for SEQ ID NO.72, and SEQ ID NO.7 and SEQ ID NO.8 for SEQ ID NO.73, and SEQ ID NO.9 and SEQ ID NO.10 for SEQ ID NO.74, and SEQ ID NO. SEQ ID NO.25 and SEQ ID NO.26 for SEQ ID NO.75, and SEQ ID NO.11 and SEQ ID NO.12 for SEQ ID NO.76, and SEQ ID NO.21 and SEQ ID NO.22 for SEQ ID NO.77, and SEQ ID NO.27 and SEQ ID NO.28 for SEQ ID NO.78, and SEQ ID NO.13 and SEQ ID NO.14 for SEQ ID NO.79.

[0023] In some embodiments, the detection technology used in the above kit is digital PCR, and the above kit includes upstream and downstream primers, methylation fluorescent probes and non-methylation fluorescent probes for each methylation biomarker, wherein the upstream and downstream primers are consistent with the above, and the methylation fluorescent probes and non-methylation fluorescent probes are as follows:

[0024] SEQ ID NO.39 and SEQ ID NO.54 for SEQ ID NO.65, and / or SEQ ID NO.45 and SEQ ID NO.60 for SEQ ID NO.66, and / or SEQ ID NO.31 and SEQ ID NO.46 for SEQ ID NO.67, and / or SEQ ID NO.32 and SEQ ID NO.47 for SEQ ID NO.68, and / or SEQ ID NO.33 and SEQ ID NO.48 for SEQ ID NO.69, and / or SEQ ID NO.42 and SEQ ID NO.57 for SEQ ID NO.70, and / or SEQ ID NO.40 and SEQ ID NO.55 for SEQ ID NO.71, and / or SEQ ID NO.38 and SEQ ID NO.53 for SEQ ID NO.72, and / or SEQ ID NO.34 and SEQ ID NO.49 for SEQ ID NO.73, and / or SEQ ID NO.35 and SEQ ID NO.48 for SEQ ID NO.74. NO.50, and / or SEQ ID NO.43 and SEQ ID NO.58 for SEQ ID NO.75, and / or SEQ ID NO.36 and SEQ ID NO.51 for SEQ ID NO.76, and / or SEQ ID NO.41 and SEQ ID NO.56 for SEQ ID NO.77, and / or SEQ ID NO.44 and SEQ ID NO.59 for SEQ ID NO.78, and / or SEQ ID NO.37 and SEQ ID NO.52 for SEQ ID NO.79.

[0025] In some embodiments, the fluorescent reporter group of the methylation probe is FAM, and the quencher group is MGB; the fluorescent reporter group of the non-methylation probe is VIC, and the quencher group is MGB.

[0026] In some embodiments, the methylated fluorescent probe and the non-methylated fluorescent probe of the acute lymphoblastic leukemia detection kit include: SEQ ID NO.39 and SEQ ID NO.54 for SEQ ID NO.65, and SEQ ID NO.45 and SEQ ID NO.60 for SEQ ID NO.66, and SEQ ID NO.31 and SEQ ID NO.46 for SEQ ID NO.67, and SEQ ID NO.32 and SEQ ID NO.47 for SEQ ID NO.68, and SEQ ID NO.33 and SEQ ID NO.48 for SEQ ID NO.69, and SEQ ID NO.42 and SEQ ID NO.57 for SEQ ID NO.70, and SEQ ID NO.40 and SEQ ID NO.55 for SEQ ID NO.71, and SEQ ID NO.38 and SEQ ID NO.53 for SEQ ID NO.72, and SEQ ID NO.34 and SEQ ID NO.49 for SEQ ID NO.73, and SEQ ID NO.48 for SEQ ID NO.74. NO.35 and SEQ ID NO.50, and SEQ ID NO.43 and SEQ ID NO.58 for SEQ ID NO.75, and SEQ ID NO.36 and SEQ ID NO.51 for SEQ ID NO.76, and SEQ ID NO.41 and SEQ ID NO.56 for SEQ ID NO.77, and SEQ ID NO.44 and SEQ ID NO.59 for SEQ ID NO.78, and SEQ ID NO.37 and SEQ ID NO.52 for SEQ ID NO.79.

[0027] Another object of the present invention is to provide a method for detecting acute lymphoblastic leukemia.

[0028] The technical solution to achieve the above purpose is as follows:

[0029] A method for detecting acute lymphoblastic leukemia comprises the following steps:

[0030] Extracting genomic DNA from the biological sample to be tested;

[0031] performing bisulfite conversion on the DNA;

[0032] Detection of the methylation level of the above methylation biomarkers or a combination thereof.

[0033] In some embodiments, the above-mentioned DNA methylation marker detection method includes but is not limited to the following technologies: polymerase chain reaction technology, in situ hybridization technology, enzymatic mutation detection technology, chemical shearing mismatch technology, mass spectrometry analysis technology, gene chip technology or gene sequencing technology.

[0034] In some of the embodiments, the polymerase chain reaction technology in the above detection method includes RT-PCR, immune PCR, nested PCR, fluorescence PCR, in situ PCR, membrane-bound PCR, anchored PCR, fixed PCR, in situ PCR, asymmetric PCR, long-distance PCR, parachute PCR, gradient PCR, etc.; high-throughput detection technology includes simplified genome methylation sequencing, whole genome methylation sequencing, DNA enrichment sequencing, pyrophosphate sequencing, sulfite conversion sequencing, etc.; detection technology based on mass spectrometry-based GC-MS, LC-MS, MALDI-TOFMS, FT-MS, ICP-MS, SIMS and other detection platforms; methylation detection technology based on chip detection platforms, such as 450K and 850K.

