A method for detecting trace nucleic acid based on photosensitive gel

Abstract

The application discloses a trace nucleic acid detection method based on photosensitive gel and relates to the technical field of nucleic acid detection. The method comprises the following steps: S1, synthesizing nucleic acid probes and amplification primers according to the nucleic acid sequence of a target gene; S2, adding a sample to be detected to a chip template covered with photosensitive gel on the surface, performing electrophoresis, and fixing proteins and / or nucleic acids through UV crosslinking after the electrophoresis is completed; S3, performing rolling circle amplification on the DNA as a template by using the amplification primers to obtain amplified linear DNA sequences; and S4, adding nucleic acid probes with labeled antibodies to the ends of the amplified linear DNA sequences, specifically combining the nucleic acid probes with the linear DNA sequences to generate local specific signals for detection, and realizing trace nucleic acid detection by observing the fluorescent signals. The application is powerful and efficient in fixing nucleic acids by using the photosensitive gel, is stable, does not affect the activity of DNA, does not affect the complementary pairing of probes, can significantly improve the sensitivity of the original method, and is high in detection efficiency and relatively economical.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid detection technology, specifically to a trace nucleic acid detection method based on photosensitive gel. Background Technology

[0002] Rolling circle amplification (RCA) is an isothermal nucleic acid amplification technique based on molecular biology. The RCA reaction requires four components: ① a circular DNA template, called the RCA template; ② a DNA / RNA primer strand partially complementary to the RCA template; ③ a DNA / RNA polymerase with strand displacement activity (such as Phi29 DNA polymerase); and ④ deoxyribonucleoside triphosphates (dNTPs). The RCA template is typically a single-stranded DNA molecule of 15–200 bases. With the aid of a DNA ligase (such as T4 DNA ligase or Taq DNA ligase) and a single-stranded primer partially complementary to the 5' and 3' ends of the template, the 5' phosphate end (5'-P) of the template DNA is circularized with the 3' hydroxyl end (3'-OH). The resulting circular template is used for subsequent amplification. The enzyme catalyst converts the dNTPs into single-stranded tandem DNA molecules composed of thousands of tandemly repeated circular copies. The exponential amplification capacity of RCA can reach up to 10^6. 9 Real-time or endpoint detection of RCA products (single-stranded or double-stranded DNA) can also be achieved by binding to various nucleic acid fluorescent dyes (SYBR Green I, SYBR Greenl I, etc.).

[0003] Unlike other amplification procedures, RCA produces individual amplification products that remain linked to DNA primers. Therefore, RCA is well-suited for solid-phase formats, such as microarrays used to generate localized signals at specific microarray locations. This unique characteristic of RCA allows for simultaneous, multi-detection (multiplexing) of numerous assays without interference.

[0004] Traditional PCR amplification procedures cannot be configured for on-chip amplification, primarily due to the detrimental effects of temperature cycling on reaction components such as analytes, samples, or microarray substrates. RCA, as an isothermal process, overcomes the need for expensive and bulky equipment for temperature cycling. The application of RCA signal amplification in the detection of DNA targets has demonstrated its ability to provide ultrasensitive detection on solid surfaces and microarrays.

[0005] Currently, RCA detection technology is generally used for nucleic acid signal detection. For example, Li et al. used a lock probe to specifically recognize the single-stranded DNA to be tested [Talanta 191, 277-282]. The pre-designed lock probe can specifically bind to the single-stranded DNA containing mutated bases and circularize it under the action of ligase. The introduced RCA primer can bind to the resulting circular template, and RCA occurs. By staining the double-stranded product of RCA with SYBR Green I, the fluorescence detection of the analyte is achieved, with a detection limit of 0.05 nmol / L. This method uses a lock probe to achieve specific recognition of the target, and then introduces RCA to amplify the signal. The signal can be read using only a fluorescence reader. Stephen et al. embedded probes into gels to form a capture microarray [Analytical Chemistry 83, 7179-7185]. All the captured miRNAs were used as amplification primers for rolling circle amplification, which enabled the direct detection of miRNAs in small amounts of unprocessed human serum samples by labeling each target with multiple fluorescent reporter genes, without the need for RNA extraction or target amplification steps. Kashkin et al. used a fixed, specific padlock probe designed specifically for human genome research. This probe can specifically identify whether a single-base mutation has occurred in the human p53 gene, selectively circularize it, and if a mutation occurs, initiate rolling circle amplification, outputting a signal [Molecular Biology 39, 26-34]. Wang et al., on the other hand, targeted RCAs to residual mRNA in cleared tissue sections. They successfully identified 160 to 1020 genes simultaneously in mouse brain sections with high efficiency at single-cell resolution [Science 361, eaat5691].

