Primer-probe combination for RPA-LFS detection of Staphylococcus epidermidis and its application

Abstract

The present invention discloses a primer-probe combination for RPA-LFS detection of Staphylococcus epidermidis and its application. First, five pairs of primers were designed using the SesB gene as a molecular diagnostic target and screened based on their amplification performance and primer-dimer formation. A specific probe was then designed based on the optimal screened primer pair. This probe is susceptible to primer-dependent artifacts when using LFS for detection, generating false-positive signals. This weakness of LFS detection was overcome by modifying the primer and probe sequences. These measures were rigorously tested for efficacy, thereby establishing an improved RPA-LFS system. Compared with PCR, this method achieved accurate and consistent detection results. The overlap rate with culture-biochemical methods was 97.78%, and the kappa index value was 0.938. This method is rapid, accurate, and less dependent on equipment and trained personnel, and can provide information for the timely formulation of reasonable antimicrobial treatment plans.

Description

Technical Field

[0001] The present invention relates to the field of Staphylococcus epidermidis detection, and in particular to a Staphylococcus epidermidis RPA-LFS detection primer-probe combination and application thereof. Background Art

[0002] Staphylococcus epidermidis is a normal parasitic flora of human skin and mucous membranes and is a conditionally pathogenic bacterium. However, in recent years, with the increase of invasive procedures such as artificial valves, artificial joints, and indwelling intravenous catheters, and with the emergence of an aging population and people with low immunity, Staphylococcus epidermidis has become a common pathogen of nosocomial infections. Pathogenic Staphylococcus epidermidis can cause skin and soft tissue infections such as furuncles, carbuncles, and folliculitis, and can also cause systemic visceral and systemic infections such as pneumonia, brain abscesses, liver abscesses, suppurative osteomyelitis, and wound infections. In treatment, Staphylococcus epidermidis has a high resistance rate to penicillin, ampicillin, oxacillin, and erythromycin, particularly to penicillin, which is as high as 90%. Multidrug-resistant Staphylococcus epidermidis has also been reported. There is currently no commercial vaccine for preventing Staphylococcus epidermidis infection. Therefore, rapid and accurate detection of Staphylococcus epidermidis is the key to its prevalence in clinical prevention and is of great significance to the generation of control nosocomial infections.

[0003] At present, the methods for detecting Staphylococcus epidermidis in clinical work include conventional smear microscopy, culture method, immunological assay, instrument automatic analysis and identification system, etc. However, these methods all have certain defects. For example, conventional smear microscopy is the most basic bacteriological examination method, but it has low sensitivity and poor specificity; culture method is currently the main way and means to find the source of infection in clinical practice, but it is very time-consuming and cannot achieve the purpose of rapid detection; immunological assay method has high requirements for the salt content of culture medium. If the salt content is relatively high, protein synthesis will be inhibited, resulting in false negatives; in recent years, instrument automatic analysis and identification systems have been continuously launched on the market, but most of these identification systems have a narrow application range, are expensive, and are difficult to promote and use widely. Molecular biological detection methods have been widely developed and applied in disease diagnosis and scientific research due to their advantages such as simplicity, speed, high sensitivity and strong specificity, but they have high requirements for instruments and equipment. The defects of these methods limit their promotion and application in clinical testing at the grassroots level and in remote areas.

[0004] Recombinase Polymerase Amplication (RPA) is a novel isothermal nucleic acid amplification technology. It primarily utilizes the interaction of three enzymes: T4 bacteriophage uvsX recombinase and its auxiliary factor uvsY, DNA polymerase (recombinase), and single-stranded binding protein (SSB). It exponentially amplifies the target fragment within 30 minutes at 37°C. The entire amplification reaction requires no expensive instrumentation, only standard laboratory equipment such as a constant temperature water bath or metal bath. It is a simple, rapid, low-cost, field-ready molecular detection technology with high specificity and sensitivity. RPA has been successfully applied to the detection of various microorganisms, but its application to the detection of Staphylococcus epidermidis has not been reported.

