A rice disease-resistant gene LBRW1, recombinant vector, recombinant engineering bacterium and application
By cloning and applying the rice disease-resistant gene LBRW1, the existing rice blast resistance gene has been solved, and the broad-spectrum resistance of rice to rice blast has been enhanced, and the gene resources for green prevention and control of rice blast are provided.
Patent Information
- Application Number
- CN202210507311.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-11
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2042-05-11
AI Technical Summary
The resistance spectrum of existing rice blast resistance genes is narrow, and it is prone to lose resistance due to mutation of rice blast, and lacks broad-spectrum disease-resistant gene resources, which leads to difficulties in preventing and controlling rice blast.
The rice disease-resistant gene LBRW1 was cloned and applied, and the rice was transformed using Agrobacterium to obtain transgenic plants to enhance the resistance to rice blast by inserting it into the recombinant vector pCambia1301-35SN, and the rice was transformed using Agrobacterium to obtain transgenic plants to enhance rice blast resistance.
It improves the broad-spectrum resistance of rice to rice blast, provides important genetic resources, and provides a theoretical basis for green prevention and control of rice blast.
Smart Images

Figure CN115433264B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a rice disease-resistant gene LBRW1, a recombinant vector, a recombinant engineering bacterium and applications thereof. Background Art
[0002] Rice is one of the most important food crops in the world, and more than half of the global population mainly relies on rice as their staple food. During the rice production process, diseases caused by fungi seriously threaten the safe production of rice, not only reducing the rice yield, but also increasing the planting cost. Among them, rice blast caused by Magnaporthe grisea is known as the "cancer" of rice, which can lead to a serious reduction in rice yield and even a complete harvest failure. The rice blast pathogen can infect all above-ground organs of rice at all growth stages, including leaves, leaf sheaths, nodes, stems, spikelets, and even the roots of rice. At present, even when disease-resistant varieties are widely planted, the annual loss of rice yield caused by rice blast still accounts for 10% - 30% of the world's annual rice yield loss.
[0003] Common methods for controlling rice blast mainly include using fungicides, adopting agronomic measures, and cultivating resistant varieties. However, the overuse of pesticides to control plant diseases has seriously polluted the global environment. Therefore, cultivating and popularizing resistant varieties has become the most economical, safe and effective control measure. However, the rice blast pathogen strains mutate rapidly, often resulting in a reduction or loss of resistance in newly popularized resistant varieties after several years of application.
[0004] At present, 37 rice blast-resistant genes have been cloned, but most of the resistance genes have a narrow resistance spectrum and can only specifically have a certain resistance to individual physiological races of the rice blast pathogen. However, the rice blast pathogen often mutates, easily leading to the loss of resistance in resistant varieties. Therefore, new broad-spectrum disease-resistant genes, especially rice blast-resistant genes, are urgently needed to be explored, so as to provide important gene resources for the green prevention and control of rice blast through resistance breeding. Summary of the Invention
[0005] The purpose of the present invention is to provide a rice disease-resistant gene LBRW1, a recombinant vector, a recombinant engineering bacterium and applications thereof, to make up for the deficiencies of existing rice blast-resistant genes. Applying it to rice can improve the disease resistance of rice, especially the resistance to rice blast caused by Magnaporthe grisea, and thus can provide important gene resources for the green prevention and control of rice blast through resistance breeding.
[0006] The present invention solves its technical problems by adopting the following technical solutions.
[0007] The present invention provides a rice disease-resistant gene LBRW1, and the coding region sequence of the rice disease-resistant gene is shown as SEQ ID NO: 1.
[0008] Optionally, the amino acid sequence encoded by the rice disease-resistant gene LBRW1 is as shown in SEQ ID NO: 2.
[0009] The present invention provides a recombinant vector containing the above-mentioned rice disease-resistant gene LBRW1.
[0010] Optionally, the vector is pCambia1301-35SN.
[0011] The present invention provides a recombinant engineering bacterium containing the above-mentioned rice disease-resistant gene LBRW1.
[0012] The present invention provides the application of the above-mentioned rice disease-resistant gene LBRW1 in improving the resistance of rice to rice blast.
