A single-cell multi-omics library and its construction method

Abstract

The present invention relates to the field of biotechnology, and in particular to a single-cell multi-omics library and a method for constructing the same. The present invention transforms the sequencing connector at one end of the Tn5 transposon into a specific connection sequence for connecting a barcode; the transcriptome and chromatin open region of a single cell can be simultaneously constructed, and the cell combination labeling technology is adopted, and no additional instruments and equipment are required, and the cost of library construction is greatly reduced compared to the solution of 10xGenomics. The library structure adopted by the present invention is adapted to the PE150 sequencing commonly used in existing second-generation sequencing, and no custom sequencing program is required, and the sequencing cost can be greatly reduced compared to SHARE‑seq.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a single-cell multi-omics library and a construction method thereof. Background Art

[0002] There are currently two main methods for single-cell sequencing: one is to spatially isolate single cells using microfluidics, microplates, etc., and the other is to distinguish single cells by combining labeling based on cell labeling technology. Most commercialized single-cell sequencing technologies are based on spatial isolation, such as 10x Genomics' single-cell library construction solution. Its advantage is that it is simple to operate. Researchers only need to complete the preparation of single-cell suspensions to access 10x's library construction process. The disadvantage is that the cell throughput is not high enough, and a single library construction can only detect about 10,000 cells, and it is expensive.

[0003] Combinatorial cell labeling technology does not require spatial separation of single cells, but rather uses multiple random barcode labels to give each cell a unique combination label. Currently, single-cell sequencing technologies developed using combinatorial labeling technology include sci-RNA-seq, sci-CAR, sci-ATAC-seq, SPLiT-seq, Paired-seq, SHARE-seq, etc. Taking SPLiT-seq as an example, this method disperses the reverse-transcribed cells into a 96-well plate, with a unique barcode connected to the cDNA in each well, and then collects the cells, and performs the second and third rounds of barcode connection in the same way, so that each cell has a unique combination barcode to distinguish it from other cells.

[0004] sci-CAR first completed the construction of single-cell multi-omics libraries through combined labeling technology, which means that it can simultaneously detect mRNA and chromatin development regions in a single cell. However, sci-CAR uses a small number of combined labels, so the cell throughput of the detection is low.

[0005] Paired-seq is a single-cell multi-omics technology developed by Ren Bing's team at the University of California. This technology can increase the detection throughput to 10^6 through 4 rounds of barcode labeling. The technology first uses Tn5 transposase with barcode and restriction sites to transpose the cell nucleus, then performs reverse transcription reaction, connects three rounds of barcodes to cDNA and Tn5 labeled DNA at the same time, and separates and sequences the library after library amplification by restriction digestion (see Figure 1 ).

[0006] SHARE-seq is a single-cell multi-omics sequencing technology developed by Jason D. Buenrostro and Aviv Regev's team at the Massachusetts Institute of Technology. Compared with paired-seq, this technology changes the Tn5 transposition conditions and library separation conditions, and can detect mRNA in the cytoplasm. This technology first uses Nextera Tn5 transposase for transposition, and then uses primers modified with biotin for reverse transcription. After three rounds of barcode connection, cross-linking is removed, and the library is separated and sequenced using streptavidin magnetic beads (see Figure 2 ).

[0007] Paired-seq cannot detect mRNA in the cytoplasm and requires the construction of 8 Tn5 transposases, which has a high technical threshold. SHARE-seq requires the construction of two Tn5 transposases, which can detect mRNA in the cytoplasm. The data quality is higher than that of Paired-seq, but the library structure of SHARE-seq is not suitable for the PE150 sequencing method commonly used by existing sequencing companies. A custom sequencing program is required, and the sequencing quotes of domestic sequencing companies are very expensive, so the sequencing cost of SHARE-seq libraries is very high. Summary of the invention

[0008] In view of this, the present invention provides a single-cell multi-omics library and a method for constructing the same. The method reconstructs the Tn5 insertion sequence for barcode connection, and the library structure is similar to SPLiT-seq and Paired-seq, which is suitable for PE150 sequencing, and the sequencing cost is greatly reduced compared to SHARE-seq.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] a Tn5 transposase complex, labeled Tn5-2, comprising a Tn5 transposase and a first assembly sequence;

[0011] The nucleotide sequences of the first assembly sequence are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0012] In some embodiments, the Tn5 transposase complex further comprises a second assembly sequence, and the complex is designated as Tn5-1, comprising Tn5 transposase, a first assembly sequence, and a second assembly sequence;

[0013] The nucleotide sequences of the second assembly sequence are shown as SEQ ID NO.1 and SEQ ID NO.3.