[0006] However, the above-mentioned use of RCA for nucleic acid detection still has the following problems: 1. The target sample needs to be extracted and enriched with nucleic acid before it can be amplified, resulting in a high loss rate; 2. The sample demand is large, usually tissue blocks, and it is impossible to analyze rare samples; 3. The probes pre-embedded in the microarray cannot detect multiple targets, resulting in low throughput.

[0007] Therefore, those skilled in the art are dedicated to developing a trace nucleic acid detection method based on photosensitive gels that requires no sample extraction, has low sample requirements, and high detection efficiency. Summary of the Invention

[0008] In view of the above-mentioned deficiencies of the prior art, the technical problem to be solved by the present invention is to provide a trace nucleic acid detection method based on photosensitive gel that does not require sample extraction, has low sample requirements, and has high detection efficiency.

[0009] To achieve the above objectives, the present invention provides a method for detecting trace nucleic acids based on photosensitive gels, comprising the following steps:

[0010] S1: Design and synthesize nucleic acid probes and amplification primers based on the nucleic acid sequence of the target gene;

[0011] S2: The sample to be tested is dropped onto a chip template with a photosensitive gel on its surface and electrophoresis is performed. After electrophoresis, proteins and / or nucleic acids are fixed by UV cross-linking.

[0012] S3: Using DNA as a template, rolling circle amplification is performed using amplification primers to obtain the amplified linear DNA sequence;

[0013] S4: Add a nucleic acid probe with a labeled antibody at the end to the amplified linear DNA sequence. The nucleic acid probe specifically binds to the linear DNA sequence to generate a local specific signal for detection. Trace nucleic acid detection is achieved by observing the fluorescence signal.

[0014] In a preferred embodiment of the present invention, the photosensitive gel is prepared by the following method:

[0015] N-(3-methylacrylamidopropyl)-2-(1-methyl-1H-pyrrolo-2-yl)-2H-tetrazole-5-carboxamide (MAP-mPyTC) was copolymerized with acrylamide and N,N'-methylenebisacrylamide to form a polyacrylamide gel solution modified with mPyTC.

[0016] Dilute the mPyTC-modified polyacrylamide gel solution to achieve a mass fraction of 4%-8% to obtain the photosensitive gel.

[0017] Furthermore, the mPyTC modified polyacrylamide gel solution is diluted with a mixed solution made of 250 μL 1X TBE solution, 129.5 μL ddH2O, 100 μL 30% concentration of acrylamide and methylene acrylamide composite solution, 12.5 μL glycerol, 4 μL APS, and 4 μL TEMED. The mass fraction of the diluted mPyTC modified polyacrylamide gel solution is 6%.

[0018] In another preferred embodiment of the present invention, the method for preparing the chip template with the surface covered by photosensitive gel in step S2 is as follows:

[0019] Spread the photosensitive gel solution onto the chip template, then cover it with a silanized glass slide, lift the glass slide, and store the chip template in a humidified incubator. Before use, add 0.5X TBE electrophoresis buffer and perform pre-electrophoresis on ice at 120V for 60 minutes.

[0020] Furthermore, the preparation method of silanized glass slides is as follows: standard glass slides are treated with silanizing reagent for 30 minutes, then washed twice with methanol and deionized water respectively, and then dried with nitrogen to obtain the slides.

[0021] In a preferred embodiment of the present invention, step S2, before the sample to be tested is dropped onto the chip template whose surface is covered with photosensitive gel, further includes the following pretreatment step: adding trypsin-EDTA to the cells of the sample to be tested, digesting at 37 degrees Celsius, neutralizing with serum, resuspending by PBS, and then dropping onto the surface of the chip template whose surface is covered with photosensitive gel.

[0022] Furthermore, in step S2, before electrophoresis, the sample to be tested is loaded onto a chip template with a photosensitive gel on its surface for 5-10 minutes, and then excess cells are washed with phosphate buffer before electrophoresis is performed.

[0023] In a preferred embodiment of the present invention, the wavelength of the UV light is 300-340nm and the irradiation time is 30s-10min.