[0013] Optionally, the above-mentioned application includes the following steps:
[0014] S1. Clone the rice disease-resistant gene LBRW1 into the pCambia1301-35SN vector to obtain an expression vector;
[0015] S2. After transforming the expression vector into Agrobacterium, use the transformed Agrobacterium to infect and transform rice to obtain transgenic plants.
[0016] Optionally, the variety of the rice is C105TTP-4L-23.
[0017] The beneficial effects of the rice disease-resistant gene LBRW1, recombinant vector, recombinant engineering bacterium and application in the embodiments of the present invention are as follows:
[0018] The rice disease-resistant gene LBRW1 provided by the present invention is cloned from rice for the first time. Its CDS sequence is 3612 bp long and encodes a protein of 1203 amino acids. Analysis and prediction with the CDD online program found that this protein includes NB-ARC and RX-CC domains. By comparing the rice blast disease incidence of overexpression transgenic plants and wild-type Nipponbare under the infection of Magnaporthe oryzae, the present invention found that the LBRW1 gene can improve the rice blast resistance of rice. Applying it to the field of genetic engineering has important economic value and application prospects, and thus can provide a theoretical basis for the breeding of new rice varieties with broad-spectrum resistance to rice blast. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.
[0020] Figure 1 Prediction map of the conserved domain of the protein encoded by the rice disease-resistant gene LBRW1 in Example 1 of the present invention;
[0021] Figure 2 Comparison diagram of leaves of wild-type Nipponbare rice, transgenic Nipponbare rice and CO39 rice inoculated with Magnaporthe oryzae for 7 days in Example 3 of the present invention;
[0022] Figure 3 Comparison diagram of the lesion areas of leaves of wild-type Nipponbare rice, transgenic Nipponbare rice and CO39 rice inoculated with Magnaporthe oryzae for 7 days in Example 3 of the present invention. Detailed implementation manners
[0023] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they shall be carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not indicated with the manufacturer, they are all conventional products that can be obtained through commercial purchase.
[0024] The rice disease-resistant gene LBRW1, recombinant vector, recombinant engineering bacteria and applications of the embodiments of the present invention will be specifically described below.
[0025] The present invention provides a rice disease-resistant gene LBRW1, and the coding region sequence of the rice disease-resistant gene LBRW1 is shown in SEQ ID NO: 1. Through sequencing, it is known that the CDS of the LBRW1 gene is 3612 bp long, and it can encode a protein of 1203 amino acids. The inventors found through research that this gene can improve the ability of rice to resist rice blast caused by Magnaporthe oryzae.
[0026] Furthermore, in a preferred embodiment of the present invention, the amino acid sequence encoded by the rice disease-resistant gene LBRW1 is shown in SEQ ID NO: 2. Through prediction of the protein conserved domain, it is found that this protein contains an NB-ARC domain and an RX-CC conserved domain.
[0027] The present invention proposes a recombinant vector containing the above-mentioned rice disease-resistant gene.
[0028] Furthermore, in a preferred embodiment of the present invention, the vector is pCambia1301-35SN.
[0029] The present invention proposes a recombinant engineering bacterium containing the above-mentioned rice disease-resistant gene LBRW1.
[0030] The present invention also proposes the application of the above-mentioned rice disease-resistant gene LBRW1 in improving the resistance of rice to rice blast.
[0031] Further, in a preferred embodiment of the present invention, the application as described above includes the following steps:
[0032] S1. Clone the rice disease-resistant gene LBRW1 into the pCambia1301-35SN vector to obtain an expression vector.
[0033] S2. After transforming the expression vector into Agrobacterium, use the transformed Agrobacterium to infect and transform rice to obtain transgenic plants.
[0034] Further, in a preferred embodiment of the present invention, the variety of the rice is C105TTP-4L-23. Of course, it should be noted that the LBRW1 gene of the present invention can also be used to transform other varieties of rice to obtain transgenic plants with blast resistance, and the present invention does not make specific limitations.
[0035] The present invention uses the Agrobacterium-mediated transformation method to transform Nipponbare to obtain transgenic plants. By studying the disease resistance of transgenic plants and wild-type Nipponbare, it can be seen that the LBRW1 gene can improve the disease resistance of rice, especially the disease resistance to blast. Applying it to the field of genetic engineering has great economic value and application prospects.
