Stable InDels markers closely linked to the high lint percentage trait in upland cotton and their applications

Abstract

This invention belongs to the field of molecular biology, specifically relating to InDels molecular markers closely linked to lint formation in upland cotton, their applications, and primer pairs for detection. This invention can be directly used for marker-assisted selection of upland cotton, laying the foundation for research on the molecular mechanisms of lint formation and the breeding of high-yield, high-quality varieties.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the InDels molecular markers closely linked to terrestrial cotton pelts and their applications. Background Technology

[0002] Upland cotton ( Gossypium hirsutum Upland cotton (L.) accounts for over 90% of global cotton cultivation due to its wide adaptability and high yield. Currently, 95% of my country's raw cotton production comes from upland cotton. However, with increasing demand and improvements in textile technology, higher requirements are being placed on cotton yield (Li et al. 2015). Long-term natural selection and artificial breeding have generated a large amount of upland cotton germplasm resources. In-depth exploration of the genomic variations of core germplasm and, based on this, the development of molecular markers, is of great significance for promoting the effective selection of high-quality and high-yield traits in upland cotton.

[0003] Obtaining molecular markers closely linked to superior genes is essential for achieving marker-assisted selection (MAS). Traditional molecular markers used for genotyping include restriction fragment length polymorphism (RFLP), random amplification polymorphism DNA (RAPD), simple sequence repeat (SSR), and amplification fragment length polymorphism (AFLP) (Xu et al., 2007). These molecular marker technologies have been widely applied in genome mapping, gene localization, marker-assisted breeding, species phylogenetic identification, gene bank construction, and gene cloning, but they still have limitations.

[0004] First, molecular marker screening is generally achieved by analyzing their linkage relationships with related major QTLs (Terauchi et al. 2013). However, the genetic background differences among different breeding materials vary, and the molecular markers currently developed are limited by polymorphism issues and cannot be widely applied (Schneeberger et al. 2009; Zerbino et al. 2008).

[0005] Secondly, the resolution of high-density linkage maps depends on the density of molecular markers. The number of existing molecular markers in databases is insufficient to meet the needs of fine localization of certain target genes, thus affecting the screening of tightly linked markers.

[0006] Furthermore, the genetic backgrounds of the hybrid parents used to construct the mapping population generally differ significantly. In early-generation segregating populations, the complex gene interactions resulting from locus recombination can also affect the stability of some gene effects and the selection of linkage markers. While using recombinant inlines (RILs) for QTL analysis can avoid these drawbacks, the population construction cycle is lengthy, impacting the breeding process (Birchler et al. 2013).

[0007] Therefore, based on resequencing, we will develop InDels markers based on single nucleic acid variations through whole-genome variation analysis, aiming to make full use of existing germplasm resources and achieve synergistic improvement of genomic composition and quality of upland cotton through molecular marker-assisted selection.

[0008] Therefore, we performed high-throughput sequencing on the parents used to construct the mapping population. Then, based on the insertion-deletion variation of the parents, we developed a high-density InDels marker and used it for genotyping of the offspring. Finally, linkage analysis was performed using phenotypic values ​​of the target trait from the secondary population. The markers obtained that were closely linked to the high pelvic index trait could be directly applied to marker-assisted selection (MAS).

[0009] Zhongmian Institute 127 is a high-quality upland cotton variety successfully bred by the Molecular Breeding Group of the Cotton Institute, Chinese Academy of Agricultural Sciences in recent years. Its main drawback is low lint percentage. Zhongmian Institute 60, also a high-yielding upland cotton variety bred in this project, exhibits high lint percentage. We constructed F2 mapping populations using both as parents. After analysis using a bulked-segregant analysis combined with next-generation sequencing (NGS-BSA), the lint percentage-related QTLs were located within a candidate region of Chr. D09 at 6.30 Mb. This region contained as many as 465 genes, yet it was still impossible to accurately identify a marker closely linked to the target gene. Therefore, after completing the NGS-BSA mapping, it is essential to develop a molecular marker closely linked to stable lint percentage QTLs.