[0005] Lateral flow strips combined with recombinase polymerase amplification (RPA) technology are based on the principles of RPA and the "double-antibody sandwich" method, enabling rapid detection of amplification products and visual visualization. In RPA-LFS, a probe labeled with FITC at its 5' end and a reverse primer labeled with biotin are added. After the reaction, the amplification product carries both biotin and FITC labels. The RPA-amplified product is detected using a lateral flow strip. Based on the antigen-antibody immune reaction, the FITC-biotin dual-labeled amplicon binds to gold-labeled particles labeled with anti-FITC antibodies to form a ternary complex. This complex diffuses upward on the immunochromatographic strip. When it reaches the test line labeled with biotin, it is captured and visualized. Uncaptured probes and the gold-labeled anti-FITC antibody form a two-component complex without biotin, which continues to diffuse upward and is captured and visualized when it reaches the control line labeled with anti-FITC (as shown in Figure 1). Summary of the Invention

[0006] The purpose of the present invention is to address the defects of the prior art and provide a primer-probe combination for RPA-LFS detection of Staphylococcus epidermidis and its application, so as to solve the problems raised by the above background technology.

[0007] To achieve the above objectives, the present invention provides the following technical solutions: The present invention provides a primer-probe combination for RPA-LFS detection of Staphylococcus epidermidis, including a SesB-1-F / R / P1 primer-probe combination and a SesB-2-F / R / P2 primer-probe combination;

[0008] In the SesB-1-F / R / P1 primer-probe combination;

[0009] The sequence of SesB-1-F is: ATAAATCTGGTGCAGGTGTCGGTACTTATAA;

[0010] The sequence of SesB-1-R is: GGTAAAGTGTAATGAAACCAGCAGTGAGTA;

[0011] The sequence of P1 is: FITC- AGGTCAAGTTCAATCTTCTGACTTACCACA[THF] CAAAGTTCATCTGAT-C3-spacer;

[0012] In the SesB-2-F / R / P2 primer-probe combination;

[0013] The sequence of SesB-2-F is: TAATAAATCTGGTGCAGGTGTCGGTACTTA;

[0014] The sequence of SesB-2-R is: GGTAGCATATCAGATGAACTTTGTTGTGGT;

[0015] The sequence of P2 is: FITC-CAACTCAATACAGCACAATGTTATGTTGCA [THF]AAGATATTGCTACAA -C3-spacer.

[0016] Application of primer-probe combination for RPA-LFS detection of Staphylococcus epidermidis. The SesB-1-F / R / P1 primer-probe combination and the SesB-2-F / R / P2 primer-probe combination are both used for RPA-LFS detection of Staphylococcus epidermidis, among which SesB-1-F / R / P1 is the best primer-probe combination.

[0017] The present invention utilizes RPA-LFS technology to develop a rapid detection method for Staphylococcus epidermidis based on recombinase polymerase amplification (RPA) and lateral flow strip (LFS) technology. This method can complete detection at 37°C in 25 minutes and has good interspecies specificity and sensitivity. Clinical samples were tested using RPA-LFS, PCR, and culture methods. The results showed that the detection results of RPA-LFS and PCR methods were the same, and the detection consistency with the culture method was 97.78%. The RPA-LFS detection system is rapid, portable, simple to operate, highly specific, and highly sensitive. It has good development prospects in on-site rapid detection and is also of great significance for the prevention and monitoring of clinical Staphylococcus epidermidis.