[0035] In some embodiments, the biological sample is blood, plasma, saliva, or serum.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The inventors of the present invention have found methylation biomarkers that are very relevant to acute lymphoblastic leukemia through research, including 15 DNA fragments corresponding to 15 methylation biomarkers: CG00589581, CG04357841, CG05955436, CG07690127, CG08670465, CG11731671, CG12366968, CG14018153, CG15225364, CG15460454, CG17001566, CG19513987, CG21940655, CG23367351 and CG23375948. The use of these 15 DNA fragments alone or in combination can be applied to the detection, diagnosis, classification or prediction, treatment monitoring, prognosis or other evaluation of acute lymphoblastic leukemia.

[0038] By studying the differences in methylation modification of these markers in ALL patients and healthy people, it was found that the above marker combination has a sensitivity of 99.63% and a specificity of 94.74% for ALL patients, and can be used as a diagnostic marker for ALL. Furthermore, in patients with remission after ALL treatment and patients with relapse after ALL treatment, by detecting the above markers alone or in combination, it was found that the test results of ALL relapse patient samples were consistent with those of ALL patient samples, and both had methylation modification specificity of the above sites, thereby effectively distinguishing ALL remission and relapse patients, indicating that it can be further used as a screening marker for minimal residual disease monitoring (MRD) in ALL patients after treatment.

[0039] The present invention combines the analysis of the co-methylation characteristics of multiple methylated cytosines on at least one genomic fragment as a biomarker for determining the onset of ALL, which has high sensitivity and strong specificity, and is of great significance for the prediction of ALL, targeted drug development and companion diagnosis, especially the screening diagnosis of minimal residual disease (MRD) after treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a graph showing the difference in peripheral blood methylation between ALL patients and healthy individuals in the sequencing results of 15 sites in Example 3, wherein Group A is ALL patients and Group B is healthy individuals.

[0041] Figure 2 This is a graph showing the methylation characteristics of peripheral blood in patients with relapsed ALL in the digital PCR test results for site CG 04357841 in Example 4.

[0042] Figure 3 This is a graph showing the methylation characteristics of peripheral blood in individuals who were relieved after ALL treatment in the digital PCR test results for site CG 04357841 in Example 4. DETAILED DESCRIPTION

[0043] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0044] The experimental methods in the following examples where specific conditions are not specified are generally carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0045] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0046] To facilitate understanding of the present technology, certain terms and phrases are defined below.

[0047] Throughout the specification and claims, the following terms have the meanings clearly associated with this document unless the context clearly dictates otherwise. The phrase "in one embodiment" used in the present invention does not necessarily refer to the same embodiment, although it may be. In addition, the phrase "in another embodiment" used in the present invention does not necessarily refer to a different embodiment, although it may be. Therefore, as described below, the various embodiments of the present invention can be easily combined without departing from the scope or spirit of the present invention.

[0048] In addition, as used in the present invention, the term "or" is an inclusive "or" symbol and is equivalent to the term "and / or", unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meanings of "a", "an", and "the" include plural referents. The meaning of "in..." includes "in..." and "on...".

[0049] The terms "complementary" and "complementarity" refer to a nucleotide (e.g., 1 nucleotide) or polynucleotide (e.g., a sequence of nucleotides) in relation to the base pairing rules. For example, the sequence 5'-AGT-3' is complementary to the sequence 3'-TCA-5'. Complementarity can be "partial", in which only some of the nucleic acid bases are matched according to the base pairing rules. Alternatively, there may be "complete" or "total" complementarity between nucleic acids. The degree of complementarity between nucleic acid chains affects the efficiency and intensity of hybridization between nucleic acid chains. This is particularly important in amplification reactions and detection methods that rely on binding between nucleic acids.

[0050] The term "polymerase chain reaction" is used to amplify a target sequence, and the method consists of the following steps: a large excess of two oligonucleotide primers are introduced into a DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycles in the presence of a DNA polymerase. The two primers are complementary to the corresponding strands of the double-stranded target sequence. In order to amplify, the mixture is denatured, and then the primers are annealed to their complementary sequences within the target molecule. After annealing, the primers are amplified with a polymerase to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing, and extension constitute one "cycle"; there can be many "cycles") to obtain a high concentration of amplified fragments of the desired target sequence. The length of the amplified fragment of the desired target sequence is determined by the relative position of the primers relative to each other, so the length is a controllable parameter. Due to the repetitive aspect of the method, the method is called "polymerase chain reaction" ("PCR"). Since the desired amplified fragment of the target sequence becomes the main sequence in the mixture (in terms of concentration), it is said to be "PCR amplified", a "PCR product" or "amplicon".

[0051] As used herein, the term "nucleic acid detection assay" refers to any method for determining the nucleotide composition of a target nucleic acid. Nucleic acid detection assays include, but are not limited to, DNA sequencing methods, probe hybridization methods.