[0010] References

[0011] Birchler JA, Yao H, Chudalayandi S, Vaiman D, and Veitiac RA (2010)Heterosis. The Plant Cell 22(7): 2105-2112

[0012] Li F, Fan G, Lu C, Xiao G, Zou C, Kohel RJ, Ma Z, Shang H, Ma X, WuJ, Liang X, Huang G, Percy RG, Liu K, Yang W, Chen W, Du X, Shi C, Yuan Y, YeW, Liu X, Zhang X, Liu W, Wei H, Wei S, Huang G, Zhang X, Zhu S, Zhang H, SunF, Wang X, Liang J, Wang J, He Q, Huang L, Wang J, Cui J, Song G, Wang K, XuX, Yu JZ, Zhu Y, Yu S (2015) Genome sequence of cultivated Upland cotton( Gossypium hirsutum TM-1) provides insights into genome evolution. NatBiotechnol 33(5): 524-30

[0013] Schneeberger K, Ossowski S, Lanz C, Juul T, Petersen AH, Nielsen KL,Jørgensen JE, Weigel D, Andersen SU (2009) SHOREmap: simultaneous mapping andmutation identification by deep sequencing. Nat Methods 6(8): 550-551

[0014] Terauchi, Ryohei, Mitsuoka, Chikako, Tamiru, Muluneh, Akira, Yoshida,Kentaro, Kosugi (2013) QTL-seq: rapid mapping of quantitative trait loci inrice by whole genome resequencing of DNA from two bulked populations. ThePlant Journal 74(1): 174-183

[0015] Zerbino DR, Birney E (2008) Velvet: algorithms for de novo short readassembly using de Bruijn graphs. Genome Res 18(5): 821-829

[0016] Zhu XY, Lehrman MA (1990) Cloning, sequence, and expression of a cDNAencoding hamster UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase. J Biol Chem 265(24): 14250-14255

[0017] Xu Lifang, Chen Jiyan, Luo Guangming (2007) Molecular marker technology and its application in plant breeding. Food and Drug 9(010): 43-46. Summary of the Invention

[0018] Given the current problems with the abundance, polymorphism, and stability of molecular markers used for genotyping, this invention aims to address how to provide nucleotide insertion-deletion polymorphisms (InDels) that are closely linked to stable QTLs in the coat of *Cottongrass arborescens*, thereby further expanding the marker database and providing a basis for gene localization, map-based cloning, marker-assisted selection, and species phylogenetic identification.

[0019] The present invention first provides a molecular marker derived from the Chinese Cotton Research Institute 60 that is closely linked to the high lint percentage trait of upland cotton, which is the InDels_077-InDels_079 marker located on chromosome D09.

[0020] The present invention also provides the application of the aforementioned molecular markers in cotton genetic breeding, specifically for breeding cotton varieties with high lint percentage, more preferably upland cotton varieties.

[0021] The present invention further provides primer pairs for detecting the high lint percentage trait in cotton, characterized in that,

[0022] The sequence of its primer pair is as follows:

[0023] The forward primer sequence is 5'-TGGTCAGGTTAGGCTCAAGG-3';

[0024] The reverse primer sequence is: 5'-GGCACGTCATTATTGGTTGGT-3'; or

[0025] The forward primer sequence is 5'-CATCATTCCATAGCAAACACCTAC-3';

[0026] The reverse primer sequence is: 5'-GTCTCCTTAATTTCTCCATTTCTCC-3'.

[0027] This invention also provides primer pair combinations for detecting the high lint percentage trait in cotton, characterized in that,

[0028] The sequence of its first primer pair is:

[0029] The forward primer sequence is 5'-TGGTCAGGTTAGGCTCAAGG-3';

[0030] The reverse primer sequence is: 5'-GGCACGTCATTATTGGTTGGT-3';

[0031] The sequence of the second primer pair is:

[0032] The forward primer sequence is 5'-CATCATTCCATAGCAAACACCTAC-3';

[0033] The reverse primer sequence is: 5'-GTCTCCTTAATTTCTCCATTTCTCC-3'.

[0034] The present invention thereby provides the application of the primer pairs or combinations thereof in cotton genetic breeding, specifically for breeding cotton varieties with high lint percentage, more preferably upland cotton varieties.

[0035] Specifically, upland cotton breeding materials are identified during the seedling stage to determine the marker genotype of each individual plant, and the target traits of individual plants are investigated and verified in the later stage.

[0036] Preferably, the specific method is as follows: extract genomic DNA from the sample to be identified, and perform PCR amplification on the extracted DNA using the primer pair. If 345 bp and 305 bp products can be amplified respectively, the single plant is preliminarily identified as having a high peltate trait.