[0036] The following further describes the features and performance of the present invention in conjunction with embodiments.
[0037] In the following embodiments, the rice disease-resistant gene LBRW1 is simply referred to as LBRW1.
[0038] Example 1
[0039] This example provides a cloning method for the rice disease-resistant gene LBRW1, including the following steps:
[0040] (1) Design a pair of specific primers LBRW1-F (CGGTGGCGGCCGCTCTAGAGCCACCATGGAGGGC TCCATGTTCAACC) and LBRW1-R (GGGGATCCACTAGTTCTAGCTACGATT TGGGGGCCCAGTTTG) according to the annotation information of LBRW1 (GenBank: BK005062.1).
[0041] (2) Extract the total RNA from the leaves of rice C105TTP-4L-23 (provided by the Key Laboratory of Crop Genetics and Breeding and Comprehensive Utilization, Ministry of Education, Fujian Agriculture and Forestry University), reverse transcribe it into cDNA as the PCR reaction template, perform PCR amplification with the above primers, and clone and sequence the PCR products, specifically including the following steps:
[0042] Extract the total RNA of 2-week-old rice C105TTP-4L-23 leaves according to the operation procedure of the RNA extraction kit (Takara 9767). Then reverse transcribe the RNA into cDNA using the reverse transcription kit (Takara AT311). Use LBRW1-F and LBRW1-R as primers and cDNA as a template to perform PCR according to the system in Table 1. The reaction program is: pre-denaturation at 98°C for 2 min → (denaturation at 98°C for 10 s → annealing at 60°C for 15 s → extension at 72°C for 4 min) for 30 cycles → extension at 72°C for 10 min → store at 4°C. Finally, send the PCR product to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0043] Table 1 PCR reaction system for amplifying the LBRW1 gene
[0044]
[0045] The sequencing results showed that the CDS of the rice LBRW1 gene is 3612 bp in length and encodes a protein of 1203 amino acids. Analyzing the structure of the LBRW1 protein using the CDD tool of NCBI found that the protein contains an NB-ARC domain and an RX-CC conserved domain ( Figure 1 as shown).
[0046] Example 2
[0047] In this example, a construction of rice resistant to Magnaporthe oryzae is provided. Among them, Nipponbare is provided by the Key Laboratory of Crop Genetics and Breeding and Comprehensive Utilization, Ministry of Education, Fujian Agriculture and Forestry University, and Agrobacterium EHA105 can be purchased from Shanghai Vidy Biotechnology Co., Ltd. It includes the following steps:
[0048] (1) Connect the LBRW1 gene obtained in Example 1 to the pCambia1301-35SN vector, which specifically includes the following steps:
[0049] Connect the sequence cloned by LBRW1-F and LBRW1-R primers to the backbone of the pCambia1301-35SN vector digested with XbaⅠ through Takara's infusion kit. After screening on a kanamycin plate, perform colony PCR identification and send the positive clone for sequencing. This part is entrusted to Sangon Biotech (Shanghai) Co., Ltd. After it is correct, extract the plasmid and transform Agrobacterium EHA105.
[0050] (2) Use the Agrobacterium-mediated method to transform Nipponbare with the positive vector pCambia1301-35SN-LBRW1 to obtain a transgenic plant LBRW1-OE with stable expression. The specific steps are as follows:
[0051] Take mature rice seeds, soak and disinfect them with 2.5% sodium hypochlorite for 30 min, wash them 5 times with sterile water, and then inoculate the disinfected seeds onto the callus induction medium and culture them under light at 28 °C for 7 d.
[0052] Immerse the rice callus in the correctly identified Agrobacterium liquid for 10 min, then blot the surface liquid dry with sterile filter paper and inoculate it onto the co-culture medium; immerse the infected callus in a 500 mg / L carbenicillin solution and soak for 15 min, repeat twice, blot the surface moisture of the callus dry with filter paper and inoculate it onto the selection medium.