[0052] The term "amplifiable nucleic acid" refers to a nucleic acid that can be amplified by any amplification method. It is expected that an "amplifiable nucleic acid" will typically comprise a "sample template."

[0053] The term "sample template" refers to nucleic acids derived from a sample that are used to analyze the presence of a "target" (defined below). In contrast, "background template" is used to refer to nucleic acids other than the sample template, which may or may not be present in the sample. Background templates are usually unintentional. This may be the result of carryover, or may be due to the presence of nucleic acid contaminants that are attempted to be purified from the sample. For example, nucleic acids other than the nucleic acids to be detected from an organism may exist as background for a test sample.

[0054] As used herein, "methylation" refers to methylation of cytosine at cytosine position C5 or N4, N6 site of adenine or other types of nucleic acid methylation. In vitro amplified DNA is usually unmethylated, because in vitro DNA amplification methods generally do not preserve the methylation pattern of the amplified template. However, "unmethylated DNA" or "methylated DNA" may also refer to amplified DNA that is unmethylated or methylated from the original template, respectively.

[0055] Therefore, as used herein, "methylated nucleotide" or "methylated nucleotide base" refers to the presence of a methyl moiety on a nucleotide base, wherein the methyl moiety is not present in recognized typical nucleotide bases. For example, cytosine does not contain a methyl moiety on its pyrimidine ring, but 5-methylcytosine contains a methyl moiety at the 5th position of its pyrimidine ring. Therefore, cytosine is not a methylated nucleotide, and 5-methylcytosine is a methylated nucleotide. In another example, thymine contains a methyl moiety at the 5th position of its pyrimidine ring; however, for the purposes of this article, thymine is not considered to be a methylated nucleotide when present in DNA, because thymine is a typical nucleotide base of DNA.

[0056] The methylation state can optionally be represented or indicated by a "methylation value" (e.g., representing a methylation frequency, fraction, ratio, percentage, etc.). The methylation value can be generated, for example, by quantifying the amount of intact nucleic acid present after restriction digestion with a methylation-dependent restriction enzyme, or by comparing amplification spectra after a bisulfite reaction, or by comparing the sequences of bisulfite-treated and untreated nucleic acids. Therefore, a value such as a methylation value represents the methylation state and can therefore be used as a quantitative indicator of the methylation state in multiple copies of a locus. The degree of co-methylation is represented or indicated by the methylation state of more than one methylation site, and co-methylation is defined as when the methylation state of more than one methylation site is methylated within a methylated region.

[0057] As used herein, the term "bisulfite reagent" refers to a reagent that, in some embodiments, comprises bisulfite, disulfite, hydrogen sulfite, or a combination thereof. After treatment with the bisulfite reagent, unmethylated cytosine nucleotides in DNA will be converted into uracil, while methylated cytosine and other bases remain unchanged, thereby making it possible to distinguish between methylated and unmethylated cytidine in, for example, a CpG dinucleotide sequence.

[0058] The term "methylation assay" refers to any assay used to determine the methylation status of one or more CpG dinucleotide sequences within a nucleic acid sequence.

[0059] The present invention is further described in detail below with reference to specific embodiments.

[0060] Example 1 Acquisition of molecular markers

[0061] We collected the existing 450K methylation chip test data in the GEO database and obtained the classification of clinical methylation test data: 1356 newly diagnosed ALL patients and 87 normal control individuals. We randomly selected the data of 1084 newly diagnosed patients and 49 healthy patients for machine learning modeling and trained a random forest model. Then, we used the remaining 272 newly diagnosed ALL patients and 38 healthy samples as validation sets, and obtained the molecular markers and corresponding sequences through screening as shown in Table 1-1 below:

[0062] Table 1-1

[0063]

[0064]

[0065] For the above 15 candidate methylation sites specific to ALL patient samples, 272 ALL samples and 38 healthy human samples were detected and analyzed using the constructed machine learning model and random forest model. The sensitivity of all marker combinations for ALL patient detection was 99.63% and the specificity was 94.74%. The results are shown in Table 1-2 below.

[0066] Table 1-2. Methylation molecular markers for acute lymphoblastic leukemia and normal population detection

[0067]

[0068] A random forest model was further established based on the 1,356 newly diagnosed cases and 87 healthy samples as training sets, and 32 relapsed and 195 remission tested samples were used as validation sets (data from the GEO database). If the relapsed state was predicted to be an ALL sample and the remission state was predicted to be a healthy sample, the prediction was considered correct. The prediction results for different combinations of CG04357841 and CG14018153, CG19513987, CG23367351, and CG23375948 are shown in Tables 1-3 below:

[0069] Table 1-3 Methylation predicts relapse / remission outcomes in acute lymphoblastic leukemia

[0070]

[0071] From the statistical results in the above table, it can be seen that the detection of the methylation level of the biomarker combination CG23375948 and CG23367351 has good sensitivity and specificity for predicting ALL relapse / remission samples. The detection of the methylation level of the biomarker combination CG04357841 and CG14018153; CG04357841 and CG19513987; CG19513987 and CG14018153 also has good sensitivity and specificity for predicting ALL relapse / remission samples.

[0072] Example 2 Preparation and detection of molecular marker kits

[0073] Based on the above markers, sulfite-specific PCR amplification primers were designed, and the specific primer sequences are shown in Table 2-1 below.