[0037] The advantages of this invention are as follows:

[0038] 1. Primers InDels_079 and InDels_077, used to identify the high lint percentage trait in upland cotton, were able to explain more than 16.63% of the lint percentage variation in the F2 segregating population, with a LOD value as high as 45.38 or more. They can be directly used for molecular marker-assisted selection of upland cotton, laying the foundation for the study of the molecular mechanism of lint percentage formation and the breeding of high-yield and high-quality varieties.

[0039] 2. The InDels primers involved in this invention are derived from single nucleotide variant analysis of the whole genome of Z641 (Zhongmian Institute 127) and Zhongmian Institute 60. Compared with earlier molecular markers, InDels markers have significant advantages in terms of abundance and polymorphism. The InDels_079-InDels_077 interval is only 30.67 Kb and contains only 4 candidate genes, which can be determined to be closely linked to the target trait, and the accuracy of using them to identify target QTLs is higher.

[0040] 3. InDels_079 and InDels_077 are codominant markers that can detect both dominant and recessive alleles simultaneously, distinguish between homozygous and heterozygous genotypes, and are more efficient for marker-assisted selection.

[0041] 4. Based on the completion of the high-density linkage map construction, we will analyze the F2 offspring and F... 2:3 Lining percentage data from different strains were used for QTL identification. The candidate regions of the target genes obtained overlapped with each other, so InDels_079-InDels_077 were stable markers closely linked to the high linting percentage trait in upland cotton.

[0042] 5. During the seedling stage, molecular marker-assisted selection (MAS) can be performed using InDels_079-InDels_077 to optimize the selection of high-yield individual plants / lines of upland cotton, thereby improving breeding efficiency and accelerating the breeding process. Attached Figure Description

[0043] Figure 1 High-density linkage maps for InDels ( qLPMappedByF 2 -d09-1 and qLPMappedByF 3 -d09-1 Based on F2 single plants and their F1 and F2 single plants respectively 2:3 Candidate intervals obtained after QTL identification of clothing composition data.

[0044] Figure 2 for qLPMappedByF 2 -d09-1 and qLPMappedByF 3-d09-1 The additive effect indicates that the high lint percentage trait originates from the parent cotton plant 60.

[0045] Figure 3 The results of tagging and genotyping 94 F2 samples using the InDels_079-InDels_077 primer pair (left 1 and left 2 represent Zhongmian Institute 60 and Zhongmian Institute 127 respectively, and the remaining samples are labeled with primers from left to right). Figure 2 correspond).

[0046] Figure 4 Marker-assisted selection for lint percentage in upland cotton (dark gray shading indicates F2 samples with the high lint percentage parental genotype Zhongmian Institute 60; these samples can be used as high lint percentage materials for further selection).

[0047] Figure 5 The phenotypic differences in F2 samples with parental marker genotypes were observed (P<0.01). Detailed Implementation

[0048] Example 1

[0049] 1. InDels molecular markers closely linked to lining fraction were obtained through the following methods:

[0050] (1) Both Zhongmian Institute 127 (i.e., Z641) and Zhongmian Institute 60 are upland cotton varieties bred in recent years by the Molecular Breeding Research Group of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. Zhongmian Institute 127 has high fiber quality, but its main defect is low lint percentage. We used Zhongmian Institute 127 as the male parent and the high lint percentage variety Zhongmian Institute 60 as the female parent to construct an F2 mapping population containing 1138 individual plants. The F2 individual plants were self-pollinated to obtain F2 plants. 2:3 Inbred lines. Linal percentage data for each line were derived from the mean of 30 individual data points for that line. Linal percentage phenotypic values ​​were used to differentiate between the F2 and F3 populations. 2:3 Frequency distribution within family groups: 25 families with extreme clothing scores were selected from each of the F2 groups. 2:3Genomic DNA was extracted from F2 single plants of the same phenotype as the pelvic morphology. DNA samples were mixed at equimolar concentrations according to the two extreme pelvic morphology values ​​to construct two BSA sequencing pools. Through NGS-BSA analysis, we obtained the major-effect QTLs contributing the most to pelvic morphology variation. Following the QTL nomenclature principle (Mccouch SR, Cho YG, Yano M, Paul E, Blinstrub M, Morishima H, Kinosita T, Mccouch SR, Cho YG, Yano M, Paul E, Morishima H, Cho YG, Yano M, Mccouch S, Yano PE, Kinoshita T, Mccouch S, ChoY, Paul E, Blinstrub M, Morishima HM, Mccouch SR, Kinoshita T. Report on QTL nomenclature[J]. Rice Genet Newsl, 1997, 14: 11-13), we named it... qLP-d09-1 It covers 6.30 Mb.