[0014] In some embodiments, the 5' end of the sequence shown in SEQ ID NO.1 has a phosphorylation modification, and the 3' end has a dideoxy modification; the 5' end of the sequence shown in SEQ ID NO.3 has a phosphorylation modification.

[0015] The present invention also provides a method for constructing a single-cell multi-omics library, comprising:

[0016] (1) Fixing the cells and permeabilizing them;

[0017] (2) transposing the cells treated in step (1) with the Tn5-1 transposase complex to obtain transposed cells; the transposed cells contain labeled open chromatin regions and unlabeled mRNA;

[0018] (3) Reverse transcription of the mRNA in the cells obtained in step (2) using a reverse transcription primer; the reverse transcription primer sequence is such as SEQ ID NO.295.

[0019] (4) using primers to perform first, second, and third rounds of barcode labeling on the reverse transcription product of step (3);

[0020] (5) Collecting the cells labeled in step (4), undoing the cross-linking, separating cDNA and chromatin using streptavidin magnetic beads, and building libraries separately to obtain RNA libraries and ATAC libraries;

[0021] During the RNA library construction process, the cDNA is fragmented using the Tn5-1 transposase complex;

[0022] In the present invention, in step (1), there is no special limitation on the fixative used to fix the cells, and any of the common types in the art can be used; in some embodiments, the fixative used for fixation is formaldehyde or paraformaldehyde. After the cells are fixed, the cells are permeabilized, and the reagents used for the permeabilization treatment can be any of the common types in the art. In a specific embodiment of the present invention, the permeabilization treatment agent is 0.1% NP40, 0.1% Triton X-100, 0.01-0.05% Digitonin, etc., which are suitable for different cell types. After the permeabilization treatment, the cells can pass through the reaction reagent.

[0023] In some embodiments, in step (2), the reverse transcription primer is modified with biotin. The present invention utilizes biotin to modify the reverse transcription primer, performs reverse transcription in cells, adds streptavidin magnetic beads to the reverse transcription product, binds the cDNA modified with biotin to the streptavidin magnetic beads, and separates the ATAC library from the cDNA library by capturing the magnetic beads.

[0024] In step (4) of the present invention, the cells obtained after the reverse transcription reaction in step (3) are labeled using barcode primers, and 96 labels are provided in each round. After three rounds of barcode labeling, a total of 96*96*96=884,736 combination labels can be generated. Each cell will carry a combination label and be distinguished from other cells by the combination label.

[0025] Specifically, the primers for the first round of Barcode labeling include Round1 linker and Round1 barcode; the primers for the second round of Barcode labeling include Round2 linker and Round2 barcode; the primers for the third round of Barcode labeling include Round3 linker and Round3 barcode;

[0026] Round1 barcode includes, from 5' to 3', a 5' phosphorylation tag, a sequence complementary to the bases of the Round2 linker part of the second round barcode tag, the first round barcode, and a sequence complementary to the bases of the Round1 linker part of the first round barcode tag;

[0027] Round2 barcode includes, from 5' to 3', a 5' phosphorylation tag, a sequence complementary to the bases of the Round3 linker part of the third round barcode tag, the second round barcode, and a sequence complementary to the bases of the Round2 linker part of the second round barcode tag;

[0028] The Round3 barcode includes, from 5' to 3', a sequence complementary to the upstream primer amplified from the cDNA library, the UMI, the third-round Barcode, and a sequence complementary to the partial bases of the Round3 linker marked by the third-round Barcode.

[0029] In some specific embodiments, the nucleotide sequence of the Round1 linker is shown as SEQ ID NO.289, and the nucleotide sequence of the Round1 barcode is shown as SEQ ID NO.1-96;

[0030] The nucleotide sequence of the Round2 linker is shown in SEQ ID NO.290, and the nucleotide sequence of the Round2 barcode is shown in SEQ ID NO.97-192;

[0031] The nucleotide sequence of the Round3 linker is shown in SEQ ID NO.291, and the nucleotide sequence of the Round3 barcode is shown in SEQ ID NOs.193-288.

[0032] In the present invention, in the nucleotide sequence of Round1 barcode, the 8 bases after the sequence complementary to the Round2 linker partial bases marked by the second round Barcode are the first round Barcode; in the nucleotide sequence of Round2 barcode, the 8 bases after the sequence complementary to the Round3 linker partial bases marked by the third round Barcode are the second round Barcode; in the nucleotide sequence of Round3 barcode, the 8 bases after the UMI sequence are the third round Barcode.

[0033] In some embodiments, in step (5), the reagents used for de-crosslinking include: 2×RCB, proteinase K and RI;

[0034] The 2×RCB includes the following components: 1 M Tris 8.0, 5 M NaCl, 10% SDS and Nuclease-Free Water (NFw).