[0074] Table 2-1

[0075]

[0076]

[0077] In real-time quantitative PCR detection, ACTB gene primers and probes can be used as internal references, wherein the upstream primer is: gattaggtgtttaagatagtgtt (SEQ ID NO.80), the downstream primer is: atctattcaaacctactatacac (SEQID NO.81), and the detection probe is: tgtgataaggttatgaggttggt (SEQ ID NO.82).

[0078] The detection sites of CG04357841 (SEQ ID NO.29-SEQ ID NO.30 primer pair and SEQ ID NO.45 probe), CG23375948 (SEQ ID NO.13-SEQ ID NO.14 primer pair and SEQ ID NO.37 probe) and CG14018153 (SEQID NO.15-SEQ ID NO.16 primer pair and SEQ ID NO.38 probe) were selected and combined with the ACTB reference gene primer probe, and used for one case of ALL patients and one case of healthy individuals for fluorescence quantitative detection, and the detection results were calculated by ΔCt for each sample methylation level. The detection results are shown in Table 2-2 below:

[0079] Table 2-2

[0080]

[0081] From the data in the above table, we can preliminarily see that the methylation levels of the biomarkers: CG04357841, CG23375948 and CG14018153 are significantly different between ALL patients and healthy individuals, and the detection Ct values ​​are also significantly different. Therefore, quantitative PCR can be used to detect the above biomarkers for the detection of ALL.

[0082] Based on the above primer pair, a digital PCR detection kit can also be prepared, which includes the above primer pair and also includes fluorescent probes for detecting methylated SEQ ID NO.31 to SEQ ID NO.45 and unmethylated SEQ ID NO.46 to SEQ ID NO.60, and the specific sequences are shown in Table 2-3 below. The methylated probe fluorescent reporter group is FAM, the quencher group is MGB, and the unmethylated probe fluorescent reporter group is VIC, and the quencher group is MGB.

[0083] Table 2-3

[0084]

[0085]

[0086] For a certain site to be detected, its upstream and downstream primers, methylation fluorescent probe and non-methylation fluorescent probe are all present in the form of a mixed solution, wherein the concentrations of the upstream and downstream primers in the mixed solution are 10uM, and the concentrations of the methylation and non-methylation fluorescent probes in the mixed solution are 3uM, respectively.

[0087] The digital PCR detection kit also includes a digital PCR reaction premix solution, which is TM 3D Digital PCR Master Mix v2 (Thermo). The kit also includes methylated and unmethylated standards, which can be prepared using lambda DNA (Promega, D1521).

[0088] The test procedure of the kit is as follows:

[0089] Before DNA molecular marker methylation modification is used in the diagnosis of acute lymphoblastic leukemia, the genomic DNA needs to be converted with sulfite or bisulfite, and the conversion reagent is EZ DNA Methylation-Gold TM Kit (ZYMO Research).

[0090] Preparation of reaction system: 2ul of primer (10uM) and probe (3uM) mixture, 12.5ul of PCR reaction premix (including 2XPCR buffer, 0.25mM dNTP and 5U PCR amplification enzyme), 50ng of DNA template after sulfite conversion, and the total reaction volume is made up to 25ul with ultrapure water.

[0091] Preparation and amplification of droplets: Add the sample reaction system to the middle row of the DG8 cartridge (droplet generation card), add 70ul of droplet generation oil to the bottom row, and the droplets will be generated in the top row of the cartridge. Pipette 40ul into a 96-well plate for amplification. The reaction procedure is: (1) 95℃, 1min; (2) 95℃ 30sec, 60℃ 1min, 40 cycles; (3) 4℃, 5min, 90℃ 2min, keep at 4℃ for no more than 12 hours.

[0092] Signal reading and analysis: After the amplification reaction, the signal of the droplet in each well was read by QX200 Droplet Reader, and the data was analyzed by Quanta Soft software.

[0093] Example 3 Detection of Acute Lymphocytic Leukemia by Combined Amplicon Sequencing of Marker DNA Regions

[0094] Selection of samples to be tested: Peripheral blood samples from 14 patients with acute lymphoblastic leukemia diagnosed in the 307th Hospital of the People's Liberation Army in Beijing (Group A) and peripheral blood samples from 10 normal subjects (Group B) were selected for methylation detection.

[0095] Genomic DNA extraction: Tiangen's blood / cell / tissue genomic DNA extraction kit (DP304-03) was used to extract the genomic DNA of the samples to be tested, and the Qubit fluorescence method was used to quantify the DNA concentration.

[0096] Genomic DNA sulfite conversion: Take 500ng of extracted genomic DNA in a volume of no more than 20ul and use ZYMOResearch's EZ DNAMethylation-Gold TM Kit (D5006) sulfite conversion kit, according to the operating instructions of the kit, the whole genome DNA was treated with sulfite and purified, and after QPCR and Agilent 2100 detection (the purification standard is: Agilent 2100 fragment distribution is in the range of 150bp-500bp, and the library concentration is not less than 1ng / ul), the DNA was eluted into 10ul EB buffer.

[0097] The upstream and downstream amplification primers of SEQ ID NO.1 to SEQ ID NO.30 are configured as PCR amplification working primers, and the concentration of each primer is 1uM. This primer combination can amplify the methylation information of all core CG sites and potential CG sites in the marker.

[0098] Bisulfite PCR amplification: First, prepare the PCR reaction solution on ice according to the following system.