[0024] Preferably, in step S3, the DNA template for rolling circle amplification is selected from any one of circular DNA template, dumbbell-shaped DNA circularization, or dumbbell-like DNA circularization.

[0025] Preferably, in step S4, the labeled antibody is selected from any one of fluorescent, enzyme, colloidal gold, and superparamagnetic microsphere labeled antibodies.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] (1) Using microarrays to allow cells to fall into wells for single-cell detection, it can finely classify cell subpopulations with a low lower limit, which can meet the detection needs of rare samples and achieve trace detection; photosensitive gel fixation of nucleic acids is strong, efficient and stable, does not affect DNA activity, does not affect the complementary pairing of probes, and can significantly improve the sensitivity of the original method.

[0028] (2) The nucleic acids separated by electrophoresis will be stably bound to the photosensitive molecules in the gel under ultraviolet light irradiation, which is not easy to lose and improves the detection sensitivity; and the ultraviolet excitation time is shorter, which can avoid causing nucleic acid denaturation, save experimental time and reduce labor time costs; the ultraviolet excitation spectrum is narrower and longer in wavelength, and the energy is lower, which reduces the background autofluorescence inside the gel caused by ultraviolet light.

[0029] (3) Since the target DNA binds stably to the gel, multiple rounds of detection with different probes can be used, which greatly improves the sample detection efficiency; in multi-target detection, repeated elution and repeated incubation with different probes can be performed, which is highly efficient.

[0030] (4) Electrophoresis requires a short time and does not excessively increase experimental time, cost, or manpower;

[0031] (5) Non-selective, it can simultaneously and non-selectively fix all pyrimidine fractions of nucleic acids, and the electrophoresis results can be preserved for a long time without band diffusion. This avoids missed or false detections of specific nucleic acids due to the method itself;

[0032] (6) Room temperature amplification helps protect the sample inside the gel and avoid denaturation;

[0033] (7) The production and preparation of gels are inexpensive.

[0034] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of the photosensitive gel capturing nucleic acids according to this application;

[0036] Figure 2 This is a flowchart of the experimental process for this application;

[0037] Figure 3 This refers to the type of rolling circle amplification DNA template used in this application;

[0038] Figure 4 This is a schematic diagram of the rolling circle amplification method in this application;

[0039] Figure 5 This is a schematic diagram illustrating the principle of the rolling circle amplification experiment in this application;

[0040] Figure 6 This is a diagram of the AF594 gene detected by rolling circle amplification using a CY3-modified probe in this application.

[0041] Figure 7 This is a fluorescence intensity diagram of the staining results of the target AF594 and the rolling circle amplification product in this application. Detailed Implementation

[0042] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0043] In the accompanying drawings, components with the same structure are indicated by the same numerical designation, and components with similar structures or functions are indicated by similar numerical designations. The dimensions and thicknesses of each component shown in the drawings are arbitrary, and the present invention does not limit the dimensions and thicknesses of each component. To make the illustrations clearer, the thickness of some components has been appropriately exaggerated in the drawings.

[0044] This invention discloses a method for detecting trace nucleic acids based on photosensitive gel, comprising the following steps:

[0045] S1: Design and synthesize nucleic acid probes and amplification primers based on the nucleic acid sequence of the target gene;

[0046] S2: The sample to be tested is dropped onto a chip template with a photosensitive gel solution on its surface and electrophoresis is performed. After electrophoresis, proteins and / or nucleic acids are fixed by UV cross-linking.

[0047] S3: Using DNA as a template, rolling circle amplification is performed using amplification primers to obtain the amplified linear DNA sequence;

[0048] S4: Add a nucleic acid probe with a labeled antibody at the end to the amplified linear DNA sequence. The nucleic acid probe specifically binds to the linear DNA sequence to generate a local specific signal for detection. Trace nucleic acid detection is achieved by observing the fluorescence signal.

[0049] The following specific examples illustrate this.

[0050] Example 1: Synthesis route of photosensitive gel

[0051]

[0052] Step 1: Ethyl 2-(1-methyl-1H-pyrrolo-2-yl)-2H-tetrazole-5-carboxylate

[0053]

[0054] 1. Dissolve methyl-1-hydropyrrole (5 g, 12.5 mmol) in 30 mL of trifluoroethanol.

[0055] 2. Add diacetic acid iodobenzene (20g, 62.5mmol) to the solution in step 1 at -40℃.

