Molecular markers linked to cold tolerance in maize and their application
By developing the linked molecular marker ZmRR1 for maize cold tolerance and its primer pairs, the problem of time-consuming and laborious identification of maize cold tolerance in existing technologies has been solved, enabling early, rapid, and accurate identification of maize cold tolerance and promoting the breeding process.
Patent Information
- Application Number
- CN202110638947.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-06-08
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2041-06-08
AI Technical Summary
Existing technologies make it difficult to effectively use molecular markers to quickly identify maize cold tolerance, resulting in a time-consuming and labor-intensive breeding process, and a lack of accurate early prediction methods.
A molecular marker ZmRR1 linked to maize cold tolerance and its primer pair were developed. Maize cold tolerance was identified by PCR amplification, and ZmRR1-InDel deletion was used as a molecular marker to determine whether maize was cold-tolerant.
This technology enables rapid and accurate identification of cold tolerance in the early stages of maize seed development, significantly accelerating the breeding process for cold-tolerant maize varieties.
Smart Images

Figure BDA0003106930690000051 
Figure BDA0003106930690000061 
Figure BDA0003106930690000071
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular markers, in particular, to a molecular marker linked to corn cold tolerance and application thereof. BACKGROUND
[0002] Corn has large yield and demand, but corn is a warm C4 crop and is extremely sensitive to temperature. Corn is prone to cold injury. Cold injury can cause abnormality of membrane structure, photosynthetic organs and reproductive organs, etc., and affect physiological metabolism of corn plants. At the same time, cold injury can also produce harmful substances, affecting the growth and development of corn and leading to yield reduction. Cold injury is one of the most important abiotic stresses of crops.
[0003] Previous studies have shown that the cold tolerance of different corn inbred lines is significantly different, and it is generally believed that the difference is a comprehensive reflection of multiple cold tolerance physiological traits and is a quantitative trait controlled by multiple genes. On this basis, some studies have attempted to explore related genes through GWAS analysis and QTL analysis, but most studies have stopped at preliminary positioning or candidate genes, and the development of corn cold tolerance molecular markers will provide a more convenient means for breeding corn varieties with cold tolerance. Therefore, it is necessary to further study the corn cold tolerance molecular markers. SUMMARY
[0004] The purpose of the present application is to provide a molecular marker linked to corn cold tolerance and an application method thereof.
[0005] Specifically, the technical solutions of the present application are as follows:
[0006] In a first aspect, the present application provides a molecular marker linked to corn cold tolerance, and the molecular marker is ZmRR1. The molecular marker ZmRR1 can be amplified by a primer pair as shown in SEQ ID NO. 1-2.
[0007] In a second aspect, the present application provides a primer for amplifying the above-mentioned molecular marker.
[0008] The primer comprises a sequence as shown in SEQ ID NO. 1-2.
[0009] In a third aspect, the present application provides a reagent or kit containing the above-mentioned primer.
[0010] In a fourth aspect, the present application provides any one of the following applications of the above-mentioned molecular marker or primer or reagent or kit:
[0011] (1) application in identifying the phenotype of corn cold tolerance traits;
[0012] (2) application in corn germplasm resource identification, improvement or molecular marker assisted breeding;
[0013] (3) application in early prediction of corn cold tolerance traits;
[0014] (4) application in screening or creating corns with different corn cold tolerance traits;
[0015] (5) application in corn cold tolerance genotyping.
[0016] In the fifth aspect, the present application provides a method for identifying the phenotype of corn cold tolerance traits, which comprises:
[0017] (1) extracting DNA of corn to be identified;
[0018] (2) using the primers shown in SEQ ID NO. 1-2 to perform PCR amplification with the DNA as a template;
[0019] (3) judging the phenotype of corn cold tolerance traits to be identified according to the size of the DNA fragment in the PCR amplification product.
[0020] The method for judging the phenotype of corn cold tolerance traits to be identified in the step (3) of the method is as follows: when no DNA amplification fragment is obtained in the product after PCR amplification using the primers shown in SEQ ID NO. 1-2, the corn to be identified has high cold tolerance.