[0053] Subculture the newly grown resistant callus pieces onto the bud induction medium and culture them under light at 30 °C until adventitious buds grow out; then subculture the adventitious buds onto the rooting medium and culture them under light at 30 °C until most adventitious roots grow out on the seedlings; finally, take out the rooted seedlings, wash the medium, immerse the roots of the seedlings in sterile water for acclimatization for 3 - 7 d, and then transplant them into the field or greenhouse to obtain transgenic Nipponbare.
[0054] Example 3
[0055] This example provides the identification of blast resistance of wild-type Nipponbare, transgenic Nipponbare and CO39 rice, including the following steps:
[0056] Respectively take transgenic (3 lines) Nipponbare seeds, wild-type Nipponbare seeds and control CO39 rice seeds (provided by the Key Laboratory of Crop Genetics and Breeding and Comprehensive Utilization, Ministry of Education, Fujian Agriculture and Forestry University), immerse them in water for germination for 2 - 3 d, and then sow them in small flower pots. Culture the rice seedlings in a greenhouse with a light intensity of 10000 Lx, a photoperiod of 14 h light / 10 h dark, and a temperature of 28 °C until the rice grows to three leaves and one heart or four leaves and one heart. Among them, the transgenic Nipponbare rice are OE-1, OE-2 and OE-3 respectively. Then spray a spore suspension of Magnaporthe oryzae (GUY11) with a concentration of 1.0×10 5 ~2.0×10 5 spores / mL evenly onto the rice leaves with a high-pressure atomizer. The inoculated seedlings are placed in a dark incubator at a humidity higher than 90% and a temperature of 26 °C for 24 h, and then the photoperiod is changed to 12 h light / 12 h dark and cultured for another 7 d.
[0057] As Figure 2 shown is the comparison diagram of the leaves of wild-type Nipponbare, transgenic Nipponbare and CO39 rice 7 days after inoculation with Magnaporthe oryzae. As Figure 2 can be seen, 7 d after inoculation with Magnaporthe oryzae, it is found that the lesion areas on the leaves of overexpressing transgenic (LBRW1-OE) rice are significantly less than those of wild-type Nipponbare. At the same time, when analyzing the lesion areas with ImageJ software, it is found that the lesion areas of wild-type Nipponbare are higher than those of overexpressing transgenic rice (asFigure 3 As shown in Figure 3 , it shows that the LBRW1 gene can enhance the resistance of rice to Magnaporthe oryzae.