[0035] In some embodiments, the step (5) specifically comprises:

[0036] (a) collecting the cells labeled in step (4) and decrosslinking; separating the decrosslinked products using streptavidin magnetic beads to obtain cDNA and chromatin;

[0037] (b) purifying the chromatin isolated in step (a), amplifying and enriching the chromatin by PCR, and purifying the chromatin to obtain an ATAC library;

[0038] (c) taking the cDNA separated and obtained in step (a), pre-amplifying and purifying it, and adding the Tn5-2 transposase complex of the present invention to obtain a purified Tag-cDNA product;

[0039] The Tag-cDNA purification product is amplified, enriched and purified by PCR to obtain an RNA library.

[0040] The present invention also provides a library obtained by the construction method described above, wherein the library includes an RNA library and an ATAC library. The present invention compares the obtained library with the 10x platform or SHARE-seq, and the results show that the quality of the library obtained by the present invention is comparable to that of the 10x platform or SHARE-seq, with little difference.

[0041] Based on SHARE-seq, the present invention transforms its library structure, transforms the sequencing connector at one end of the Tn5 transposon into a specific connection sequence for connecting the barcode; it can complete the simultaneous construction of the transcriptome and chromatin open region of a single cell, adopts the cell combination labeling technology, does not require additional instruments and equipment, and the library construction cost is greatly reduced compared with the solution of 10xGenomics. The library structure adopted by the present invention is adapted to the PE150 sequencing commonly used in existing second-generation sequencing, does not require a custom sequencing program, and the sequencing cost can be greatly reduced compared with SHARE-seq. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Schematic diagram showing Paired-seq library construction;

[0043] Figure 2 Schematic diagram of SHARE-seq library construction

[0044] Figure 3 Schematic diagram showing the process of constructing a single-cell multi-omics library of the present invention;

[0045] Figure 4 The comparison of the effective fragments detected by ATAC of the present invention with the data of other platforms is shown;

[0046] Figure 5 The TSS enrichment of ATAC data of the present invention is compared with data from other platforms;

[0047] Figure 6 The effective UMI of RNA detection of the present invention is compared with data from other platforms;

[0048] Figure 7 The figure shows the comparison of the effective gene number detected by RNA of the present invention with the data of other platforms. DETAILED DESCRIPTION

[0049] The present invention provides a single-cell multi-omics library and a method for constructing the same. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the same. It should be noted in particular that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0050] Terminology explanation:

[0051] Single cell multi-omics sequencing: Developed based on single-cell library construction technology and high-throughput second-generation sequencing technology, it is a single-cell multi-omics technology that can simultaneously detect two or more types of omics information such as transcriptome, genome, epigenome, proteome or spatial state at the single-cell level.

[0052] Transcriptome sequencing (RNA-seq): high-throughput sequencing of the RNA that can be transcribed from the genes in the entire genome of a specific cell in a certain functional state, mainly including mRNA and non-coding RNA.

[0053] ATAC-seq: There are open areas between chromatin nucleosomes. The modified Tn5 transposase is used to design the transposed DNA into sequencing adapters, which are then directly introduced into the open chromatin for sequencing.

[0054] Transposition: Use the modified Tn5 transposase to insert specific sequences into open chromatin regions.

[0055] Reverse transcription: The process of synthesizing DNA using RNA as a template, that is, DNA synthesis under the guidance of RNA. In this process, the nucleic acid synthesis and transcription (DNA to RNA) process is opposite to the flow direction of genetic information (RNA to DNA), so it is called reverse transcription.

[0056] Decrosslinking of fixed cells: After the cells are fixed, the DNA crosslinked to the protein is released in the presence of high temperature, high salt, SDS and proteinase K.

[0057] DNA magnetic bead purification product: Utilizing the characteristic of DNA magnetic beads to preferentially adsorb large fragments, a certain proportion of magnetic beads can be used to adsorb fragments above a certain size to obtain DNA of the desired size range.

[0058] Unless otherwise specified, the test materials used in the present invention are all common commercial products and can be purchased in the market.

[0059] The present invention will be further described below in conjunction with embodiments:

[0060] Example 1

[0061] This embodiment provides a method for constructing a single-cell multi-omics library. The schematic diagram of the process is shown in Figure 3 , specifically including the following steps:

[0062] (1) Primer synthesis:

[0063] Synthesize Round1, Round2, Round3 barcode sequences and other primer sequences;

[0064] Among them, the nucleotide sequences of Round1_01 to 96 are shown in SEQ ID NOs.1 to 96, the nucleotide sequences of Round2_01 to 96 are shown in SEQ ID NOs.97 to 192, and the nucleotide sequences of Round3_01 to 96 are shown in SEQ ID NOs.193 to 288.