[0056] 3. Under nitrogen protection, stir at -40℃ for 2 hours.

[0057] 4. Concentrate the product to a black oily state and dissolve it in dichloromethane.

[0058] 5. Add ethyl 5-carboxylate tetrazolium (3 g, 21.6 mmol), copper(II) trifluoromethanesulfonate (3.1 g, 8.6 mmol), and triethylamine (16 ml, 108 mmol) to the solution in step 4.

[0059] 6. Under nitrogen protection, stir at room temperature for 24 hours.

[0060] 7. After the reaction is complete, wash the product with saturated ammonium chloride and brine, dry with anhydrous magnesium sulfate, and filter to dry.

[0061] 8. The product was further purified by rapid silica gel chromatography (eluent: PE:EA = 5:1) to obtain brown oily product I.

[0062] 9. Yield: 450 mg (9.6%). ¹H NMR (400 MHz, DMSO) δ 7.13–7.00 (m, ¹H), 6.65 (dd, J = 3.9, 1.9 Hz, ¹H), 6.24 (dd, J = 3.9, 3.0 Hz, ¹H), 4.47 (q, J = 7.1 Hz, 2H), 3.65 (s, 3H), 1.37 (t, J = 7.1 Hz, 3H). [M+H+], 222.0. (See figure).

[0063] Step 2: 2-(1-Methyl-1H-pyrrolo-2-yl)-2H-tetrazole-5-carboxylic acid

[0064]

[0065] 1. Dissolve product I (450 mg, 2 mmol) from Step 1 in 1:1 MeOH / H2O (20 ml).

[0066] 2. At 0°C, add lithium hydroxide (850 mg, 10 mmol) to the solution in step 1.

[0067] 3. Place the mixture from step 2 at room temperature under nitrogen protection and stir for 2 hours.

[0068] 4. After the reaction is complete, add 2N HCl at 0℃ to adjust the pH to 4-5.

[0069] 5. Extracted with ethyl acetate solution, the mixed organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated to a brown solid product II (370 mg, yield 94%). [M+H+], 194.1.

[0070] Step 3: N-(3-Methacrylamidopropyl)-2-(1-Methyl-1H-pyrrolo-2-yl)-2H-tetrazole-5-carboxamide

[0071]

[0072] 1. Dissolve N-(3-aminopropyl)methacrylate hydrochloride (370 mg, 1.67 mmol) in 20 mL of tetrahydrofuran.

[0073] 2. At 0℃, add 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCl.HCl, 650 mg, 3.34 mmol) and 1-hydroxybenzotriazole (HOBt, 220 mg, 1.67 mmol), and react for 30 min.

[0074] 3. Add product II (300 mg, 1.67 mmol) and triethylamine (850 mg, 8.35 mmol) from Step 2 to the mixed solution in step 2, and stir and reflux overnight.

[0075] 4. After the reaction was completed, the product was purified by preparative HPLC to obtain white powder III (41 mg, yield 6.7%).

[0076] 1H NMR (400MHz, MeOD) δ6.97–6.82(m,1H),6.60(dd,J=4.0,1.9Hz,1H),6.23(dd,J=3.9,3.0Hz,1H),5.78–5.64(m,1H),5.50–5.2 3(m,1H),3.71(s,3H),3.50(t,J=6.8Hz,2H),3.36(t,J=6.7Hz,2H),2.03–1.92(m,3H),1.87(p,J=6.7Hz,2H).[M+H+],318.1.

[0077] Example 2: Preparation of a chip template with a surface coated with photosensitive gel

[0078] Its specific flowchart is as follows Figure 2 As shown.

[0079] 1. Preparation of photosensitive gel for electrophoresis

[0080] Preparation of photosensitive gel solution: The photosensitive gel N-(3-methacrylamidopropyl)-2-(1-methyl-1H-pyrrolo-2-yl)-2H-tetrazole-5-carboxamide (MAP-mPyTC) prepared in Example 1 was copolymerized with acrylamide and N,N'-methylenebisacrylamide to form an mPyTC-modified polyacrylamide (MMP) gel solution. Then, the solution was diluted with a mixed solution prepared by adding 250 μL of 1X TBE solution, 129.5 μL of ddH2O, 100 μL of a 30% concentration composite solution of acrylamide and methylene acrylamide, 12.5 μL of glycerol, 4 μL of APS, and 4 μL of TEMED to achieve a mass fraction of 6% for the diluted mPyTC-modified polyacrylamide gel solution.