[0058] The embodiments described above are some embodiments of the present invention, rather than all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely represents selected embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention. SEQUENCE LISTING <110> Putian University <120> A rice disease-resistant gene LBRW1, recombinant vector, recombinant engineering bacterium and application <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 3612 <212> DNA <213> Rice C105TTP-4L-23 <400> 1 atggagggct ccatgttcaa cctcccagga aggctcgacc ggctcctgtg tcgtcatggc 60 agcatgctgc ccaagggggc agaggaggag atacctctca tcaagcaaga tctcgaggaa 120 ataatctccg tcctccatgg tcactgtagc gagccaaagc tggaggacca tgccatggtg 180 gtcaggtgct ggatgaagga ggtacgtgag ctctcttatg acatcgagga ttgcatcgac 240 cagtatgagc atgccgccac tgccacccgg tcacatactg gacctaatat ttgtcgccgt 300 aagttcaatc agcggcatgg aaagatgatc ccttgggttc cctggaaact taagcagcgg 360 ttgtggatgg ccaacaagat cagagaattc agcctgcgca cccaggaggc gcttcaacgc 420 cacaccatgt acaacaacct tggtggcatc accattgctt caactactgg aggagatgta 480 tgctctgcaa caccttggca tcccacgcag ttcagagagc acaccgacaa cgtctgttct 540 gtcagtatag acgccgatgg tatggaagct gccctgaatg acctgaacaa gctcaaaaac 600 ttgctcgcta gtatcccgac tgcttctctc gtgcagttca gggagcacgc caataaagtg 660 cgtcatatcc accccgatat ggaagccatc ctgaagaagc tcaaaaacat acccactggt 720 atcaccacta cttctactac cactagaggt gatgtatctt ctacctcatc taggcaaccc 780 acgcggttca tggagtccgt gggtcttgtt ggcatcgacg ccgcggtgaa caagcttgaa 840 aacttgctcg atgtgtgtgg agaggagaag ctcaaggtgg tgtccatcgt gggagttgga 900 ggagttggca agactacgct cgccaacaag ctgtactgca agcttcagcg gcagttcgag 960 tgccgggcat ttgtgcagac atctcagaag actgatatga ggaggcttct catcaatatc 1020 ctctcacagg ttcagccgca ccagtcacct gacaattgga aggtgcatag cctaatttcc 1080 agtatcagga cacatctgca agataagagg tacttgatca taattgatgg tttatgggct 1140 acatccacat gggatgttat taagtgcgct ttgccggatg gtaatagttc cagcagaata 1200 ctaaccacaa cagaaattga ggatctagct ttgcaatctt gtagttatga cttgaaattt 1260 attttcaaga tgaaaccttt tggtgagggt gactcaagaa aactattttt cagtatagtc 1320 tttggctctc attctaagtg tcctccagaa gtcagtgaaa cattatatga tattgtaagg 1380 aaatgtggtg gtttgccgct agctattgtc actgttgcta gtattttagc aagccagctt 1440 gagaaacaag aacaatggga ttatataaac aaatccttag gttacggttt gatggcaaat 1500 cctactttgg aagggatgaa acaactactg aacatttgtt acaacaatct tcctcagcat 1560 ttgaaggtat gcatgttgta tcttagtatg tatcaagaag atcacataat ttggaaagat 1620 gatttagtga gtcaatggat agctgaaggt tttatctgtg caactgaagg gcatgacaag 1680 gaagaaattt caagggccta ttttgatgag cttgtgggca gaaaaatcat ccagcctgta 1740 catatcgatg acagtggtga ggttttgtcc tgtgtagttc accatatggt actcaatttc 1800 gttacataca agtcaataga agaaaatttt attattgcaa tagaccattc acaggcaact 1860 ataagatttg ctgacaaggt tcgacgatta tctatccact ttagtaacgt agaagatgca 1920 actccgccta ccagtatgag attgtcccaa gttcggacag ttgccttctt cggggtcttg 1980 aagtatatgc ctttcgttat ggagtttcga cttattaaag ttctagttct acatattttg 2040 ggtgatgagg atagcatagg catttttgat ctcactaaaa tttcagaact tgttcgactg 2100 agatatttga aggtcacctc taatgtcacc gtaaaactgc caacccagat gcaaggtcta 2160 ccatatttgg agacactgaa aatagatggg acaataagtg aagttccaac agacatttat 2220 ttgccaggtt tgctgcatct tactcttcct gctaagacaa acctgcccag tggaattgtc 2280 cacatgacat