[0065] Table 1 Round1 primer sequences

[0066]

[0067]

[0068]

[0069] Table 2 Round2 primer sequences

[0070]

[0071]

[0072] Table 3 Round3 primer sequences

[0073]

[0074]

[0075]

[0076] Table 4 Other primer sequences

[0077]

[0078] (2) Primer annealing:

[0079] 1. Dilute Round1, Round2, and Round3 barcode primers to 100uM with TE buffer (10mM Tris-HCl 8.0, 0.1mM EDTA), and dilute Round1, Round2, and Round3 linkers to 1mM with TE buffer;

[0080] 2. Mix Round1 linker and Round1 barcode at a final concentration of 9uM and add to a 96-well plate;

[0081] 3. Mix Round2 linker and Round2 barcode at a final concentration of 11uM and add to a 96-well plate;

[0082] 4. Mix Round3 linker and Round3 barcode at a final concentration of 13uM and add to a 96-well plate;

[0083] 5. Place the 96-well plate in the PCR for annealing. The procedure is as follows:

[0084] Table 5

[0085]

[0086] 6. Aliquot the barcode into 96-well plates at a volume of 10ul per well and store at -80℃.

[0087] (3) Construction of Tn5:

[0088] 1. Synthesize primers Tn5_rev: / 5Phos / CTGTCTCTTATACACAT / 3ddC / , Tn5_fw_1:TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, Tn5_fw_2:GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG;

[0089] 2. Primer annealing: Use Annealing Buffer (Vazyme) to dissolve the primers to 10uM and prepare the following system in a PCR tube:

[0090] Table 6

[0091]

[0092] 3. Place in PCR instrument for annealing, the procedure is as follows:

[0093] Table 7

[0094] Heat cover 105℃ 75℃ 15min 60℃ 10min 50℃ 10min 40℃ 10min 25℃ 30min

[0095] 4. Add the following components to the PCR tube to construct Tn5-1:

[0096] Table 8

[0097] TruePrep Tagment Enzyme(Vazyme) 4μl Adapter Mix 1 3.5μl Adapter Mix 2 3.5μl Coupling Buffer 39μl total 50μl

[0098] 5. Add the following components to the PCR tube to construct Tn5-2:

[0099] Table 9

[0100] TruePrep Tagment Enzyme(Vazyme) 4μl Adapter Mix 1 7μl Coupling Buffer 39μl total 50μl

[0101] 6. After mixing thoroughly, place in PCR instrument, react at 30℃ for 1 hour, and store at -20℃.

[0102] (4) Cell fixation:

[0103] First, prepare a cell suspension, centrifuge the cell suspension at room temperature at 500g for 5 minutes, and resuspend the obtained cell pellet in 4°C pre-cooled DPBS-RI to make the cell density 1,000,000 cells / ml. Take 1ml of DPBS-RI cell suspension, add 5.4μl of 37% formaldehyde solution (final concentration is 0.2%), and place it on ice for fixation for 10 minutes. Then centrifuge at 4°C 500g for 5 minutes, and remove the supernatant to obtain the fixed cell pellet.

[0104] Table 10

[0105] DPBS-2RI Volume(μl) 1× DPBS 4000 RNase Inhibitor(RI) 10

[0106] (5) Cell lysis:

[0107] Resuspend the fixed cell pellet with 1ml pre-cooled RSB-T-RI, add 10ul 10% NP40 (final concentration is 0.1%) after beating evenly, and beating evenly with a gun again. Place on ice and lyse the cells for 5 minutes. Then centrifuge at 4℃ 1000g for 5 minutes and remove the supernatant. Resuspend the cell pellet with 1ml pre-cooled RSB-T-RI, pass through a 40μm filter membrane after beating evenly, remove the supernatant after centrifugation at 4℃ 1000g for 5 minutes, collect the pellet and resuspend the cells with 0.2ml pre-cooled RSB-T-RI, take 5μl in a PCR tube after beating evenly, and add 5μl 0.2% table blue for counting. According to the cell concentration obtained by counting, dilute the cells to 5,000 cells / μl with RSB-T-RI.