[0099] 5ul of genomic DNA after sulfite conversion, 2ul of PCR amplification primers, 20ul of PCR reaction premix, and 13ul of ultrapure water were added. Then, amplification was performed on a PCR instrument according to the following procedure. After the amplified product was purified, the concentration was determined by Qubit.

[0100] Table 3-1

[0101]

[0102] Library construction:

[0103] Configure the reaction solution system according to Table 3-2 below:

[0104] Table 3-2

[0105] PCR amplification product (50ng) 10ul 10X Polynucleotide Kinase Buffer 5ul T4 polynucleotide kinase 2ul ATP(10mM) 5ul 50% PEG 7.5 Connector 1 / 2 (10mM) 1ul T4 DNA ligase 1ul Ultrapure water 18.5ul

[0106] Wherein linker 1 is: tacactctttccctacacgacgctcttccgatct (SEQ ID NO.61);

[0107] Linker 2 is: gatcggaagagcacacgtctgaactccagtcac (SEQ ID NO. 62).

[0108] After mixing, react at 20°C for 30 minutes; the reaction product is purified by Beckman XP magnetic beads with a volume of 0.9 times the reaction product, and the DNA is eluted into 30ul elution solution.

[0109] Library PCR amplification and sequencing

[0110] First, prepare the reaction solution in the PCR tube according to the following reaction system:

[0111] Table 3-3

[0112] Adapter-ligated amplification products 23ul 2XPCRReadyMix 25ul Outer primers 1 and 2 (10uM) 2ul

[0113] Among them, external primer 1: aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct (SEQ ID NO.63). External primer 2: caagcagaagacggcatacgagatnnnnnnnngtgactggagttcagacgtgtgctcttccgatct (SEQ ID NO.64). Among them, n8 is a tag sequence used to distinguish sequencing data of different samples.

[0114] After the reaction system is configured, perform the reaction in the PCR instrument according to the procedure shown in Table 3-4 below.

[0115] Table 3-4

[0116]

[0117] After the library was tested, high-throughput second-generation sequencing was performed, and the methylation data of the target region sequencing and the methylation differences between ALL patients and normal controls were analyzed. The data was split into different sample data using the label sequence of the external primer 2, and the low-quality sequencing data such as the connector contamination was removed. The methylation level of the molecular marker sequencing data was calculated. Figure 1 The results showed that Group A was the ALL test results, and Group B was the peripheral blood test results of normal physical examination. The vertical axis was the methylation level. It can be seen that the average methylation levels of the 15 test areas were significantly different between acute lymphoblastic leukemia patients and normal individuals.

[0118] Example 4: Digital PCR kit for monitoring MRD in acute lymphoblastic leukemia

[0119] Taking the detection of the methylation biomarker CG 04357841 (SEQ ID NO.66) as an example, the above-mentioned primers SEQID NO.29, SEQ ID NO.30 and probes SEQ ID NO.45, SEQ ID NO.60 were used to construct a primer-probe mixture according to the technical invention process and parameters, and the digital PCR kit detection process was used to detect the differences in the number of DNA methylation molecules in peripheral blood samples of one patient in remission and one patient in relapse after ALL treatment.

[0120] Genomic DNA extraction: Tiangen's blood / cell / tissue genomic DNA extraction kit (DP304-03) was used to extract the genomic DNA of the samples to be tested, and the Qubit fluorescence method was used to quantify the DNA concentration.

[0121] Before DNA molecular marker methylation modification is used in the diagnosis of acute lymphoblastic leukemia, the genomic DNA needs to be converted with sulfite or bisulfite. The conversion reagent is EZ DNAMethylation-Gold TM Kit (ZYMO Research).

[0122] Preparation of reaction system: 2ul of primer (10uM) and probe (3uM) mixture, 12.5ul of PCR reaction premix, 50ng of sulfite-converted DNA template, and the total reaction volume is made up to 25ul with ultrapure water.

[0123] Droplet preparation and amplification: Add the sample reaction system to the middle row of the DG8 cartridge, add 70ul of droplet generation oil to the bottom row, and the droplets will be generated in the top row of the cartridge. Pipette 40ul into a 96-well plate for amplification. The reaction program is: (1) 95℃, 1min; (2) 95℃ 30sec, 60℃ 1min, 40 cycles; (3) 4℃, 5min, 90℃ 2min, keep at 4℃ for no more than 12 hours.

[0124] Signal reading and analysis: After the amplification reaction, the signal of the droplet in each well was read by QX200 Droplet Reader, and the data was analyzed by QuantaSoft software.

[0125] The results of the above-mentioned methylation copy number detection of peripheral blood samples from patients with ALL relapse and ALL remission are as follows Figure 2-3 As shown in the figure, the upper left scattered dots represent the methylated (FAM positive) copy number, and the lower right scattered dots represent the unmethylated (VIC positive) copy number. The methylated copy number of the DNA site CG 04357841 in the peripheral blood of ALL relapsed patients is significantly higher than that in the peripheral blood of ALL remission patients. Figure 1 The results were consistent, that is, the same site methylation modification specificity also existed in ALL patients, and the methylation level of site CG 04357841 in ALL patient samples was significantly higher than that in healthy individuals.