cgcttcgtac aattggatat tttgatctca gctgtaactc agcggagaat 2340 ctatggagcc ttggtgagct gagcaatctc cgggatttgc agctcaccta ttctgaaata 2400 cattctgaca atctgaagga taatatgaaa tatcttggat ccattctggg gaaactccgt 2460 aatctcacat ctataacttt atcgcctcct ggctcttcct gtccagatac tctacatatt 2520 gacagggata caaagacgag gatcaatgtt gatggctgga gcagtgtgtc ctctccacca 2580 gcccttcttc agaggtttga gttgttacca tgtgtttgca tcttttctaa cctcccaaat 2640 tggattgggc agcttggaaa cctctgcatt ttgaagattg ggataaggga agtaacaagt 2700 aatagtattg atgttctagg agtattaccg aaactcactg ttttgtcact ttatgtccac 2760 acaaagcctg cagaaaggat tgtctttgac aatgcagggt tctcaatcct caaatacttc 2820 gagtttatat gcagtgtagc atggatgaaa tttgagatgg gtgcaatgcc tagtctaagg 2880 aagctcaagc taggttttga tgtccataga gcagatcagc atgatattat tcctgttggc 2940 atcgaacatc tgtctggact tgaagagatc tctgcaaaaa ttagggtcgc ctatactgct 3000 catgatcatt gtagaagatt tgcagagtca gctttgacta acgcctttat gatgcatcca 3060 ggacgtccta gcgtcaacat acggtgtgtg gattggacct ttcatgataa ggataatgac 3120 tgtgtgggga cacgagagga agaatgtagg actccaatga aacaggagca ttttgtgaaa 3180 gaagacttaa gtgagaaatc tgcagttcta caaaacgagc acgacgaaga agcacataaa 3240 tttgttgaca gaagatatta ttccatcatg gacgcggcag agatccgcag gtgtccgtgg 3300 agcatcaacg aggagcagga gcagccggtg ttgatctacg acgccagaac caagatttcc 3360 cagtcgttgt ccatgcacgg cgaattctgg gcggccgtcc aacggctcac cggcccagct 3420 gccacgccgg ccaagaccaa gaggcacctc cacctgacga cctcgcctga gctggaggac 3480 ggcttcttgc cggtacgtag tctcgtcttc ccgtccgctc cggatccacg gtgcaacatg 3540 aagaagaaga tgacgagggc cggccctgga gggggtcgag cagtgtggtc gaactgggcc 3600 cccaaatcgt ag 3612 <210> 2 <211> 1203 <212> PRT <213> Rice C105TTP-4L-23 <400> 2 Met Glu Gly Ser Met Phe Asn Leu Pro Gly Arg Leu Asp Arg Leu Leu 1 5 10 15 Cys Arg His Gly Ser Met Leu Pro Lys Gly Ala Glu Glu Glu Ile Pro 20 25 30 Leu Ile Lys Gln Asp Leu Glu Glu Ile Ile Ser Val Leu His Gly His 35 40 45 Cys Ser Glu Pro Lys Leu Glu Asp His Ala Met Val Val Arg Cys Trp 50 55 60 Met Lys Glu Val Arg Glu Leu Ser Tyr Asp Ile Glu Asp Cys Ile Asp 65 70 75 80 Gln Tyr Glu His Ala Ala Thr Ala Thr Arg Ser His Thr Gly Pro Asn 85 90 95 Ile Cys Arg Arg Lys Phe Asn Gln Arg His Gly Lys Met Ile Pro Trp 100 105 110 Val Pro Trp Lys Leu Lys Gln Arg Leu Trp Met Ala Asn Lys Ile Arg 115 120 125 Glu Phe Ser Leu Arg Thr Gln Glu Ala Leu Gln Arg His Thr Met Tyr 130 135 140 Asn Asn Leu Gly Gly Ile Thr Ile Ala Ser Thr Thr Gly Gly Asp Val 145 150 155 160 Cys Ser Ala Thr Pro Trp His Pro Thr Gln Phe Arg Glu His Thr Asp 165 170 175 Asn Val Cys Ser Val Ser Ile Asp Ala Asp Gly Met Glu Ala Ala Leu 180 185 190 Asn Asp Leu Asn Lys Leu Lys Asn Leu Leu Ala Ser Ile Pro Thr Ala 195 200 205 Ser Leu Val Gln Phe Arg Glu His Ala Asn Lys Val Arg His Ile His 210 215 220 Pro Asp Met Glu Ala Ile Leu Lys Lys Leu Lys Asn Ile Pro Thr Gly 225 230 235 240 Ile Thr Thr Thr Ser Thr Thr Thr Arg Gly Asp Val Ser Ser Thr Ser 245 250 255 Ser