[0108] Table 11

[0109] RSB-T-RI Volume(μl) 1×RSB-T 4000 RNase Inhibitor(RI) 10

[0110] (6) Transposition:

[0111] First prepare the 2×TB buffer required for transposition:

[0112] Table 12

[0113] Regent Volume for 1ml 1M Tris-HCl pH 8 20μl 1M MgCl2 10μl 10% NP40 10μl 100%DMF 200 μl RSB-T-RI 500 Nuclease-free Water 260μl

[0114] Then prepare the cell transposition reaction system:

[0115] Table 13

[0116] Regent Volume 2×TB 25μl Cells in RSB-T-RI 10μl PIC 0.2μl RI 1μl Tn5-1 5μl Nuclease-free Water 8.8μl total 50μl

[0117] After the cell transposition system is configured in the PCR tube, blow it 6 times with a pipette tip and place it in a constant temperature oscillator at 37℃ for 30min for transposition reaction. After the transposition is completed, collect the transposition system in a 1.5ml low adsorption tube, and wash the PCR tube once with an equal volume of pre-cooled RSB-T-RI, collect the washed solution in the above 1.5ml tube, and centrifuge it at 4℃ 1000g for 5min. Remove the supernatant, wash the cell pellet with 0.5ml pre-cooled RSB-T-RI and centrifuge it again at 4℃ 1000g for 5min. Remove the supernatant and resuspend the cells with 60μl pre-cooled RSB-T-RI.

[0118] (7) Reverse transcription:

[0119] First, configure the reverse transcription system (taking 6 reverse transcription reactions as an example):

[0120] Table 14

[0121]

[0122]

[0123] Note: 50% PEG 6000 is obtained by mixing equal amounts of PEG 6000 and water.

[0124] Heat equal amounts of mixed PEG 6000 in a 65°C water bath for 5 minutes, then cool to room temperature.

[0125] Add the above 240 μl reverse transcription mixture to the 60 μl RSB-T-RI resuspended transposed cells in step (6). After pipetting evenly, divide evenly into 6 PCR tubes, 50 μl per tube. Then put it into the PCR instrument and run the following program:

[0126] Table 15

[0127]

[0128] After the reverse transcription reaction is completed, the reverse transcription product is collected in a 1.5 ml low-adsorption tube, and the PCR tube is washed once with an equal volume of RSB-T-RI. The washed solution is collected in the above 1.5 ml tube and centrifuged at 1000 g for 5 min at 4°C. The supernatant is removed, and the cell pellet is washed with 0.5 ml pre-cooled RSB-T-RI and centrifuged again at 1000 g for 5 min at 4°C. The supernatant is removed and the cells are resuspended with 1056 μl pre-cooled RSB-T-RI.

[0129] (8) Barcode connection:

[0130] 1. Connection of the first round of barcode:

[0131] First, configure the hybridization buffer for the first round of barcode connection as shown in the following table:

[0132] Table 16

[0133] Hybridization buffer Volume(μl) Wlq 2761.9 T4 ligation buffer 576 RI 57.6 10% BSA 57.6 total 3456

[0134] Take 3168 μl of the above hybridization buffer and add 1056 μl of RSB-T-RI resuspended cells in step (7), filter through a 40 μm filter, then add 100 μl of T4 DNA ligase and mix by inversion. Then add 40 μl per well to the Round1 96-well plate prepared in step (2). Place the plate in a constant temperature shaker at 37°C, 300 rpm for 30 min.

[0135] After the reaction, prepare the Blocking oligo 1 mixture (as shown in the table below), add 10 μl of the Blocking oligo 1 mixture to each well of Round 1 96-well plate, and then place in a constant temperature oscillator at 37°C, 300 rpm for 30 min.

[0136] Table 17

[0137]

[0138]

[0139] 2. Connection of the second round of barcode:

[0140] Collect the first round of barcode ligation products in the 96-well plate in a 15 ml tube, add 100 μl of T4 DNA ligase, blow evenly with a pipette, and then add 55 μl per well to the Round 2 96-well plate prepared in step (2). Place the plate in a constant temperature shaker at 37°C, 300 rpm for 30 min.

[0141] After the reaction, prepare the Blocking oligo 2 mixture (as shown in the table below), add 10 μl of the Blocking oligo 2 mixture to each well of a Round2 96-well plate, and then place in a constant temperature shaker at 37°C, 300 rpm, for 30 min.

[0142] Table 18

[0143] Block oligo 2 Volume(μl) Round_2_blocking 304 T4 ligation buffer 211 Wlq 637 total 1152

[0144] 3. Connection of the third round of barcode:

[0145] Collect the second round of barcode ligation products in the 96-well plate in a 15 ml tube, add 100 μl of T4 DNA ligase, blow evenly with a pipette, and then add 70 μl per well to the Round 3 96-well plate prepared in step (2). Place the plate in a constant temperature shaker at 37°C, 300 rpm for 30 min.

[0146] After the reaction, a Blocking oligo 3 mixture was prepared (as shown in the following table). 10 μl of the Blocking oligo 3 mixture was added to each well of a Round3 96-well plate, and then placed in a constant temperature shaker at 37°C, 300 rpm, for 30 min.