[0126] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0127] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. Sequence Listing <110> High Fly Xi Yongzhi <120> Acute lymphoblastic leukemia methylation biomarkers and their applications <160> 82 <170> SIPOSequenceListing 1.0 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <400> 1 taagtgatat gttgtagggt tatagatt 28 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 taacactccc aaaaaaaaca actac 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 tttattattg ttattgattttgggg 25 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 tcaataaaac aaccaaacac aaac 24 <210> 5 <211> twenty four <212> DNA <213> Artificial Sequence <400> 5 ttttgtttag ttggggtttt gtag 24 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 tcccaatctt year aaaaa 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 atttgttttt ttggaagtag agagg 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <400> 8 ataaaactaa tcaaccctaa acacc 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 ggtagagatt tagataataa gggaa 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 ctataccta actatacacc cattc 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <400> 11 gtttggggtt tttagtaatt gattt <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <400> 12 tttaacaaaa aacttttcaa attack <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <400> 13 gggaagtag ggtttaggt ttt <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <400> 14 atacccacct caactctaca will be <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <400> 15 tggttaga tttaggttga aat <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <400> 16 aacaataccc tcaaaaaaaa att <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <400> 17 ataattttag gtgtgttttg gttgg 25 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <400> 18 tataaaacca ccacacttct ccc 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <400> 19 taggtgtgtt ttggttggtg tta 23 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 ccctatccac taaaaatact tcctc 25 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <400> 21 ttttttgtgg gggttatatt tgtag 25 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <400> 22 acaccttatt attaaaccca atccc 25 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <400> 23 aaatatttaa ataaagatta aaaatga 27 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <400> 24 aaaaataaaa taaaaattaa taccc 25 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <400> 25 tttttttttg gttttttttg 20 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <400> 26 cccctacaac ccctacttaa ac 22 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <400> 27 ttatgtagag ttgaggtggg tattg 25 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <400> 28 tataacccca aaccaaaaat acaaa 25 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <400> 29 gattagagtg tagtggttat aatgga 26 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <400> 30 ctaacttcct ctccctctac ctaac 25 <210> 31 <211> 16 <212> DNA <213> Artificial Sequence <400> 31 taggtgtcgg attaat 16 <210> 32 <211> 15 <212> DNA <213> Artificial Sequence <400> 32 ttttcgattt tattg 15 <210> 33 <211> 15 <212> DNA <213> Artificial Sequence <400> 33 tttgacggtt gattt 15 <210> 34 <211> 15 <212> DNA <213> Artificial Sequence <400> 34 tatgttcgtg gaata 15 <210> 35 <211> 15 <212> DNA <213> Artificial Sequence <400> 35 aagggaacga ataga 15 <210> 36 <211> 15 <212> DNA <213> Artificial Sequence <400> 36 atagggcggg agggt 15 <210> 37 <211> 23 <212> DNA <213> Artificial Sequence <400> 37 tttgggtgcg ttttgagaga agg 23 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <400> 38 aaggggtcgt cgtgttggt 19 <210> 39 <211> 15 <212> DNA <213> Artificial Sequence <400> 39 tgttacggag tttta 15 <210> 40 <211> 15 <212> DNA <213> Artificial Sequence <400> 40 attttcggtg tgttt 15 <210> 41 <211> 15 <212> DNA <213> Artificial Sequence <400> 41 tgttgttcgt ttggt 15 <210> 42 <211> 15 <212> DNA <213> Artificial Sequence <400> 42 tggttgcggt ttttt 15 <210> 43 <211> 15 <212> DNA <213> Artificial Sequence <400> 43 atatcgtggg cgtta 15 <210> 44 <211> 14 <212> DNA <213> Artificial Sequence <400> 44 ttggttggac ggat 14 <210> 45 <211> 15 <212> DNA <213> Artificial Sequence <400> 45 ttgggtgcgt tttga 15 <210> 46 <211> 16 <212> DNA <213> Artificial Sequence <400> 46 taggtgttgg attaat 16 <210> 47 <211> 15 <212> DNA <213> Artificial Sequence <400> 47 tttttgattt