[0018] The beneficial effects of the present invention are: the method first SesBFive pairs of primers were designed for the target gene for molecular diagnosis and were screened based on their amplification performance and primer dimer formation. Specific probes were then designed based on the optimal primer pairs screened. LFS detection is susceptible to primer-dependent artifacts, generating false-positive signals. This weakness of LFS detection was overcome by modifying the sequences of primers and probes. These measures were rigorously tested for efficacy, resulting in the establishment of an improved RPA-LFS system. The standardized method can complete the amplification process within 25 minutes at a constant temperature of 37°C, and LFS can produce visible results within 3 minutes. The method is highly sensitive, with a minimum detection limit of 8.91 The method has a low detection rate of 0.1 CFU / μL and no cross-reaction with other pathogens. It has high specificity and a short completion time. When applied to the detection of clinical samples, the method has accurate and consistent detection results compared with PCR. The overlap rate with the culture-biochemical method is 97.78%, and the kappa index value is 0.938. In addition, this method is fast, accurate, and less dependent on equipment and trained personnel. It can provide information for the timely formulation of reasonable antimicrobial treatment plans and has great clinical application potential, especially in resource-limited areas. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the principle of the RPA-LFD method of the present invention.

[0020] (A) RPA amplification principle; (B) Schematic diagram of the working principle of the lateral flowmeter;

[0021] Figure 2 Primers were screened for RPA amplification performance in the present invention; the agarose gel image shows the amplification results of 5 pairs of primers designed for the SesB gene; the name of the primer pair is shown at the top of each lane; the NTC bar immediately following it is the no-template control for each primer.

[0022] Figure 3 The performance of the primer-probe set tested by RPA-LFS reaction of the present invention;

[0023] (A) LFS assay results showing RPA amplification products before mismatching; (B) LFS assay results showing RPA amplification products after mismatching; (C) Agarose gel results; the name of each primer-probe combination is indicated above the corresponding band; the NTC band is the no-template control for RPA; the positions of the test and control lines are marked on the right side of the bars; the reaction was performed at 37°C for 30 min. This image represents the results of three independent experiments.

[0024] Figure 4 Optimization of the RPA-LFS reaction conditions of the present invention;

[0025] (A) Optimal reaction temperature for RPA-LFS assay; (B) Optimal reaction time for RPA-LFS assay;

[0026] Figure 5 The specificity of the RPA-LFS detection system of the present invention is shown. 1 μL of boiled bacterial culture was used as a template. 18 common pathogens (A) and 15 clinical isolates of Staphylococcus epidermidis (B) were tested. The species name is shown at the top of each bar.

[0027] Figure 6 is the minimum detection limit of the RPA-LFS method of the present invention;

[0028] (A) Shows the LFS results of RPA-amplified Staphylococcus epidermidis at different concentrations (in CFU); (B) Probit regression analysis of the results of 10 independent tests at each concentration using SPSS software; (C) Anti-interference ability of the RPA-LFS method; in addition to S. epidermidis DNA, human genomic DNA was also added. DETAILED DESCRIPTION

[0029] The preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the protection scope of the present invention.

[0030] Example:

[0031] Standard strains and clinical isolates:

[0032] A rapid RPA-LFS assay was established for Staphylococcus epidermidis. Fifteen clinical isolates of S. epidermidis were collected from sputum and urine specimens of the lower respiratory tract. In addition, 18 other common pathogens, including Staphylococcus aureus, hemolytic Staphylococcus, coagulase-negative Staphylococci, Escherichia coli, Acinetobacter baumannii, Haemophilus influenzae, Pseudomonas aeruginosa, Klebsiella pneumoniae, Enterococcus faecalis, Enterococcus faecium, Burkholderia cepacia, Serratia marcescens, Candida albicans, Vibrio parahaemolyticus, Stenotrophomonas maltophilia, Proteus mirabilis, Candida albicans, and Streptococcus lactis, were collected for analysis of detection specificity. All strains were identified in the laboratory of Lianyungang Second People's Hospital using a reference culture-biochemical method. Table 1 lists the bacterial strains used in the study.

[0033] To explore the applicability of the RPA-LFS detection method for Staphylococcus epidermidis in clinical specimens, 90 specimens were collected from the Microbiology Laboratory of Lianyungang Second People's Hospital, including 50 respiratory tract sputum samples and 40 urine samples.