[0147] Table 19

[0148] Block oligo 3 Volume(μl) Round_3_blocking 265 Triton X-100 11.5 Wlq 875.5 total 1152

[0149] 4. Collect the third round of barcode ligation products in the 96-well plate in a 15 ml tube, filter through a 40 μm filter, then centrifuge at 4°C 1000 g for 5 min, remove the supernatant, resuspend the cells with 1 ml RSB-T-RI, filter through a 40 μm filter again, centrifuge at 4°C 1000 g for 5 min, collect the precipitate, resuspend the cells with 100 μl RSB-T-RI, pipet evenly, take 5 μl into a PCR tube, and add 5 μl 0.2% table blue for counting.

[0150] (9) Separation of ATAC library and RNA library:

[0151] 1. Cell decrosslinking:

[0152] First, prepare the de-crosslinked 2x RCB:

[0153] Table 20

[0154] 2x RCB Volume(μl) 1M Tris 8.0 100 5M NaCl 20 10% SDS 40 Wlq 840 total 1000

[0155] Take 25 μl of the library, add 25 μl of 2x RCB, 2 μl of proteinase K, and 1 μl of RI, and incubate at 55°C for 1 h in a PCR instrument with a heated lid at 65°C.

[0156] Note: This step is a stopping point and the cross-linked library can be stored at -20°C.

[0157] 2. Add 2.5 μl of 100 mM PMSF to the above de-crosslinked product and incubate at room temperature for 10 min. At the same time, prepare the following solutions:

[0158] Table 21

[0159] 1x B&W-T Volume(μl) 1M Tris 8.0 25 5M NaCl 1000 0.5M EDTA 5 10% Tween 25 Wlq 3945 total 5000

[0160] Table 22

[0161]

[0162] Table 23

[0163] 2xB&W Volume(μl) 1M Tris 8.0 50 5M NaCl 2000 0.5M EDTA 10 Wlq 2940 total 5000

[0164] Table 24

[0165] 1x B&W-T / RI Volume / μl 1x B&W-T 600 RI 6

[0166] Table 25

[0167] 2x B&W / RI Volume / μl 2x B&W 50 RI 1

[0168] Table 26

[0169] 1x STE / RI Volume / μl STE 300 RI 1

[0170] 3. Take 10μl of streptavidin magnetic beads, place them on a magnetic rack, remove the supernatant, then wash three times with 100μl of 1xB&W-T / RI, remove the supernatant, and finally resuspend the streptavidin magnetic beads with 50μl of 2x B&W / RI, add the resuspended magnetic beads to the above-mentioned de-crosslinking product, blow evenly with the tip of the pipette, and place them in a 3D mixing rotator to react at room temperature for 1h.

[0171] 4. Place the PCR tube after the reaction on the magnetic stand, and collect the supernatant (ATAC library to be built) after the magnetic beads are adsorbed. Wash the remaining magnetic beads three times with 100μl of 1xB&W-T / RI, remove the supernatant, and then resuspend the magnetic beads (RNA library to be built) with 100μl of 1x STE / RI.

[0172] (10) ATAC library construction:

[0173] 1. Use NEB's DNA purification column to purify the ATAC library to be constructed. Elute twice with 11μl EB and 12μl EB respectively, and finally obtain 22.5μl of ATAC library purification product to be constructed.

[0174] 2. Configure the following PCR system to amplify the ATAC library:

[0175] Table 27

[0176] Regent Volume(μl) NEBNext HiFi 2x mix 25 N5 1.25 S7 1.25 ATAC products 22.5 total 50

[0177] The PCR system is as follows:

[0178] Table 28

[0179]

[0180] 3. DNA magnetic beads to purify PCR products:

[0181] Add 20μl (0.4x) of DNA magnetic beads to the 50μl PCR system, blow evenly with a gun, let stand at room temperature for 5min, place the PCR tube on the magnetic stand, take the supernatant after the magnetic beads are adsorbed, and transfer it to a new PCR tube. Add 40μl (1.2x) of DNA magnetic beads again, blow evenly with a gun and let stand at room temperature for 5min, remove the supernatant after the magnetic beads are adsorbed, wash the magnetic beads twice with 80% ethanol, and dry at room temperature for 3min after removing the alcohol. Finally, add 20μl of NFw, blow evenly, place on the PCR plate, let stand at room temperature for 5min, then place on the magnetic stand, and absorb the supernatant into a new PCR tube after the magnetic beads are adsorbed. The product is the ATAC test library.