tattg 15 <210> 48 <211> 15 <212> DNA <213> Artificial Sequence <400> 48 tttgatggtt gattt 15 <210> 49 <211> 15 <212> DNA <213> Artificial Sequence <400> 49 tatgtttgtg gaata 15 <210> 50 <211> 15 <212> DNA <213> Artificial Sequence <400> 50 aagggaatga ataga 15 <210> 51 <211> 15 <212> DNA <213> Artificial Sequence <400> 51 atagggtggg agggt 15 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <400> 52 ttgggtgtgt tttgagagaa 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <400> 53 tggggaaggg gttgttgtgt 20 <210> 54 <211> 15 <212> DNA <213> Artificial Sequence <400> 54 tgttatggag tttta 15 <210> 55 <211> 15 <212> DNA <213> Artificial Sequence <400> 55 atttttggtg tgttt 15 <210> 56 <211> 15 <212> DNA <213> Artificial Sequence <400> 56 tgttgtttgt ttggt 15 <210> 57 <211> 15 <212> DNA <213> Artificial Sequence <400> 57 tggttgtggt ttttt 15 <210> 58 <211> 15 <212> DNA <213> Artificial Sequence <400> 58 atattgtggg tgtta 15 <210> 59 <211> 14 <212> DNA <213> Artificial Sequence <400> 59 ttggttggat ggat 14 <210> 60 <211> 15 <212> DNA <213> Artificial Sequence <400> 60 ttgggtgtgt tttga 15 <210> 61 <211> 34 <212> DNA <213> Artificial Sequence <400> 61 tacactcttt ccctacacga cgctcttccg atct 34 <210> 62 <211> 33 <212> DNA <213> Artificial Sequence <400> 62 gatcggaaga gcacacgtct gaactccagt cac 33 <210> 63 <211> 58 <212> DNA <213> Artificial Sequence <400> 63 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58 <210> 64 <211> 66 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (25)..(32) <223> n is a, c, g, or t <400> 64 caagcagaag acggcatacg agatnnnnnn nngtgactgg agttcagacg tgtgctcttc 60 cgatct 66 <210> 65 <211> 81 <212> DNA <213> Artificial Sequence <400> 65 cggagcctca cacacggctg aaccgcttaa ctcacatcca gccacagaac ggcctgccag 60 gggctccccg gggacctgac g 81 <210> 66 <211> 114 <212> DNA <213> Artificial Sequence <400> 66 cgagggtctg gactagagtg cagtggccac aatggacgcc gcgagtgtct tcattaagag 60 tgagtgtctc agtctccccc agggcgcccg ccagccacag ggccgctatg tgcg 114 <210> 67 <211> 96 <212> DNA <213> Artificial Sequence <400> 67 cggattaaca ggaagttaaa tcaaacaagg agtgtgagga gggaggcggg gcagtgggag 60 aatgcccccc agctgcacag ggcggggtaa cattcg 96 <210> 68 <211> 86 <212> DNA <213> Artificial Sequence <400> 68 cggcggtctc cgatcttact gctgtcattg attctgggac gccacacact atgctcctca 60 gacggcaaaa gcttcaccga ccaacg 86 <210> 69 <211> 70 <212> DNA <213> Artificial Sequence <400> 69 gctggggctt tgcagaccaa aatctatcct gacggttgac ctgaaataca gacaatttcc 60 cacatcagtg 70 <210> 70 <211> 93 <212> DNA <213> Artificial Sequence <400> 70 cgctcaccgg aggagcccaa acggtgaccg cagggtggct gcggtcctcc ccgggcaaac 60 aggaagttgg cgtgactgtc tccgacggct ccg 93 <210> 71 <211> 69 <212> DNA <213> Artificial Sequence <400> 71 cggcctgcca ggggctcccc ggggacctga cgagggtcaa cactttccca cgaccctctg 60 ccatccccg 69 <210> 72 <211> 88 <212> DNA <213> Artificial Sequence <400> 72 cgctcggcgc tcgggctgcg gggaaggggt cgtcgtgttg gtaatccccc tctgagggca 60 ctgctcgtgt ggccctggca ggtggacg 88 <210> 73 <211> 94 <212> DNA <213> Artificial Sequence <400> 73 cggggacctc tgcagcatgt ccgtggaaca cgtgggccag ggattgtgtg cccggccccc 60 attccagctc tgccacgtga gcagtgctca ctcg 94 <210> 74 <211> 67 <212> DNA <213> Artificial Sequence <400> 74 cgggtgaacc cgagacgggc agagacccag acaacaaggg aacgaacaga tgggcaaacc 60 cgagacg 67 <210> 75 <211> 109 <212> DNA <213> Artificial Sequence <400> 75 cgccgaccct cgacctcgtg cgggacaccg tgggcgccag gccccccgct tgcctgggtt 60 ccctgcgaca tcccgacccg cgccccgaga gacgcgggag cgcgcgccg 109 <210> 76 <211> 127 <212> DNA <213> Artificial Sequence <400> 76 cgacgtgagt ccgacgccgc tggacaccca gcgtcaactg ctccccccaa gcctggggcc 60 tccagtaact gatctgctgt gagacagggc gggagggtgg agtgcagaca acaaggggtg 120 ggaagcg 127 <210> 77 <211> 79 <212> DNA <213> Artificial Sequence <400> 77 cgcatggagg accaacccaa agtgctgccc gcctggccgg tgtgggccga tgtcactccc 60 cagccccgac ccagaatcg 79 <210> 78 <211> 66 <212> DNA <213> Artificial Sequence <400> 78 cggctggctg gacggatcct gcatccctgg cctggggcta cacgggcgac tgggatcaat 60 ccttcg 66 <210> 79 <211> 66 <212> DNA <213> Artificial Sequence <400> 79 cggaggctcg cagccctcct gggtgcgcct tgagagaagg cgctcctcga ccaccccagc 60 tgggcg 66 <210> 80 <211> 23 <212> DNA <213> Artificial Sequence <400> 80 gattaggtgt ttaagatagt gtt 23 <210> 81 <211> 23 <212> DNA <213> Artificial Sequence <400> 81 atctattcaa acctactata cac 23 <210> 82 <211> 23 <212> DNA <213> Artificial Sequence <400> 82 tgtgataagg ttatgaggtt ggt 23

