Nitrate reductase genes and their application as targets for plant stress resistance regulation

By targeting and downregulating the expression or activity of NR1.2, the nitrogen use efficiency and drought resistance of plants are regulated, solving the problems of low drought resistance and nitrogen use efficiency in plants in existing technologies, and achieving the effects of increasing crop yield and reducing environmental pollution.

CN115627273BActive Publication Date: 2026-05-05CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Filing Date
2021-07-14
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the drought resistance and nitrogen use efficiency of plants, leading to increased food production costs and environmental pollution, and affecting crop yield and quality.

Method used

By targeting and downregulating the expression or activity of NR1.2 in plants, including gene editing, silencing, or inhibiting NR1.2, nitrogen use efficiency and drought tolerance in plants can be regulated, and the aboveground height of plant seedlings can be reduced.

Benefits of technology

It significantly improves plant drought resistance and nitrogen use efficiency, reduces plant height during the seedling stage, enhances plant survival rate and yield in drought conditions, reduces fertilizer use, and lowers the risk of environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003163017520000131
    Figure BDA0003163017520000131
  • Figure BDA0003163017520000151
    Figure BDA0003163017520000151
  • Figure HDA0003163017530000011
    Figure HDA0003163017530000011
Patent Text Reader

Abstract

This invention provides a nitrate reductase gene and its application as a target for regulating plant stress resistance. The invention discloses a novel nitrate reductase gene, named NR1.2, that regulates nitrogen use efficiency in plants. NR1.2 is closely related to drought tolerance in plants; reducing the expression / activity of NR1.2 in plants results in decreased seedling height and increased drought tolerance. Therefore, NR1.2 can be used as a target for regulating drought tolerance in plants, and materials or methods for downregulating NR1.2 can be applied to improve plant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant variety improvement and stress resistance. More specifically, this invention relates to the nitrate reductase gene and its application as a target for plant stress resistance regulation. Background Technology

[0002] With the accelerating pace of urbanization and industrialization worldwide, coupled with continuous population growth, soil erosion, and salinization, the amount of arable land globally is constantly decreasing. Food shortages are a common challenge facing everyone. Utilizing the theoretical methods of molecular genetics to conduct in-depth research on crop variety improvement, enhancing crop adaptability to different environmental stresses, and achieving high and stable crop yields is an important aspect of this field.

[0003] Crops are frequently subjected to environmental stresses such as drought, high salinity, and high temperature during their growth and development, which significantly impact crop yield. How to increase crop yield while simultaneously improving crop resistance to environmental stresses, thus achieving high and stable yields, is a major challenge facing scientists and breeders.

[0004] Rice, a member of the Poaceae family, is one of the world's most important food crops, widely cultivated and providing staple food for half the world's population. However, to achieve wider rice cultivation and improve its planting efficiency, enhancing its environmental adaptability under different conditions is of paramount importance in this field.

[0005] Some grain production data show that despite maintaining high fertilizer inputs, large-scale grain yields have not increased significantly. The declining nutrient use efficiency of plants has led to a gradual increase in fertilizer application, significantly increasing production costs and resulting in a widespread phenomenon of increased yields but not increased income in agricultural production. On the other hand, due to the low nitrogen fertilizer use efficiency of crops, most of the nitrogen fertilizer applied in agricultural production enters the environment, directly causing environmental pollution problems such as eutrophication of water systems, soil acidification, and the accumulation of heavy metals in water resources and soil. To date, many mysteries remain regarding the molecular mechanisms affecting plant nitrogen use efficiency, and many key components involved in plant nitrogen use efficiency still await discovery.

[0006] Under natural conditions, various adverse environments arise due to different geographical locations, climates, and human activities, exceeding the tolerance range for normal plant growth and development, causing damage and even death to plants. These harmful environments are called adversity or stress. Adversity includes, but is not limited to, freezing, low temperatures, high temperatures, drought, salinity, excessive soil moisture, and diseases. Although plants are affected by adversity, they resist it through physiological responses. However, if the damage exceeds the tolerable range and surpasses the plant's own repair capacity, the damage becomes irreversible, and the plant will suffer harm or even die.

[0007] Drought causes physiological and ecological changes such as wilting of leaves and young stems, and reduced or even closed stomatal opening, which greatly affect the normal germination, growth, and maturation of plants. Plant drought tolerance is a complex trait controlled by multiple genes, involving various mechanisms and signaling pathways. The signal transduction processes involved in drought stress are quite complex and often intersect with signaling pathways related to heat resistance, freezing, and oxidative stress.

[0008] Improving the drought tolerance of plants has always been an important topic in this field. There is an urgent need to explore more effective ways to enhance the drought tolerance of plants. Summary of the Invention

[0009] The purpose of this invention is to provide a novel nitrate reductase gene that regulates the nitrogen use efficiency of plants.