[0182] (11) RNA library construction:

[0183] 1. Template switching of RNA library:

[0184] Take the magnetic beads resuspended in 1x STE / RI in step (9) and place them on a magnetic rack. After the magnetic beads are adsorbed, remove the supernatant and resuspend the magnetic beads with the template conversion mixture. The configuration is as follows:

[0185] Table 29

[0186] Template switch mix Volume(μl) 50% PEG 6000 12.5 5x Maxima RT buffer 10 Ficoll PM-400 (20%) 10 10mM dNTPs, each 5 RNase Inhibitor 5 100 μM TSO 5 Maxima RT RNase H Minus 2.5 total 50

[0187] The resuspended magnetic beads were placed in a 3D mixing rotator, incubated at room temperature for 30 minutes, and then transferred to a constant temperature oscillator at 42°C for reaction for 90 minutes. When reacting in the constant temperature oscillator, the magnetic beads needed to be resuspended and mixed with a gun every 30 minutes.

[0188] 2. cDNA Pre-amplification

[0189] Place the cDNA template conversion product on a magnetic rack, remove the supernatant after the magnetic beads are adsorbed, wash the magnetic beads twice with 100 μl of 1xSTE / RI, and resuspend the magnetic beads with the cDNA amplification mixture in the following table:

[0190] Table 30

[0191] cDNA PCR mix Volume(μl) 2×Q5 25 cDNA AMP F (20 μM) 1.25 cDNA AMP R (20 μM) 1.25 Wlq 22.5 total 50

[0192] Then place it on the PCR instrument and perform the following reaction:

[0193] Table 31

[0194]

[0195] 3. Purification of cDNA pre-amplification products

[0196] Add 40 (0.8x) DNA magnetic beads to 50 μl of cDNA pre-amplification product, blow and mix evenly with a gun, let stand at room temperature for 5 minutes, place the PCR tube on a magnetic rack, remove the supernatant after the magnetic beads are adsorbed, wash the magnetic beads twice with 80% ethanol, and dry at room temperature for 3 minutes after removing the alcohol. Finally, add 20 μl of NFw, blow and mix evenly, place on the PCR plate, let stand at room temperature for 5 minutes, and then place on a magnetic rack. After the magnetic beads are adsorbed, absorb the supernatant into a new PCR tube. The product is the cDNA pre-amplification purification product.

[0197] 4.cDNA fragmentation, library construction and amplification

[0198] Take 50 ng of the above cDNA pre-amplification purified product and perform Tn5-2 shearing. The system is as follows:

[0199] Table 32

[0200] Regent Volume 5×TTBL 10μl Tn5-2 5μl cDNA 50ng Wlq 35-cDNA μl total 50μl

[0201] The reaction system was placed in a constant temperature oscillator at 55°C for 10 min. After the reaction was completed, the transposition product was purified using NEB's DNA purification columns. Elution was performed twice with 11 μl EB and 12 μl EB respectively, and finally 22.5 μl of Tag-cDNA purification product was obtained.

[0202] After the obtained Tag-cDNA product is purified, the following amplification reaction system is configured:

[0203] Table 33

[0204] Regent Volume(μl) 2×Q5 25 N5(20μM) 1.25 S7 (20 μM) 1.25 Tag-cDNA 22.5 total 50

[0205] Then the following amplification procedure was performed:

[0206] Table 34

[0207]

[0208] 5. Purification of RNA library:

[0209] Add 35 (0.7x) DNA magnetic beads to 50 μl of Tag-cDNA amplification product, blow evenly with a gun, let stand at room temperature for 5 minutes, place the PCR tube on the magnetic rack, remove the supernatant after the magnetic beads are adsorbed, wash the magnetic beads twice with 80% ethanol, and dry at room temperature for 3 minutes after removing the alcohol. Finally, add 20 μl of NFw, blow evenly, place on the PCR plate, let stand at room temperature for 5 minutes, and then place on the magnetic rack. After the magnetic beads are adsorbed, absorb the supernatant into a new PCR tube. The product is the RNA library to be tested.

[0210] (12) Library quality inspection and sequencing:

[0211] 1. Use Qubit to measure the dsDNA concentration of the ATAC and RNA libraries. The library concentration must be greater than 10 ng / ul.

[0212] 2. Take 10ng of ATAC and RNA libraries to be tested and run 4200 D1000 gel. The distribution of ATAC should be between 300 and 700bp, with nucleosome peaks, and the first main peak should be around 340bp; the distribution of RNA should be between 300 and 700bp, with the main peak around 450bp.