Arg Gln Pro Thr Arg Phe Met Glu Ser Val Gly Leu Val Gly Ile 260 265 270 Asp Ala Ala Val Asn Lys Leu Glu Asn Leu Leu Asp Val Cys Gly Glu 275 280 285 Glu Lys Leu Lys Val Val Ser Ile Val Gly Val Gly Gly Val Gly Lys 290 295 300 Thr Thr Leu Ala Asn Lys Leu Tyr Cys Lys Leu Gln Arg Gln Phe Glu 305 310 315 320 Cys Arg Ala Phe Val Gln Thr Ser Gln Lys Thr Asp Met Arg Arg Leu 325 330 335 Leu Ile Asn Ile Leu Ser Gln Val Gln Pro His Gln Ser Pro Asp Asn 340 345 350 Trp Lys Val His Ser Leu Ile Ser Ser Ile Arg Thr His Leu Gln Asp 355 360 365 Lys Arg Tyr Leu Ile Ile Ile Asp Gly Leu Trp Ala Thr Ser Thr Trp 370 375 380 Asp Val Ile Lys Cys Ala Leu Pro Asp Gly Asn Ser Ser Ser Arg Ile 385 390 395 400 Leu Thr Thr Thr Glu Ile Glu Asp Leu Ala Leu Gln Ser Cys Ser Tyr 405 410 415 Asp Leu Lys Phe Ile Phe Lys Met Lys Pro Phe Gly Glu Gly Asp Ser 420 425 430 Arg Lys Leu Phe Phe Ser Ile Val Phe Gly Ser His Ser Lys Cys Pro 435 440 445 Pro Glu Val Ser Glu Thr Leu Tyr Asp Ile Val Arg Lys Cys Gly Gly 450 455 460 Leu Pro Leu Ala Ile Val Thr Val Ala Ser Ile Leu Ala Ser Gln Leu 465 470 475 480 Glu Lys Gln Glu Gln Trp Asp Tyr Ile Asn Lys Ser Leu Gly Tyr Gly 485 490 495 Leu Met Ala Asn Pro Thr Leu Glu Gly Met Lys Gln Leu Leu Asn Ile 500 505 510 Cys Tyr Asn Asn Leu Pro Gln His Leu Lys Val Cys Met Leu Tyr Leu 515 520 525 Ser Met Tyr Gln Glu Asp His Ile Ile Trp Lys Asp Asp Leu Val Ser 530 535 540 Gln Trp Ile Ala Glu Gly Phe Ile Cys Ala Thr Glu Gly His Asp Lys 545 550 555 560 Glu Glu Ile Ser Arg Ala Tyr Phe Asp Glu Leu Val Gly Arg Lys Ile 565 570 575 Ile Gln Pro Val His Ile Asp Asp Ser Gly Glu Val Leu Ser Cys Val 580 585 590 Val His His Met Val Leu Asn Phe Val Thr Tyr Lys Ser Ile Glu Glu 595 600 605 Asn Phe Ile Ile Ala Ile Asp His Ser Gln Ala Thr Ile Arg Phe Ala 610 615 620 Asp Lys Val Arg Arg Leu Ser Ile His Phe Ser Asn Val Glu Asp Ala 625 630 635 640 Thr Pro Pro Thr Ser Met Arg Leu Ser Gln Val Arg Thr Val Ala Phe 645 650 655 Phe Gly Val Leu Lys Tyr Met Pro Phe Val Met Glu Phe Arg Leu Ile 660 665 670 Lys Val Leu Val Leu His Ile Leu Gly Asp Glu Asp Ser Ile Gly Ile 675 680 685 Phe Asp Leu Thr Lys Ile Ser Glu Leu Val Arg Leu Arg Tyr Leu Lys 690 695 700 Val Thr Ser Asn Val Thr Val Lys Leu Pro Thr Gln Met Gln Gly Leu 705 710 715 720 Pro Tyr Leu Glu Thr Leu Lys Ile Asp Gly Thr Ile Ser Glu Val Pro 725 730 735 Thr Asp Ile Tyr Leu Pro Gly Leu Leu His Leu Thr Leu Pro Ala Lys 740 745 750 Thr Asn Leu Pro Ser Gly Ile Val His Met Thr Ser Leu Arg Thr Ile 755 760 765 Gly Tyr Phe Asp Leu Ser Cys Asn Ser Ala Glu Asn Leu Trp Ser Leu 770 775 780 Gly Glu Leu Ser Asn Leu Arg Asp Leu Gln Leu Thr Tyr Ser Glu Ile 785 790 795 800 His Ser Asp Asn Leu Lys Asp Asn Met Lys Tyr Leu Gly Ser Ile Leu 805 810 815 Gly Lys Leu Arg Asn Leu Thr Ser Ile Thr Leu Ser Pro Pro Gly Ser 820 825 830 Ser Cys Pro Asp Thr Leu His Ile Asp Arg Asp Thr Lys Thr Arg Ile 835 840 845 Asn Val