Claims

1. A methylation biomarker combination for the detection of acute lymphoblastic leukemia, characterized in that: The methylation biomarker panel consists of CG04357841, CG00589581, CG05955436, CG07690127, CG08670465, CG11731671, CG12366968, CG14018153, CG15225364, CG15460454, CG17001566, CG19513987, CG21940655, CG23367351, and CG23375948.

2. The methylation biomarker combination according to claim 1, characterized in that: The sequence of CG04357841 is shown in SEQ ID NO.66 or its complementary sequence, The sequence of CG00589581 is shown in SEQ ID NO.65 or its complementary sequence, The sequence of CG05955436 is shown in SEQ ID NO.67 or its complementary sequence, The sequence of CG07690127 is shown in SEQ ID NO.68 or its complementary sequence, The sequence of CG08670465 is shown in SEQ ID NO.69 or its complementary sequence, The sequence of CG11731671 is shown in SEQ ID NO.70 or its complementary sequence, The sequence of CG12366968 is shown in SEQ ID NO.71 or its complementary sequence, The sequence of CG14018153 is shown in SEQ ID NO.72 or its complementary sequence, The sequence of CG15225364 is shown in SEQ ID NO.73 or its complementary sequence, The sequence of CG15460454 is shown in SEQ ID NO.74 or its complementary sequence, The sequence of CG17001566 is shown in SEQ ID NO.75 or its complementary sequence, The sequence of CG19513987 is shown in SEQ ID NO.76 or its complementary sequence, The sequence of CG21940655 is shown in SEQ ID NO.77 or its complementary sequence, The sequence of CG23367351 is shown in SEQ ID NO.78 or its complementary sequence, The sequence of CG23375948 is shown in SEQ ID NO.79 or its complementary sequence.

3. The methylation biomarker combination according to claim 2, characterized in that: The DNA methylation marker combination is the sequence shown in SEQ ID NO.65-SEQ ID NO.

79.

4. Use of the methylation biomarker combination according to any one of claims 1 to 3 in the preparation of a kit for detecting or monitoring the treatment of acute lymphoblastic leukemia.

5. An acute lymphoblastic leukemia detection kit, characterized in that: A reagent for detecting the methylation status of the methylation biomarker combination according to any one of claims 1 to 3; The technology used in the kit is polymerase chain reaction technology, and the polymerase chain reaction is fluorescent PCR. The kit includes upstream and downstream primers for each methylation biomarker, and the upstream and downstream primers are respectively: For SEQ ID NO. 17 and SEQ ID NO. 18 of SEQ ID NO. 65, SEQ ID NO.29 and SEQ ID NO.30 for SEQ ID NO.66, SEQ ID NO.1 and SEQ ID NO.2 for SEQ ID NO.67, For SEQ ID NO.3 and SEQ ID NO.4 of SEQ ID NO.68, SEQ ID NO.5 and SEQ ID NO.6 for SEQ ID NO.69, SEQ ID NO.23 and SEQ ID NO.24 for SEQ ID NO.70, SEQ ID NO.19 and SEQ ID NO.20 for SEQ ID NO.71, SEQ ID NO.15 and SEQ ID NO.16 for SEQ ID NO.72, SEQ ID NO.7 and SEQ ID NO.8 for SEQ ID NO.73, SEQ ID NO.9 and SEQ ID NO.10 for SEQ ID NO.74, SEQ ID NO.25 and SEQID NO.26 for SEQ ID NO.75, For SEQ ID NO.76, SEQ ID NO.11 and SEQ ID NO.12, SEQ ID NO.21 and SEQ ID NO.22 for SEQ ID NO.77, SEQ ID NO.27 and SEQ ID NO.28 for SEQ ID NO.78, and SEQ ID NO.13 and SEQ ID NO.14 for SEQ ID NO.

79.

6. An acute lymphoblastic leukemia detection kit, characterized in that: A reagent for detecting the methylation state of the methylation biomarker combination according to any one of claims 1 to 3; the technology used in the kit is polymerase chain reaction technology, the polymerase chain reaction is digital PCR, the kit includes upstream and downstream primers for each methylation biomarker, methylation fluorescent probes and non-methylation fluorescent probes, the upstream and downstream primers are as shown in claim 5, and the methylation fluorescent probes and non-methylation fluorescent probes are as follows: SEQ ID NO.39 and SEQ ID NO.54 for SEQ ID NO.65, SEQ ID NO.45 and SEQ ID NO.60 for SEQ ID NO.66, SEQ ID NO.31 and SEQ ID NO.46 for SEQ ID NO.67, SEQ ID NO.32 and SEQ ID NO.47 for SEQ ID NO.68, SEQ ID NO.33 and SEQ ID NO.48 for SEQ ID NO.69, SEQ ID NO.42 and SEQ ID NO.57 for SEQ ID NO.70, SEQ ID NO.40 and SEQ ID NO.55 for SEQ ID NO.71, SEQ ID NO.38 and SEQ ID NO.53 for SEQ ID NO.72, For SEQ ID NO.73, SEQ ID NO.34 and SEQ ID NO.49, For SEQ ID NO.74, SEQ ID NO.35 and SEQ ID NO.50, SEQ ID NO.43 and SEQ ID NO.58 for SEQ ID NO.75, SEQ ID NO.36 and SEQ ID NO.51 for SEQ ID NO.76, For SEQ ID NO.77, SEQ ID NO.41 and SEQ ID NO.56, SEQ ID NO.44 and SEQ ID NO.59 for SEQ ID NO.78, and SEQ ID NO.37 and SEQ ID NO.52 for SEQ ID NO.79.

Images