[0021] If a 143bp fragment (containing the nucleotide sequence shown in SEQ ID No. 4) is obtained after primer amplification, the corn to be identified is likely to be cold sensitive.
[0022] The present application has at least the following beneficial effects:
[0023] In the cold tolerance ZmRR1 gene, the present application identifies a small fragment located in the insertion or deletion of its exon, which is linked to corn cold tolerance. The insertion or deletion of the fragment can be used as a corn cold tolerance molecular marker. The present application also provides a primer pair for detecting the corn cold tolerance molecular marker of the present application and a method for detecting whether corn is cold tolerant.
[0024] Since corn cold tolerance is a quantitative trait, phenotype analysis is time-consuming and laborious. The above-mentioned molecular markers and primer pairs can be applied to corn cold tolerance breeding, and can be identified during corn seed or at the early stage of cotyledon growth, which is time-saving and accurate, and can accelerate the process of corn cold tolerance variety breeding. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1A in the table is the relative leaf injury correlation analysis of ZmRR1 natural variation in 161 maize inbred lines and low temperature stress, wherein, Zm00001d001865 represents the gene number of ZmRR1 in maize GDB V4 library; Indel-35 represents ZmRR1-InDel of the application; according to Indel35 (45bp insertion and deletion) in A, 161 maize inbred lines are divided into two haplotypes of Hap.A and Hap.B.
[0026] Figure 1 B in the table is the comparison result of leaf injury of ZmRR1-InDel deletion maize inbred lines (Hap.A cold-resistant genotype) and maize inbred lines without ZmRR1-InDel deletion (Hap.B may be cold-sensitive type), wherein, the ordinate is the proportion of injured area.
[0027] Figure 2 Part of the 45bp nucleotide sequence between the difference between the resistant and sensitive materials (such as B111 and B73) is identified, and its effect on ZmRR1 reading frame and amino acid is identified.
[0028] Figure 3 It is the result of PCR amplification in B111 and B73 using primer pair I; wherein, Marker is 2000bp marker of molecular weight standard of Agilent. DETAILED DESCRIPTION
[0029] The preferred embodiments of the application will be described in detail below with reference to the examples. It should be understood that the following examples are given only to illustrate the application and are not intended to limit the scope of the application. Those skilled in the art can make various modifications and replacements to the application without departing from the spirit and principles of the application.
[0030] The following examples are used to illustrate the application, but not to limit the scope of the application. If not specifically indicated, the equipment and reagents used in each example are commonly available on the market.
[0031] Example 1
[0032] The present application screened 700 transgenic overexpression lines of genes for low temperature phenotype at seedling stage, and a series of overexpression lines with different degrees of difference compared with wild type were obtained after screening, and finally one of the genes (ZmRR1 gene) was selected for further experiment. It was found that overexpression of ZmRR1 gene showed a more cold-resistant phenotype than wild type, and the coding region length of the gene was 471bp (see SEQ ID No. 3 for detailed sequence).
[0033] In order to screen DNA sequence variation suitable for cold tolerance molecular marker, the coding region and 5'UTR of ZmRR1 of 161 maize inbred lines from different temperature zones were resequenced (471 bp of coding region and 74 bp of 5'UTR were included). A total of 23 natural variations (non-synonymous mutations) were identified, including 20 SNP sites and 3 InDels (MAF≥5%). Association analysis (TASSEL3.0) of the natural variations and leaf injury of different maize inbred lines at low temperature showed that a 45 bp insertion / deletion had the highest correlation with leaf injury (-log 10 (P)≥4.0), see Table 1 and Table 2. Figure 1 The insertion / deletion fragment was named ZmRR1-InDel.