Asp Gly Trp Ser Ser Val Ser Ser Pro Pro Ala Leu Leu Gln 850 855 860 Arg Phe Glu Leu Leu Pro Cys Val Cys Ile Phe Ser Asn Leu Pro Asn 865 870 875 880 Trp Ile Gly Gln Leu Gly Asn Leu Cys Ile Leu Lys Ile Gly Ile Arg 885 890 895 Glu Val Thr Ser Asn Ser Ile Asp Val Leu Gly Val Leu Pro Lys Leu 900 905 910 Thr Val Leu Ser Leu Tyr Val His Thr Lys Pro Ala Glu Arg Ile Val 915 920 925 Phe Asp Asn Ala Gly Phe Ser Ile Leu Lys Tyr Phe Glu Phe Ile Cys 930 935 940 Ser Val Ala Trp Met Lys Phe Glu Met Gly Ala Met Pro Ser Leu Arg 945 950 955 960 Lys Leu Lys Leu Gly Phe Asp Val His Arg Ala Asp Gln His Asp Ile 965 970 975 Ile Pro Val Gly Ile Glu His Leu Ser Gly Leu Glu Glu Ile Ser Ala 980 985 990 Lys Ile Arg Val Ala Tyr Thr Ala His Asp His Cys Arg Arg Phe Ala 995 1000 1005 Glu Ser Ala Leu Thr Asn Ala Phe Met Met His Pro Gly Arg Pro 1010 1015 1020 Ser Val Asn Ile Arg Cys Val Asp Trp Thr Phe His Asp Lys Asp 1025 1030 1035 Asn Asp Cys Val Gly Thr Arg Glu Glu Glu Cys Arg Thr Pro Met 1040 1045 1050 Lys Gln Glu His Phe Val Lys Glu Asp Leu Ser Glu Lys Ser Ala 1055 1060 1065 Val Leu Gln Asn Glu His Asp Glu Glu Ala His Lys Phe Val Asp 1070 1075 1080 Arg Arg Tyr Tyr Ser Ile Met Asp Ala Ala Glu Ile Arg Arg Cys 1085 1090 1095 Pro Trp Ser Ile Asn Glu Glu Gln Glu Gln Pro Val Leu Ile Tyr 1100 1105 1110 Asp Ala Arg Thr Lys Ile Ser Gln Ser Leu Ser Met His Gly Glu 1115 1120 1125 Phe Trp Ala Ala Val Gln Arg Leu Thr Gly Pro Ala Ala Thr Pro 1130 1135 1140 Ala Lys Thr Lys Arg His Leu His Leu Thr Thr Ser Pro Glu Leu 1145 1150 1155 Glu Asp Gly Phe Leu Pro Val Arg Ser Leu Val Phe Pro Ser Ala 1160 1165 1170 Pro Asp Pro Arg Cys Asn Met Lys Lys Lys Met Thr Arg Ala Gly 1175 1180 1185 Pro Gly Gly Gly Arg Ala Val Trp Ser Asn Trp Ala Pro Lys Ser 1190 1195 1200
Claims
1. A rice disease-resistant gene LBRW1, characterized in that, The coding region sequence of the rice disease resistance gene LBRW1 is shown in SEQ ID NO:
1.
2. The rice disease-resistant gene according to claim 1, characterized in that, The amino acid sequence encoded by it is shown in SEQ ID NO:
2.
3. A recombinant vector containing the rice disease resistance gene LBRW1 as described in claim 1.
4. The recombinant vector according to claim 3, characterized in that, The vector is pCambia1301-35SN.
5. A recombinant engineering bacterium containing the rice disease resistance gene LBRW1 as described in claim 1.
6. Use of the rice disease resistance gene LBRW1 as described in claim 1 in improving the blast resistance of rice.
7. The application according to claim 6, characterized in that, It includes the following steps: S1. Clone the rice disease resistance gene LBRW1 into the pCambia1301-35SN vector to obtain an expression vector; S2. After transforming the expression vector into Agrobacterium, use the transformed Agrobacterium to infect and transform rice to obtain transgenic plants.