[0051] (2) By comparing the Illumina resequencing data of Zhongmian Institute 127 and Zhongmian Institute 60 with the cotton reference genome (http: / / ibi.zju.edu.cn / cotton / ) and performing interparental variation analysis, information on intergenomic nucleotide insertion-deletion variation can be obtained, and this mutation is present in... qLP-d09-1 Numerous intervals also exist. Based on this, we designed 80 pairs of InDels primers and collected 14 pairs of SSR primers from the database (https: / / www.cottongen.org / find / markers). All primer pairs were used to genotype 1138 F2 samples to construct a high-density genetic linkage map. The 60 effective markers with specific genetic locations covered a length of 15.05 cM on the linkage map, with an average distance of only 0.251 cM between adjacent markers. Figure 1 Regression analysis results confirmed that the genetic map can explain the physical location of each molecular marker in the genome, with a goodness of fit. R 2 = 0.96783.

[0052] (3) Unlike previous QTLs positioning, in addition to using 1138 F2 individual plant lint percentage data for QTL analysis, we also used F 2:3Family pellucida data were used to replace F2 individual plant data for another QTL analysis. To filter out loci with low effect values, a high LOD threshold (> 5.0) was set, which significantly narrowed down the candidate regions for the target gene. qLPMappedByF 2 -d09-1 and qLPMappedByF 3 -d09-1 Report on QTLnomenclature[J]. Rice Genet Newsl, 1997, 14: 11-13) ( Figure 1 (Table 1). Furthermore, the F2 group and F... 2:3 The QTLs for clothing categories based on family lineage completely overlap. qLPMappedByF 2 -d09-1 and qLPMappedByF 3 -d09-1 The additive effects were all positive, meaning the lint-increasing gene originated from the high-lint-increasing parent cotton variety 60 (…). Figure 2 ).

[0053] Table 1. QTLs Fine-Search and Closely Linked InDels Marker Selection

[0054] QTLs Chr. Left marker Right marker LOD PVE (%) Add Dom <![CDATA[ qLPMappedByF 2 -d09-1 ]]> 23(D09) InDels_079 InDels_077 45.3881 16.6364 1.6218 -0.0268 <![CDATA[ qLPMappedByF 3 -d09-1 ]]> 23(D09) InDels_079 InDels_077 42.5938 15.7349 1.0645 0.0558

[0055] (4) InDels_079-InDels_077 and qLPMappedByF 2 -d09-1 or qLPMappedByF 3 -d09-1 The markers are tightly linked and co-dominant between the parents. The amplification products of InDels_079-InDels_077 for F2 samples were analyzed by SDS-polyacrylamide gel electrophoresis. The banding pattern of the low-content samples was consistent with that of Zhongmian Institute 127, while the banding pattern of the high-content samples was consistent with that of Zhongmian Institute 60.

[0056] 2. Regarding InDels_079-InDels_077:

[0057] The InDels_077-InDels_079 markers, closely linked to the high lint percentage trait in the upland cotton variety Zhongmian 60, are located on chromosome D09. The InDels_077 PCR product is 345 bp. The forward primer sequence is 5'-TGGTCAGGTTAGGCTCAAGG-3' (SEQ ID No. 1), and the reverse primer sequence is 5'-GGCACGTCATTATTGGTTGGT-3' (SEQ ID No. 2). The annealing temperatures (Tm) are 54.6℃ and 55.1℃, respectively, and the GC base content (GC %) is 47.6%. The InDels_079 amplification product was 305 bp. The forward primer sequence was 5'-CATCATTCCATAGCAAACACCTAC-3' (SEQ ID No. 3), and the reverse primer sequence was 5'-GTCTCCTTAATTTCTCCATTTCTCC-3' (SEQ ID No. 4). The annealing temperatures (Tm) were 54.5℃ and 54.1℃, respectively, and the GC base content (GC %) was 40.0%.