[0034] Extraction of bacterial genomes:

[0035] For reactions using purified genomic DNA as a template, genomic DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen Technology Co., Ltd., Beijing, China) and stored at −20°C until use. If bacterial culture was used as a template, bacterial DNA was extracted using the boiling method; each colony was suspended in 50 μL of Tris-EDTA buffer and boiled for 10 minutes to completely release the bacterial genomic DNA.

[0036] Primer design for RPA reaction:

[0037] Staphylococcus epidermidis SesB The gene was the specific target of the detection system. Primers were designed using NCBI's online design software with the following parameters: size set to 30-35 bp, product size set to 100-500 bp, Tm value set to 50-100, GC content set to 20%-80%, and the organism set to Staphylococcus epidermidis. Five primer pairs were selected for detection (General Co., Ltd., Anhui, China).

[0038] Design of probes for RPA-LFS reaction:

[0039] Using a probe in the RPA reaction can improve amplification specificity and reduce false positives caused by primer dimers. The probe is labeled with FITC at the 5' end, has a C3 spacer (SpC3) at the 3' end to prevent chain extension, and a tetrahydrofuran (THF) group in the middle (position 31) to promote NFO cleavage. NFO cleavage occurs only when the bases on either side of the THF site successfully pair with the template, releasing the SpC3 blockage at the 3' end. Probes were designed using Primer Premier 5 software. The probe size was set to no less than 46 bp; the melting temperature (Tm) was set between 50 and 100°C; the GC content was set to a minimum of 20 to 70; the maximum hairpin score and primer-dimer score were both set to 9; the maximum PolyX score was set to 5; and all other parameters were set to default values.

[0040] RPA-LFS Program:

[0041] RPA-LFS reactions were performed using the TwistAmp® DNA Amplification Kit. A total of 50 μL of reaction mixture was added to a lyophilized tube containing the enzyme components: 29.5 μL of rehydration buffer, 12.2 μL of ddH2O, 2.1 μL of upstream primer (10 μM), 2.1 μL of downstream primer (10 μM), and 0.6 μL of probe. To ensure simultaneous initiation of all reactions, 1 μL of template and 2.5 μL of 280 mM magnesium acetate were added to the cap of the tube. The reaction was centrifuged briefly and immediately incubated in a 37°C thermostat for 30 minutes. The amplified product was then placed on ice for 2–5 minutes. LFS (Ustar Biotechnologies Ltd., Hangzhou, China) specifically recognizes FITC- and biotin-labeled RPA products generated by the probe and reverse primer. Five microliters of amplified product was added to 100 μL of sample buffer, and an LFS rod was inserted into the tube for 3 minutes before visual inspection. Two red lines were observed for a positive reaction, including a control line (upper) and a test line (lower), but only the control line was observed for a negative reaction and a blank control reaction.

[0042] Optimization of RPA-LFS reaction conditions:

[0043] The RPA-LFS reaction was performed with the optimal primer and probe combination screened. The reaction system was incubated at 20 to 52°C for 30 min to screen the optimal RPA-LFS reaction temperature. The reaction system was incubated at the optimal temperature screened for 5 to 30 min to screen the optimal RPA-LFS reaction time. At the same time, a group of NTC controls were set up.

[0044] Limit of Detection (LOD) Assay:

[0045] Ten-fold serial dilutions of the Staphylococcus epidermidis genome ranging from 8×105 CFU / μL to 8×10-1 CFU / μL were prepared for RPA-LFS reaction; the limit of detection (LOD) of this method was determined by probabilistic regression analysis of 10 independent experiments.

[0046] Examination of clinical specimens:

[0047] The practical application value of RPA-LFS in clinical specimen detection was evaluated by comparing it with PCR and culture methods. Clinical samples were cultured on blood agar at 37°C for 18-48 hours. Identification was performed using the VITEK 2 fully automated microbial analysis system. PCR is also based on SesBThe consistency of the RPA-LFS method with the other two methods was calculated using the formula: The kappa index was used to evaluate the consistency of this method with the other methods.