[0034] The DNA of 161 maize inbred lines from different temperature zones (publicly disclosed in Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels, 2013, Nature Genet 45:1) was sequenced by using Illumina sequencing platform (sequencing was completed by Beijing Huada Science and Technology Co., Ltd.), and it was found by sequencing data comparison and analysis that the 45 bp fragment of ZmRR1 gene was deleted in 15 cold-tolerant inbred lines represented by B111. Identification of the 45 bp nucleotide sequence different between some resistant materials and its effect on the reading frame of ZmRR1 and amino acid are shown in Table 3. Figure 2
[0035] The cold tolerance phenotype test of the above-mentioned 161 maize inbred lines was as follows:
[0036] The 161 maize inbred lines grown at 25°C for 14 days were cold-treated at 4°C for 2 days, and then grown at 25°C for 2 days again. The second leaves of each inbred line were spread and stuck on A4 paper, and each inbred line had at least three technical repeats. Then the A4 paper with the leaves was photographed. The photograph was imported into the software of Image J, and the total area and the injured area were calculated to obtain the leaf injury ratio, i.e. the injured area / total area*100%. The results of three independent repeated experiments were similar. P<0.05 was significantly different. The specific test results are shown in Table 1 and Table 2. Figure 1 B. All inbred lines with the deletion of the 45 bp are cold tolerance inbred lines, and the deletion of the 45 bp results in the deletion of 15 amino acids of ZmRR1, which is suitable for molecular marker. In combination with the sequencing results, the corn inbred lines with the deletion of the 45 bp fragment are divided into Hap. A haplotype, and the corn inbred lines without the deletion of the 45 bp fragment are divided into Hap. B haplotype.
[0037] Table 1
[0038]
[0039]
[0040]
[0041]
[0042]
[0043] Example 2: Obtaining of the inserted fragment (ZmRR1-InDel) in the ZmRR1 gene ZmRR1 exon of corn
[0044] According to the sequencing results of Example 1, a pair of primers I: ZmRR1-F1 / ZmRR1-InDel-R1 is designed according to the application. The primer sequences are as follows:
[0045] ZmRR1-F1: GACTGTCTGTTTTCAGCACC (SEQ ID No. 1)
[0046] ZmRR1-InDel-R1: ACCACCGTCTTCCTGTTGTC (SEQ ID No. 2).
[0047] ZmRR1-F1 / ZmRR1-InDel-R1 as primers, the genomic DNA of B111 as a template, using Taq DNA polymerase of Polygen Technologies Co., Ltd. for amplification (PCR system 50 μl: 2x Super Multiplex PCR Mix 25 μl, 10 μM primer ZmRR1-F1 2.5 μl, 10 μM primer ZmRR1-InDel-R1 2.5 μl, DNA 2.0 μl, ddH2O 18 μl; PCR program: pre-denaturation 95℃ 2min, denaturation 95℃ 30s, annealing 58℃ 30s, extension 72℃ 30s, 34 cycles of denaturation to extension, and finally extension 72℃ 5min), the PCR product is sent to Beijing Huada Biological Technology Co., Ltd. for sequencing, and the results show that the deletion of 45 bp in B111 results in the deletion of 15 amino acids as follows: Figure 2The specific sequence of ZmRRl-InDel deletion is shown in SEQ ID No. 4.
[0048] Example 3 ZmRRl-InDel insertion or deletion in cold-tolerant gene ZmRRl as a molecular marker
[0049] Since the deletion of ZmRRl-InDel only exists in the cold-tolerant corn inbred line (such as B111), it results in the deletion of 15 amino acids encoded by the cold-tolerant gene ZmRRl, so the deletion of ZmRRl-InDel can be used as a molecular marker for determining whether an individual is cold-tolerant.
[0050] Using the primer ZmRRl-F1 (forward, SEQ ID No. 1) designed based on the flanking sequence of ZmRRl-InDel deletion and the primer ZmRRl-InDel-R1 (reverse, SEQ ID No. 2) designed based on the sequence of ZmRRl-InDel, a primer pair I was formed. The genomic DNA of the cold-tolerant corn inbred line B111 and the relatively cold-sensitive corn inbred line B73 was used as a template for PCR amplification. The PCR system was 20 μl: 2x Super Multiplex PCR Mix 10 μl, 10 μM primer ZmRRl-F1 1 μl, 10 μM primer ZmRRl-InDel-R1 1 μl, DNA 1 μl, ddH2O 7 μl. The PCR program was pre-denaturation 95 °C for 2 min, denaturation 95 °C for 30 s, annealing 58 °C for 30 s, extension 72 °C for 30 s, 34 cycles of denaturation to extension, and finally extension 72 °C for 5 min. It was found that the primer pair had no band when the total DNA of the cold-tolerant corn inbred line B111 was used as a template for PCR amplification, and the primer could amplify a 143 bp band (the detailed sequence is shown in SEQ ID No. 5) when the total DNA of the corn inbred line B73 was used as a template for PCR amplification, as shown in Figure 3 Therefore, the primer pair I can be used for corn cold-tolerant molecular assisted breeding, and the cold-tolerant molecular marker based on the primer pair I is named ZmRRl.