[0058] 3. Application of InDels_077-InDels_079 in cotton genetics and breeding:

[0059] Target trait screening: Utilizing the linkage relationship between InDels_077-InDels_079 and the high lint percentage trait in upland cotton, upland cotton breeding materials can be identified at the seedling stage to determine the marker genotype of each individual plant. Later, the target trait of each plant is investigated and verified. The specific method is as follows: Genomic DNA is extracted from the samples to be identified using the CTAB method. PCR amplification is performed on the extracted DNA using primers with sequences SEQ ID No. 1-SEQ ID No. 2 and SEQ ID No. 3-SEQ ID No. 4. The amplified products are subjected to SDS-PAGE and then labeled using a DL2000 Plus DNA Marker (Vazyme). If products of 345 bp and 305 bp are amplified respectively, the individual plant is preliminarily identified as having the high lint percentage trait.

[0060] (1) CTAB method operation procedure:

[0061] ① Grinding: Place young leaves in a 2 mL centrifuge tube, pre-cool with liquid nitrogen, and grind into powder. ② Lysis: Add 800 μL of CTAB lysis buffer preheated to 65 ℃ (β-mercaptoethanol needs to be added fresh, 1.5 mL / 100 mL), and continue incubation at 65 ℃ for 45 min. ③ RNA Digestion: Cool the above mixture to room temperature, add 5 μL of RNase, and incubate at 37 ℃ for 30 min. ④ Extraction: Add 500 μL of chloroform / isoamyl alcohol (24 / 1), mix well, and centrifuge (4 ℃, 12000 rpm, 10 min). Transfer the supernatant to a 2 mL centrifuge tube. ⑤ Precipitation: Add 0.6 times the volume of ice-cold isopropanol, invert until white flocculent material (DNA) is formed, and transfer the flocculent material to a 1.5 mL centrifuge tube. ⑥ Washing: Wash twice with 70% ethanol and once with anhydrous ethanol, discard the liquid, and air dry. ⑦ Dissolve: Dissolve in 200-700 μL of TE solution (pH 8.0) overnight at 4℃, and store at -20℃ for later use.

[0062] (2) High-fidelity PCR system (Novizan Phanta reagent kit) ® Max Super-Fidelity DNAPolymerase):

[0063] ① ddH2O 18 μl; ② 2×Phanta Max Buffer 25 μl; ③ dNTP Mix (10 mM each) 1 μl; ④ Upstream primer (10 μM) 2 μl; ⑤ Downstream primer (10 μM) 2 μl; ⑥ Phanta Max Super-Fidelity DNA Polymerase 1 μl; ⑦ Template DNA 1 μl (50 ng / μl).

[0064] (3) High-fidelity reaction procedure (Novizan Phanta reagent kit) ® Max Super-Fidelity DNAPolymerase):

[0065] ① Pre-denaturation at 95 ℃ for 3 min; ② Denaturation at 95 ℃ for 15 sec; ③ Annealing at 59 ℃ for 15 sec; ④ Extension at 72 ℃ for 45 sec, with ②~④ repeated for 20 cycles; ⑤ Complete extension at 72 ℃ for 5 min; ⑥ Store the high-fidelity amplification product at 4 ℃.

[0066] Example 2

[0067] 1. The high-quality upland cotton variety Zhongmian Institute 127 (i.e. Z641) was used as the male parent and the high-yield variety Zhongmian Institute 60 was used as the female parent for hybridization. The F1 generation was then self-pollinated to obtain the F2 population containing 1138 individual plants.

[0068] 2. Ninety-four consecutive F2 plants were selected as samples for identification based on their individual plant serial numbers, with two parent plants serving as controls. Genomic DNA was extracted from young leaves of these 96 samples using the CTAB method.

[0069] Steps for extracting genomic DNA from upland cotton:

[0070] step Detailed instructions Grinding sample Place the tender leaves in a 2 mL centrifuge tube, pre-cool with liquid nitrogen, and grind into powder. Pyrolysis Add 800 μL of CTAB lysis buffer preheated at 65℃ (β-mercaptoethanol needs to be added fresh, 1.5 mL / 100 mL). RNA digestion Cool the above mixture to room temperature, add 5 μL of RNAase, and incubate in a 37°C water bath for 30 min. Extraction Add 500 μL of chloroform / isoamyl alcohol (24 / 1), mix well and centrifuge (4℃ / 12000 rpm / 10 min), and aspirate the supernatant into a 2 ml centrifuge tube. precipitation Add 0.6 times the volume of ice-cold isopropanol, invert until white flocculent material (DNA) appears, then transfer it to a 1.5 mL centrifuge tube. washing Wash twice with 70% ethanol and once with anhydrous ethanol. Discard the liquid and air dry. Dissolve Dissolve 200-700 μL of ddH2O overnight at 4℃.