[0048] Here are the results:

[0049] Design and screening of RPA primers:

[0050] Design specific primers from SesB The primers only matched Staphylococcus epidermidis. Using the Staphylococcus epidermidis genome as a template, the five designed primer pairs were subjected to basic RPA reaction, and the products were detected by agarose gel electrophoresis. All five primer sets produced target bands consistent with the expectations, with sizes of 351, 267, 271, 255, and 365 bp, respectively. However, primer dimers smaller than 100 bp appeared in the no-template control (NTC). Figure 2 In contrast, primers SesB-2 and SesB-4 produced brighter target bands and fewer primer dimers. Therefore, we selected SesB-1 and SesB-2 for probe design in subsequent reactions.

[0051] Table 1: Primer and probe sequences used in the RPA-LFS reaction.

[0052]

[0053] ∗Sequences modified with base substitutions. Modified bases are inred. F and R represent forward and reverse primers, respectively. P, probe.

[0054] Improvement and determination of the optimal primer-probe combination in the RPA-LFS system;

[0055] Using probes in RPA reactions can increase amplification specificity and reduce primer-dependent artifacts. Probes P1 and P2 were designed within the sequences of SesB-1 and SesB-2, and RPA–LFS tests were performed to examine the amplification performance and false positive rates of the primer-probe combinations SesB-1 / F / R / P1 and SesB-2 / F / R / P2. The results are shown in Figure 2. Figure 3As shown in Figure A, both primer-probe combinations provide correct positive signals (two visible red bands on both the test and control lines), indicating good amplification performance. However, in the no-template control, they also show a single, faint red band on the test line, indicating false-positive signals for both primer-probe combinations.

[0056] RPA can tolerate some base mismatches between primers / probes and templates, which can provide some flexibility in primer / probe design and screening. LFS can specifically recognize FITC and biotin-labeled RPA products produced by probes and reverse primers. Analysis using Primer Premier 5 software revealed that the probe and reverse primer had multiple consecutive matching bases, which may lead to false positive signals. Therefore, base substitutions were introduced to eliminate false positive signals.

[0057] The replacement principle is: (1) break the site with more than five consecutive matches or more than three consecutive matches at the 3' end. (2) The three bases near the 3' end cannot be replaced; (3) the number of replaced bases should not exceed 5, otherwise it may affect the sensitivity of the detection; (4) there should not be two consecutive base replacements; (5) AG replacement and TC replacement are preferred. The modified reverse primer (mR) and probe (mP) sequences are listed in Table 2, and the replaced bases are indicated in red. The improved primer-probe combination was used for detection, and the false positive signal in the NTC of the combination SesB-1 / F / R / P1 was eliminated. At the same time, the color depth of the detection line was consistent before and after the modification, that is, the base replacement did not affect the amplification efficiency ( Figure 3 B). However, a weak false positive signal was still observed on the NTC of the SesB-2 / F / R / P2 combination. Analysis of the RPA amplification products by agarose gel electrophoresis showed that the RPA amplification products had two distinct bands, representing the products of the forward-reverse primer and the probe-reverse primer, respectively ( Figure 3 C). Overall, the best primer-probe combination was SesB-1 / F / R / P1 for RPA-LFS detection of Staphylococcus epidermidis.

[0058] Optimization of RPA-LFS reaction conditions:

[0059] The RPA reaction conditions were optimized in terms of reaction temperature and reaction time. The RPA reaction system was amplified at different temperatures ranging from 20 to 52°C. At reaction temperatures of 20 and 25°C, the color of the detection line was relatively weak, and the color of the detection line deepened with increasing temperature. The reaction temperature ranged from 30 to 42°C, with a relatively clear color development, and the best color was achieved at 37°C. Figure 4A); at 37°C, the reaction time was set to 5 to 30 minutes. The results showed that the detection line had a weak band at 5 to 20 minutes, and the detection line showed clear and bright color at 25 and 30 minutes, with no obvious change ( Figure 4 B). Therefore, the optimal reaction temperature and time for the RPA–LFS method are 37°C for 25 min.