[0010] The present invention also aims to provide a nitrate reductase gene and its application as a target for regulating plant stress resistance.

[0011] Another object of the present invention is to provide the potential application of the nitrate reductase gene in enhancing nitrogen use efficiency in plants.

[0012] In a first aspect of the invention, a method for regulating plant traits is provided, comprising: targeting downregulating the expression or activity of NR1.2 in plants, said traits including: enhancing drought tolerance of plants; and / or reducing the aboveground height (plant height) of plant seedlings.

[0013] In a preferred embodiment, reducing the expression or activity of NR1.2 in plants includes: knocking out or silencing the coding gene for NR1.2 in plants, or inhibiting the activity of NR1.2; preferably, knocking out or silencing the coding gene for NR1.2 in plants includes: gene editing using a CRISPR system to knock out the coding gene for NR1.2; knocking out the coding gene for NR1.2 by homologous recombination; silencing NR1.2 by interfering molecules that specifically interfere with the expression of the coding gene for NR1.2; performing a loss-of-function mutation on NR1.2 in plants containing NR1.2; or inhibiting NR1.2 by chemical inhibitors that specifically inhibit signaling pathways involved in NR1.2.

[0014] In another preferred embodiment, the method includes: performing gene editing using the CRISPR method to knock out the coding gene of NR1.2, including: targeting position 511 of the coding sequence of NR1.2 and deleting C; or, inserting at least one base, preferably A, at position 513-514 of the coding sequence of NR1.2, causing a shift in the coding sequence.

[0015] In another preferred embodiment, gene knockout is performed using primers shown in SEQ ID NO:3-6, based on the CRISPR system, targeting the coding gene of NR1.2.

[0016] In another aspect of the invention, the use of an NR1.2 downregulator is provided for regulating plant traits, including: enhancing the drought resistance of plants, or preparing a formulation that enhances the drought resistance of plants.

[0017] In another aspect of the invention, the use of an NR1.2 downregulator is provided for reducing the aboveground height of plant seedlings, or for preparing a formulation that reduces the aboveground height of plant seedlings.

[0018] In another preferred embodiment, the downregulator comprises: a reagent that knocks out or silences the coding gene of NR1.2, or a reagent that inhibits the activity of NR1.2; preferably, the downregulator comprises: a CRISPR gene editing reagent, a homologous recombination reagent, or a site-directed mutagenesis reagent targeting NR1.2, wherein the reagent performs a loss-of-function mutation on NR1.2, a disrupting molecule that specifically interferes with the expression of the coding gene of NR1.2, or a chemical inhibitor that specifically inhibits the signaling pathways involved by NR1.2.

[0019] In another preferred embodiment, the enhancement includes improvement, promotion, etc., which are significant enhancements, improvements, or promotions, such as an increase in drought resistance, an increase or promotion of 5%, 10%, 15%, 20%, 40%, 60%, 80%, 90%, or higher (e.g., an increase in survival rate of 5%, 10%, 15%, 20%, 40%, 60%, 80%, 90%, or higher).

[0020] In another preferred embodiment, the reduced expression includes the deletion of expression.

[0021] In another preferred embodiment, the reduction indicates a significant reduction, such as a reduction of 20%, 40%, 60%, 80%, 90%, or lower.

[0022] In another preferred embodiment, the reduction in the aboveground height of the plant seedlings is a statistically significant reduction, such as a reduction of 5%, 8%, 10%, 12%, 15%, 20%, 40%, 60%, 80%, 90%, or lower.

[0023] In another preferred embodiment, the plant is or the NR1.2 is derived from a grass family; preferably including (but not limited to): rice (Oryza sativa), maize (Zea mays), millet (Setaria italica), wheat (Triticumaestivum), sorghum (Panicum miliaceum), barley (Hordeum vulgare), oats (Avena sativa L.), sorghum (Sorghum bicolor), brachypodium distachyum, and rye (Secalecereale).

[0024] In another preferred embodiment, the reduction of the aboveground height (plant height) during the seedling stage refers to reducing the aboveground height of the seedling stage under low nitrogen conditions.

[0025] In another preferred embodiment, by downregulating the activity of NR1.2 in plants, the plants enhance their resistance to drought by reducing nitrogen use efficiency during the seedling stage.

[0026] In another preferred embodiment, the drought / drought includes (but is not limited to) drought / drought caused by the following conditions: drought caused by insufficient soil moisture, drought caused by plant transpiration exceeding root absorption, drought caused by lack of oxygen in the soil, and drought caused by saline-alkali soil environment.