[0213] Example 2

[0214] The library constructed in Example 1 was compared with the 10x platform or SHARE-seq, and the results were as follows:

[0215] 1. In the ATAC library, the uniq fragments detected in each cell are at the same level (see Figure 4 );

[0216] 2: In the ATAC library, the FRiTSS (TSS enrichment ratio) is relatively low. Different samples may also cause this difference. The FRiTSS of the 3T3 cell line of xseq is not much different from that of the 3T3 cell line of SHARE (see Figure 5 );

[0217] 3: In the RNA library, the number of genes detected per cell is not much different compared with SHARE-seq (see Figure 6 );

[0218] 4: In the RNA library, the number of UMIs (unique transcripts) detected in each cell is similar compared to SHARE-seq (see Figure 7 ).

[0219] The above results show that the quality of the ATAC library and RNA library constructed by the present invention is comparable to that of the 10x platform and SHARE-seq, with little difference.

[0220] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for constructing a single-cell multi-omics library, characterized in that: include: (1) Fix the cells and permeabilize them; (2) transposing the cells treated in step (1) with the transposase complex Tn5-1 to obtain transposed cells; the transposed cells contain labeled open chromatin regions and unlabeled mRNA; (3) reversely transcribing the mRNA in the cells obtained in step (2) using a reverse transcription primer; the nucleotide sequence of the reverse transcription primer is shown in SEQ ID NO.295; (4) using primers to perform first, second, and third rounds of barcode labeling on the reverse transcription product of step (3); (5) Collect the cells labeled in step (4), undo the cross-linking, separate the cDNA and chromatin using streptavidin magnetic beads, and build libraries separately to obtain RNA library and ATAC library; During the RNA library construction process, the cDNA is fragmented using the transposase complex Tn5-2; The Tn5-2 comprises a Tn5 transposase and a first assembly sequence, wherein the first assembly sequence comprises a nucleotide sequence as shown in SEQ ID NO.307-308; The Tn5-1 comprises Tn5 transposase, the first assembly sequence and the second assembly sequence, wherein the second assembly sequence comprises nucleotide sequences such as the sequence shown in SEQ ID NO.307 and the sequence shown in SEQ ID NO.

309.

2. The construction method according to claim 1, characterized in that: The 5' end of the sequence shown in SEQ ID NO.1 has a phosphorylation modification, and the 3' end has a dideoxy modification; the 5' end of the sequence shown in SEQ ID NO.3 has a phosphorylation modification.

3. The construction method according to claim 1, characterized in that: In step (1), the fixative used is formaldehyde, and the permeabilization agent used is NP40.

4. The construction method according to claim 1, characterized in that: In step (2), the reverse transcription primer is modified with biotin.

5. The construction method according to claim 1, characterized in that: In step (4), the primers for the first round of Barcode labeling include Round1 linker and Round1 barcode; the primers for the second round of Barcode labeling include Round2 linker and Round2 barcode; the primers for the third round of Barcode labeling include Round3 linker and Round3 barcode; Round1 barcode includes, from 5' to 3', a 5' phosphorylation tag, a sequence complementary to the Round2 linker portion of the second round barcode tag, the first round barcode, and a sequence complementary to the Round1 linker portion of the first round barcode tag; Round2 barcode includes, from 5' to 3', a 5' phosphorylation tag, a sequence complementary to the Round3 linker portion of the third round barcode tag, a second round barcode, and a sequence complementary to the Round2 linker portion of the second round barcode tag; The Round3 barcode includes, from 5' to 3', a sequence complementary to the upstream primer amplified by the cDNA library, a UMI sequence, the third-round Barcode, and a sequence complementary to the partial bases of the Round3 linker marked by the third-round Barcode.

6. The construction method according to claim 5, characterized in that: The nucleotide sequence of the Round1 linker is shown in SEQ ID NO.289, and the nucleotide sequence of the Round1 barcode is shown in SEQ ID NO.1-96; The nucleotide sequence of the Round2 linker is shown in SEQ ID NO.290, and the nucleotide sequence of the Round2 barcode is shown in SEQ ID NO.97-192; The nucleotide sequence of the Round3 linker is shown in SEQ ID NO.291, and the nucleotide sequence of the Round3 barcode is shown in SEQ ID NO.193-288.

7. The construction method according to claim 1, characterized in that: The step (5) specifically includes: (a) Collecting the cells labeled in step (4) and decrosslinking them; separating the decrosslinked products using streptavidin magnetic beads to obtain cDNA and chromatin open regions; (b) Purifying the chromatin open region isolated in step (a), amplifying and enriching the region by PCR, and purifying the region to obtain an ATAC library; (c) The cDNA separated and obtained in step (a) is pre-amplified and purified, and the transposase complex Tn5-2 described in claim 1 is added to obtain Tag-cDNA fragmentation products; the Tag-cDNA purified products are amplified, enriched, and purified by PCR to obtain an RNA library.

Images