[0060] Specificity analysis of RPA-LFS detection:

[0061] During the design of the primer set, the parameters were limited to S. epidermidis. However, to evaluate the specificity and inclusiveness of the optimal primer-probe combination SesB-1 / F / R / P1 for RPA-LFS detection of S. epidermidis, a total of 18 common respiratory pathogens and 15 clinical isolates of S. epidermidis were used. Figure 5 As shown, when genomic DNA from Staphylococcus epidermidis was used as a template, a clear positive signal appeared on the test line. However, when genomic DNA from other respiratory bacterial pathogens was used as a template, no bands appeared on the test line. Furthermore, all 15 clinical isolates of Staphylococcus epidermidis showed positive signals in the RPA-LFS assay. These results demonstrate that the established RPA-LFS detection system has good specificity for Staphylococcus epidermidis and has no cross-reactivity with other pathogens.

[0062] Detection limit of RPA-LFD method for Staphylococcus epidermidis:

[0063] To evaluate the detection limit of the RPA-LFS method, 10-fold dilutions of Staphylococcus epidermidis were prepared with concentrations ranging from 8 × 105 to 8 × 10-1 CFU / μL (1 μL, 50 μL reaction volume). A strong positive signal appeared on the test line of the 8 × 105 CFU / μL group. As the template concentration decreased, the density of the positive band decreased, and the positive signal completely disappeared in the 8 × 10-1 CFU / μL group. Figure 6 A). In addition, to further determine the accurate LOD of the RPA-LFS assay, 10 independent tests were performed for all concentrations. The results showed that at 8×10⁻¹, 9 were positive, and at 8×10⁻¹, 2 were positive. Probit regression analysis was performed on the results of the 10 tests using SPSS software. At a 95% probability, the LOD for each RPA-LFS reaction was 8.91 CFU / μL ( Figure 6 B) To test whether the system is resistant to interference from genomes of other species, 10 ng of human genomic DNA was added to the RPA reaction in addition to Staphylococcus epidermidis. Detection sensitivity was not affected by human DNA ( Figure 6 C).

[0064] Application of RPA-LFS in clinical specimen testing:

[0065] The clinical application value of the RPA-LFS method was evaluated by comparison with PCR and culture methods. Ninety clinical specimens collected from patients were tested. The results showed that 22 of the 90 specimens tested positive for Staphylococcus epidermidis by both RPA-LFS and PCR, while only 20 were positive by culture. The established RPA-LFS method achieved 100% concordance with PCR and 97.78% with traditional culture-biochemical methods, with a calculated kappa index of 0.938. These results demonstrate the feasibility and reliability of the highly specific and sensitive RPA-LFS method for Staphylococcus epidermidis in clinical samples from patients.

[0066] Table 2: Detection performance of RPA-LFS method, PCR and culture-biochemical method.

[0067]

[0068] Currently, a variety of methods are available for the detection of Staphylococcus epidermidis. For example, bacterial isolation and identification techniques are the "gold standard" for microbial identification, but they are cumbersome, time-consuming, and labor-intensive, making them impractical for large-scale clinical field testing. PCR technology is rapid, accurate, and highly sensitive, but it requires complex reaction equipment and is time-consuming, making it unsuitable for on-site detection of pathogenic microorganisms. RPA technology is a rapid, sensitive, efficient, and effective visual nucleic acid amplification method that eliminates the need for complex reaction equipment or instruments and allows for direct visual evaluation of test results, making it suitable for rapid on-site detection of Staphylococcus epidermidis. Currently, RPA-LFS has been successfully used for molecular diagnosis of diseases caused by pathogens such as methicillin-resistant Staphylococcus aureus, Klebsiella pneumoniae, Mycobacterium tuberculosis, and Candida albicans. However, for Staphylococcus epidermidis, a significant clinical pathogen, RPA-based detection methods have yet to be established.