[0027] In another preferred embodiment, the amino acid sequence of the polypeptide of NR1.2 is selected from the group consisting of: (i) a polypeptide having the amino acid sequence shown in SEQ ID NO:2; (ii) a polypeptide derived from (i) having the regulatory trait function formed by substituting, deleting, or adding one or more (e.g., 1-20, 1-15, 1-10, 1-5, 1-3, or 1-2) amino acid residues of the amino acid sequence shown in SEQ ID NO:2; (iii) a polypeptide having the regulatory trait function with an amino acid sequence homology ≥85% (preferably ≥90%, ≥95%, ≥98%, or ≥99%) to the amino acid sequence shown in SEQ ID NO:2; (iv) an active fragment of a polypeptide having the amino acid sequence shown in SEQ ID NO:2; or (v) a polypeptide formed by adding a tag sequence or restriction enzyme site sequence to the N or C end of the polypeptide having the amino acid sequence shown in SEQ ID NO:2, or by adding a signal peptide sequence to its N end.

[0028] In another aspect of the invention, a downregulator of NR1.2 for enhancing plant drought resistance is provided, which is a CRISPR gene editing reagent; preferably, C is deleted at position 511 of the coding sequence of NR1.2; or, at least one base, preferably A, is inserted at position 513-514 of the coding sequence of NR1.2 to cause a shift in the coding sequence.

[0029] In another preferred embodiment, the CRISPR gene editing reagent may be an sgRNA construct.

[0030] In another aspect of the invention, a plant cell, tissue, or organ is provided, wherein the exogenous downregulator is contained.

[0031] In a preferred embodiment, the plant cells, tissues, or organs are not capable of reproduction.

[0032] In another aspect of the invention, an application of NR1.2 or the gene encoding it is provided for use as a nitrate reductase; preferably, the nitrate reductase is an NADH-dependent nitrate reductase.

[0033] In another aspect of the invention, an application of NR1.2 or the gene encoding it is provided for promoting the absorption and utilization of nitrates in plants, or for preparing a formulation that promotes the absorption and utilization of nitrates in plants.

[0034] In another aspect of the invention, an application of NR1.2 or the gene encoding it is provided for improving nitrogen use efficiency in plants, or for preparing a formulation that improves nitrogen use efficiency in plants; preferably, the plant is a grass.

[0035] In another aspect of the invention, a method is provided to promote the absorption and utilization of nitrates by plants or to improve the nitrogen use efficiency of plants, comprising increasing the expression or activity of NR1.2 in plants; preferably, comprising transferring the encoding gene of NR1.2 or an expression construct or vector containing the encoding gene into plants; performing a gain-of-function mutation on NR1.2; promoting NR1.2 expression by expressing an enhancing promoter or a tissue-specific promoter; or, promoting NR1.2 expression by an enhancer; preferably, the plant is a grass.

[0036] In another aspect of the invention, an application of NR1.2 as a screening marker is provided, including its use as a molecular marker for specifically screening plants with drought resistance, or as a molecular marker for identifying the drought resistance of plants.

[0037] In another aspect of the present invention, a method for specifically selecting or identifying plants is provided, comprising: identifying the expression or sequence characteristics or activity of NR1.2 in a test plant; if the test plant has high expression or high activity of NR1.2, it is a plant with high nitrate uptake and utilization or high nitrogen use efficiency; if the test plant has low expression or no expression, low activity or no activity of NR1.2, it is a plant with high drought resistance.

[0038] In another preferred embodiment, the high expression or high activity refers to a statistically significant increase in expression or activity compared to the average expression or activity of similar or identical plants, such as an increase of 10%, 20%, 40%, 60%, 80%, 90%, or higher.

[0039] In another preferred embodiment, the low expression or low activity refers to a statistically significant reduction in expression or activity compared to the average expression or activity of similar or identical plants, such as a reduction of 10%, 20%, 40%, 60%, 80%, 90%, or lower.

[0040] In another preferred embodiment, the high drought tolerance refers to a statistically significant increase in drought tolerance compared to that of similar or identical plants, such as an increase in survival rate of 5%, 10%, 20%, 40%, 60%, 80%, 90%, or higher.

[0041] In another aspect of the present invention, a method is provided for screening substances (including potential substances) that enhance plant drought resistance, comprising: (1) adding a candidate substance to a system expressing NR1.2; and (2) detecting the system and observing the expression or activity of NR1.2 therein, wherein if its expression or activity is reduced (significantly reduced, such as by 10%, 20%, 40%, 60%, 80%, 90% or lower), then the candidate substance is indicated to be a substance that can be used to enhance plant drought resistance.

[0042] In another preferred embodiment, the method further includes setting up a control group in which the candidate substance is not added, thereby clearly distinguishing the difference in NR1.2 expression or activity between the test group and the control group.