[0071] 3. High-fidelity PCR amplification was performed on the selected samples and parents using primers InDels_079-InDels_077.

[0072] High-fidelity PCR reaction system (NovaZeneca Phanta® Max Super-Fidelity DNA Polymerase kit):

[0073] Components volume <![CDATA[ddH2O]]> 18 μl 2 × Phanta Max Buffer 25 μl dNTP Mix (10 mM each) 1 μl Upstream primer (10 μM) 2 μl Downstream primer (10 μM) 2 μl Phanta Max Super-Fidelity DNA Polymerase 1 μl Template DNA (50 ng / μl) 1 μl

[0074] High-fidelity PCR reaction procedure (NovaZeneca Phanta® Max Super-Fidelity DNA Polymerase kit):

[0075]

[0076] 4. Molecular marker-assisted selection and phenotypic verification.

[0077] PCR products were loaded onto an SDS-polyacrylamide gel at a standard concentration of 1.7 μl and electrophoresed at a constant voltage of 120V for 45 min. After staining with 1 g / L AgNO3 for 5 min, the gel was developed with 20 g / L NaOH and 10 ml / L CH2O. Then, the gel detection results for each label were statistically analyzed using the parental banding patterns as a reference. The migration rate of the amplified products from Zhongmian Institute 60 was higher than that of Zhongmian Institute 127 (Z641), and the amplified banding patterns of InDels_077 and InDels_079 were consistent for each F2DNA sample to be identified. Figure 3 The lint percentage data corresponding to the parent plants and F2 individual plants in the gelatin diagram are as follows: Figure 4 As shown, samples with the same banding pattern as Zhongmian Institute 60 all exhibited higher lint percentages, while the lint percentages of heterozygous samples fell between those of Zhongmian Institute 60 and Zhongmian Institute 127 (Z641). Furthermore, due to the influence of hybrid dominance, the target phenotype of heterozygous samples was closer to the high-value parent. In addition, we statistically analyzed the lint percentage data of F2 plants with different parental banding patterns. The mean lint percentage of F2 plants with the same banding pattern as Zhongmian Institute 60 was significantly higher than that of F2 plants with the banding pattern of Zhongmian Institute 127 (P < 0.01). Figure 5The results of the examples show that InDels_079-InDels_077 are closely linked to the lint percentage gene in upland cotton, and can be used for marker-assisted selection of the high lint percentage trait in upland cotton to improve the breeding efficiency of high-yielding varieties.

[0078] The embodiments described above merely illustrate specific implementation methods of this application, but should not be construed as limiting the scope of protection of this application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the technical solution of this application, and these modifications and improvements all fall within the scope of protection of this application. <110> Cotton Research Institute, Chinese Academy of Agricultural Sciences <120> Stable InDels markers closely linked to the high lint percentage trait in upland cotton and their applications <160> 4 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <400> 1 TGGTCAGGTTAGGCTCAAGG 20 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <400> 2 GGCACGTCATTATTGGTTGGT 21 <210> 3 <211> twenty four <212> DNA <213> Artificial sequence <400> 3 CATCATTCCATAGCAAACACCTAC 24 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <400> 4 GTCTCCTTAATTTCTCCATTTCTCC 25

Claims

1. The application of a primer combination in cotton genetic breeding, wherein the application is for breeding cotton varieties with high lint percentage, and wherein the cotton variety is Zhongmian 60 or an upland cotton variety with its genetic background; wherein, The primer pair includes a first primer pair and a second primer pair, the sequence of which is: The forward primer sequence is 5'-TGGTCAGGTTAGGCTCAAGG-3'; The reverse primer sequence is: 5'-GGCACGTCATTATTGGTTGGT-3'; The sequence of the second primer pair is: The forward primer sequence is 5'-CATCATTCCATAGCAAACACCTAC-3'; The reverse primer sequence is: 5'-GTCTCCTTAATTTCTCCATTTCTCC-3'; The method described is as follows: extract genomic DNA from the sample to be identified, and perform PCR amplification on the extracted DNA using the primer combination. If 345 bp and 305 bp products can be amplified respectively, the single plant is preliminarily identified as having a high peltate trait.

Images