[0069] In RPA-LFS detection, the determination of target genes and primer design are key steps in the reaction. Staphylococcus epidermidis surface protein (Ses) is an important pathogenic factor that can promote the binding of bacteria to host cells, and SesB is one of the genes encoding Ses protein in the genome of Staphylococcus epidermidis. Therefore, the present invention uses Staphylococcus epidermidis as the target gene. SesBThe gene (Genbank: EF424054.1) is the target gene. In a complex RPA reaction, slight changes in the position and length of the primer probe may affect the amplification results. Therefore, the present invention initially designed 5 pairs of primers for basic RPA reactions. Amplification performance, primer dimer formation and false positive signals were taken into consideration during screening. In contrast, 2 pairs of primers were selected for subsequent probe design, but they also produced false positive signals on LFS without a DNA template; since the RPA reaction can tolerate some base mismatches between the template and the primer or probe, the false positive signal was eliminated by introducing base substitutions in the probe and reverse primer; once the primer probe combination was established, the RPA-LFS method showed good performance in detecting Staphylococcus epidermidis.

[0070] To determine the accurate detection limit of RPA-LFS for S. epidermidis, we tested different concentrations of S. epidermidis genomic DNA, ranging from 105 CFU / μL to 10-1 CFU / μL. Probit regression analysis demonstrated that the detection limit of RPA-LFS for S. epidermidis was 8.91 CFU / μL at a 95% probability. This is comparable to the detection limits of other highly sensitive molecular detection methods, including simple PCR (10-100 CFU / mL), multiplex PCR (104 CFU / mL), multiplex qPCR (103 CFU / mL), the Epidome method (10 copies / μL), and loop-mediated isothermal amplification (20 CFU / μL).

[0071] The present invention combines RPA technology with lateral flow chromatography test strips to detect Staphylococcus epidermidis, and retains the excellent characteristics of rapidity, high sensitivity, and visualization. When applied to clinical strain detection, the sample is not purified, and the DNA is released by simple heating and boiling, and is directly used for detection. Compared with the traditional PCR method, the detection consistency rate of the two methods is 100%, and the consistency rate with the traditional culture method is 97.78%. In short, based on the combination of visual RPA and LFS technology, SesB Using the gene as the target, a rapid, specific and sensitive on-site detection method for Staphylococcus epidermidis has been established, providing a basis for the rational use of antibiotics in clinical practice, especially individualized anti-infection treatment.

[0072] Recombinase polymerase amplification (RPA), an isothermal nucleic acid amplification technique, has been increasingly used in disease detection in recent years with the development of experimental technology, and has very broad application prospects. However, it also has many problems. First, there is no professional software for designing RPA primers, and multiple pairs of primers should be designed and screened according to primer design principles. Second, it is easy to cause aerosol contamination of the amplification product and produce false positives. The operation should be carried out in a well-ventilated and open environment as much as possible. At the same time, the primer probe should be designed strictly according to the primer probe instructions to avoid hybridization of the primer probe and produce false positive results. To avoid false negative results, the quality of the template nucleic acid and the specificity of the primers and probes should be guaranteed. Third, there is noise. If the negative control is left for too long, a faint detection line may appear on the test strip. The results of this test show that the result can be read within 3 minutes, so it is best to read it as soon as possible.

[0073] The above embodiments merely illustrate several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Use of a primer-probe combination in the preparation of an RPA-LFS detection kit for Staphylococcus epidermidis, characterized in that: Primer probe combinations include SesB-1-F / mR / mP1 primer probe combination; In the SesB-1-F / mR / mP1 primer-probe combination; The sequence of SesB-1-F is: ATAAATCTGGTGCAGGTGTCGGTACTTATAA; The sequence of SesB-1-mR is: Biotin-GGTAAAGTGTAATGTAACCAGCAGTGCGTA; The sequence of mP1 is: FITC-AGGTCAAGTTCAATCTTCTGACTAACCACA[THF] CAAAGTTCATCTGAT-C3-spacer.

Images