[0081] 2. Cover the chip template surface with photosensitive gel solution

[0082] The chip template, designed using CAD software and manufactured by Shenzhen Nanochip Electronics Co., Ltd., features numerous micropillars on its surface, which create a large number of pores after gel formation, facilitating cell sedimentation. Silanized glass slides were prepared by treating standard glass slides with a silanizing reagent (175528, J&K) for 30 minutes, followed by washing twice with methanol and deionized water, and drying with nitrogen. At the start of gel preparation, the prepared photosensitive gel solution was first spread onto the chip template, then covered with the silanized glass slide. After 20 minutes, the slide was lifted and stored in a humidified oven at 4°C, resulting in a chip template with a photosensitive gel coating.

[0083] Example 3: Detection of nucleic acids in sample cells

[0084] Before use, the chip template covered with photosensitive gel solution was pre-electrophorized on ice for 60 minutes at 120V after adding 0.5X TBE electrophoresis buffer.

[0085] Then, the sample cells were digested with 0.25% trypsin-EDTA at 37°C for 3 minutes, neutralized with serum, resuspended by PBS, and dropped onto the surface of a chip template coated with photosensitive gel. After loading the cells, they settled into the cell traps after 5-10 minutes. Excess cells were then washed with phosphate-buffered saline (PBS), followed by electrophoresis with 0.5% XTBE buffer at 120V for 3 minutes. After electrophoresis, proteins and / or nucleic acids were immediately fixed by UV cross-linking. A schematic diagram of the photosensitive gel capturing nucleic acids is shown below. Figure 1 As shown.

[0086] In this embodiment, when proteins and / or nucleic acids are fixed by UV crosslinking, the wavelength of the UV light is 300-340nm and the irradiation time is 30s-10min.

[0087] See further Figure 2 , Figure 5 As shown, rolling circle amplification detection (RCA) is used to amplify the signal of low-copy nucleic acid fragments, which facilitates reading.

[0088] The RCA reaction comprises four components: ① a circular DNA template (RCA template) sequence designed as (5'-PAGCCTCGCCTTTGCCTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTTCGCCCCGCGAGCACAG); ② a DNA / RNA initiating strand (target nucleic acid fragment) partially complementary to the RCA template; ③ a Phi29 DNA polymerase with strand displacement activity; and ④ deoxyribonucleoside triphosphates (dNTPs). The RCA template is a single-stranded DNA molecule. If the target sequence is present, this single-stranded DNA molecule will become complementary to the target sequence, forming a partially double-stranded structure. Under the action of DNA ligase, the 5' phosphate end (5'-P) and the 3' hydroxyl end (3'-OH) of the template DNA are cyclized, forming a circular template for subsequent amplification. The amplification of the circular template depends on the Phi29 DNA polymerase, which has strand displacement and continuous synthetic activity, and its optimal temperature is 30°C. Phi29 DNA polymerase possesses strong 5'-3' polymerization activity and 3'-5' exonuclease activity, generating amplicons larger than 70 kbp within 20 minutes. Its amplification sensitivity reaches single-copy levels, and due to its 3'-5' exonuclease activity, it can proofread the synthesized single-stranded sequences with high fidelity. The amplified linear DNA sequence contains numerous repetitive fragments. At this point, a nucleic acid probe Cy3-N-hydroxysuccinimide ester with a fluorescent terminal is added. The sequence design is 5'-CCTCAATGCTGCTGCTGTACTAC. This probe specifically binds to the linear sequence, generating a detectable localized signal. Excess probe is washed with TBST at room temperature to reduce background interference, and the fluorescence signal is observed using a confocal microscope.

[0089] The structural formula of Cy3 (Cyanine 3) is shown below:

[0090]

[0091] Of course, in some embodiments, in addition to the circular DNA template mentioned above, dumbbell-shaped or dumbbell-like circular DNA templates can also be selected for rolling circle amplification, as shown in the figure below. Figure 3 As shown.

[0092] Furthermore, in some embodiments, the type of rolling circle amplification DNA template is not limited to the linear amplification described above, but also includes superbranched amplification or multi-primer amplification, etc., with amplification methods such as... Figure 4 As shown.