[0051] Example 4 Detection of whether corn is cold-tolerant using a cold-tolerant molecular marker
[0052] Nine maize inbred lines (including some maize core inbreds, which have been published in Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels, 2013, Nature Genet 45:1) were selected for detection. The detection method was as described in Example 1. The primer pair I for detecting the cold tolerance molecular marker of the application was used to perform PCR amplification with the maize genomic DNA as a template. The results showed that 143 bp bands were amplified from all the inbred lines except B111. The inbred lines used and the identification results are shown in Table 2.
[0053] Table 2
[0054]
[0055] "√" indicates that the PCR product has a band; "X" indicates that the PCR product has no band.
[0056] Although the application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the application, all belong to the scope of the application claimed. SEQUENCE LISTING <110> China Agricultural University <120> Molecular marker linked to maize cold tolerance and application thereof <130> KHP211116877.4 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 gactgtctgt tttcagcacc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 accaccgtct tcctgttgtc 20 <210> 3 <211> 471 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 3 atggccgctg cagccgccgc tccagcatct gtggcgccgt cctcgcccaa ggccgccggc 60 gacaacagga agacggtggt gtccgtggac gcgtcggagc tggagaagca cgtcctagcg 120 gtggacgaca gctctgtgga ccgtgccgtg atcgccagga tcctgcgtgg ctccaggtac 180 aaggtgaccg ccgtggagtc agcgacgcgc gcgctggagc tgctcgcgct aggcctgctc 240 cccgacgtca gcatgatcat caccgactac tggatgcccg ggatgactgg gtacgagctg 300 ctcaaacgcg tcaaggagtc ggcggcgctc agaggcatcc ccgtcgtcat catgtcatcg 360 gagaacgtgt ccacccgtat cacccgctgc ctggaggagg gcgccgaggg cttcctcctc 420 aagcccgtcc gccccgccga cgtctcccgc ctctgcagcc ggatccggtg a 471 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 4 cgccgtctcc tgcgcccaaa gccagcgaca gcaggaagac ggtgg 45 <210> 5 <211> 143 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 5 gactgtctgt tttcagcacc cgcaccacct gactgtctgt tcgcagcacc cggacctgtg 60 tcaatggccg ctgcagccgc cgctccagca tctgtggcgc cgtcctcgcc caaggccgcc 120 ggcgacaaca ggaagacggt ggt 143
Claims
1. A molecular marker linked to cold tolerance in maize, characterized in that, The molecular marker is ZmRR1, and its nucleotide sequence is shown in SEQ ID No.
4.
2. Any of the following applications of the molecular marker according to claim 1: (1) Application in identifying the phenotypic traits of cold tolerance in maize; (2) Application in the identification, improvement or molecular marker-assisted breeding of maize germplasm resources; (3) Application in early prediction of cold tolerance traits in maize; (4) Application in screening or creating maize varieties with different cold resistance traits; (5) Application in the genotyping of cold tolerance genes in maize.
3. A method for identifying the phenotypic traits of cold tolerance in maize, characterized in that, include: (1) Extract DNA from the corn to be identified; (2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO.1-2; (3) Determine the phenotype of the maize cold tolerance trait to be identified based on the size of the DNA fragments in the PCR amplification products; The method for determining the phenotype of cold tolerance trait in maize to be identified in step (3) is as follows: When PCR amplification is performed using the primers shown in SEQ ID NO.1-2, and no DNA amplification fragment is found in the product, the corn to be identified has high cold resistance.