[0093] Of course, the probe is not limited to the fluorescent nucleic acid probe Cy3-N-hydroxysuccinimide ester. It can also be any of the following: enzyme, colloidal gold, or superparamagnetic microsphere labeled antibody. No further restrictions are imposed here.

[0094] Test case

[0095] In this invention, the detection of the AF594 gene is specifically taken using rolling circle amplification and a Cy3-modified probe, as an example. The results are as follows: Figure 6 , Figure 7 As shown.

[0096] The detection method of this invention reveals that the fluorescence intensity of the target AF594 gene and the staining results of the rolling circle amplification product are comparable.

[0097] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A method for detecting trace nucleic acids based on photosensitive gels for non-disease diagnosis and treatment purposes, characterized in that, Includes the following steps: S1: Design and synthesize nucleic acid probes and circular DNA templates based on the nucleic acid sequence of the target gene; S2: The sample to be tested is dropped onto the chip template whose surface is covered with photosensitive gel solution, and electrophoresis is performed. The electrophoresis conditions are: electrophoresis in 0.5×TBE buffer at 120V for 3 minutes. After electrophoresis, nucleic acids are fixed by UV cross-linking; the wavelength of the UV light is 300-340nm, and the irradiation time is 30s-10min; the chip template with the surface covered by photosensitive gel solution is pre-electrophoresis with 0.5X TBE electrophoresis buffer and 120V on ice for 60 minutes before use; before the sample to be tested is dropped onto the chip template with the surface covered by photosensitive gel solution, the following pretreatment steps are also included: trypsin-EDTA is added to the cells of the sample to be tested, digestion is performed at 37 degrees Celsius, then neutralized with serum, resuspended by PBS, and then dropped onto the surface of the chip template with the surface covered by photosensitive gel solution; The photosensitive gel was prepared by the following method: N-(3-methacrylamidopropyl)-2-(1-methyl-1H-pyrrolo-2-yl)-2H-tetrazole-5-carboxamide (MAP-mPyTC) was copolymerized with acrylamide and N,N'-methylenebisacrylamide to form mPyTC-modified polyacrylamide gel; the mPyTC-modified polyacrylamide gel solution was diluted to a mass fraction of 6% to obtain the photosensitive gel; the mPyTC-modified polyacrylamide gel solution was diluted with a mixed solution prepared by 250ul 1X TBE solution, 129.5ul ddH2O, 100ul 30% concentration of acrylamide and methylene acrylamide composite solution, 12.5ul glycerol, 4ul APS, and 4ul TEMED, and the mass fraction of the diluted mPyTC-modified polyacrylamide gel solution was 6%; S3: Using a circular DNA template as a template, a target nucleic acid fragment immobilized on a photosensitive gel and partially complementary to the circular DNA template is used as the initiating strand for rolling circle amplification to obtain the amplified linear DNA sequence; S4: Add a nucleic acid probe with a labeled antibody at the end to the amplified linear DNA sequence. The nucleic acid probe specifically binds to the linear DNA sequence to generate a local specific signal for detection. Trace nucleic acid detection is achieved by observing the fluorescence signal.

2. The trace nucleic acid detection method based on photosensitive gel for non-disease diagnosis and treatment purposes as described in claim 1, characterized in that: In step S2, the method for preparing the chip template with the surface covered by the photosensitive gel solution is as follows: The photosensitive gel solution was spread on the chip template, then covered with a silanized glass slide. The slide was then lifted, and the chip template was stored in a humid chamber.

3. The trace nucleic acid detection method based on photosensitive gel for non-disease diagnosis and treatment purposes as described in claim 2, characterized in that: The method for preparing the silanized glass slide is as follows: treat the standard glass slide with a silanizing agent for 30 minutes, then wash it twice with methanol and deionized water respectively, and then dry it with nitrogen to obtain the slide.

4. The trace nucleic acid detection method based on photosensitive gel for non-disease diagnosis and treatment purposes as described in claim 1, characterized in that: In step S2, before electrophoresis, the sample to be tested is loaded onto a chip template with a photosensitive gel solution on its surface for 5-10 minutes. Then, excess cells are washed with phosphate buffer before electrophoresis.

5. The trace nucleic acid detection method based on photosensitive gel for non-disease diagnosis and treatment purposes as described in claim 1, characterized in that: In step S4, the labeled antibody is selected from any one of fluorescent, enzyme, colloidal gold, and superparamagnetic microsphere labeled antibodies.

Images