[0043] In another preferred embodiment, the candidate substances include (but are not limited to): regulatory molecules designed for NR1.2 or its encoding gene or its upstream or downstream proteins or genes (such as upregulators, downregulators, small molecule compound gene editing constructs, etc.).

[0044] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0045] Figure 1Genotyping of transgenic knockout materials of rice NR1.2.

[0046] Figure 2 The transgenic knockout materials osnr1.2-19 and osnr1.2-29 of ZH11 and NR1.2, and their tolerance to the toxic nitrate analogue Chlorate.

[0047] Figure 3 Comparison of growth between transgenic OsNR1.2 knockout plants and wild-type plants under normal nitrogen / low nitrogen conditions.

[0048] Figure 4 Results of nitrate reductase activity determination in osnr1.2-19 and osnr1.2-29 transgenic knockout materials of ZH11 and NR1.2.

[0049] Figure 5 OsNR1.2 protein was expressed and purified in vitro, and the NR1.2 protein was identified as an NADH-dependent nitrate reductase rather than an NADPH-dependent nitrate reductase.

[0050] Figure 6 Comparison of drought resistance phenotypes of wild-type ZH11 and transgenic knockout materials osnr1.2-19 and osnr1.2-29 under PEG 4000 simulated drought conditions.

[0051] Figure 7 Comparison of drought resistance phenotypes of wild-type ZH11 and transgenic knockout materials osnr1.2-19 and osnr1.2-29 under arid soil conditions. Detailed Implementation

[0052] This invention discloses a novel nitrate reductase gene, named NR1.2, that regulates nitrogen use efficiency in plants, and the protein it encodes is also named NR1.2. The inventors unexpectedly discovered that NR1.2 is closely related to drought tolerance in plants; reducing the expression / activity of NR1.2 in plants leads to a decrease in seedling height and thus enhanced drought tolerance. Therefore, NR1.2 can be used as a target for regulating drought tolerance in plants, and materials or methods for downregulating NR1.2 can be applied to improve plant varieties.

[0053] As used in this article, the terms "drought resistance" and "drought tolerance" are used interchangeably.

[0054] As used herein, "plant" refers to a plant whose genome contains NR1.2 or its homologs (homologous genes / homologous polypeptides (proteins)) of the present invention. The plant may include monocotyledonous or polycotyledonous plants, such as: grasses, cruciferous plants, legumes, etc. Preferably, grasses are included. In some preferred embodiments, the plant is a crop, preferably a cereal crop. Preferably, the grasses include rice (Oryza sativa), wheat (Triticum aestivum), and maize (Zea mays). Examples include: rice, sorghum, maize, barley, wheat, oats, and rye. Those skilled in the art will understand that the plants applicable to the technical solutions of the present invention are not limited to those listed above, and suitable plants can be determined by identifying the presence of NR1.2 homologs.

[0055] As used in this article, the “seedling stage” refers to the growth stage of a plant after the germination stage and before the maturity stage. For example, for rice, the seedling stage usually takes about 35 days from the germination of rice seeds to before transplanting. Ten days after transplanting, the rice enters the tillering stage.

[0056] As used herein and as will be understood by those skilled in the art, selecting an appropriate “control plant” is a routine part of experimental design and may include a corresponding wild-type plant or a transgenic plant without the target gene. Control plants are generally the same plant species or even varieties of the same or the same class as the plant being evaluated. Control plants may also be individuals from which the transgenic plant has been lost due to segregation. As used herein, control plants refer not only to whole plants but also to plant parts, including seeds and seed portions.

[0057] As used herein, the term "above-ground part" also refers to a portion of a plant tissue that lies above the ground or the surface of the culture medium when the plant is planted in soil or cultured in a nutrient solution. In this invention, the height of the "above-ground part" has the same meaning as the plant height.

[0058] As used in this invention, the “downregulator” of NR1.2 or its encoding gene can be a protein-level regulatory agent / preparation or a gene-level regulatory agent / preparation, including inhibitors, antagonists, blockers, blocking agents, etc., which can be used interchangeably.

[0059] In this invention, the genetic composition of plants is altered to enhance their tolerance to stress conditions. The method / use disclosed in this invention aims to improve plant stress tolerance by regulating nitrate reductase or its encoding gene.

[0060] The function of the NR1.2 gene has not been analyzed and studied by those skilled in the art. The inventors have discovered for the first time that the NR1.2 gene plays a role in plant drought resistance.

[0061] In this invention, “OsNR1.2” derived from rice comprises a gene having the sequence shown in LOC_Os08g36500 and the polypeptide it encodes. Regarding the amino acid sequence, those skilled in the art will understand that individual substitutions, deletions, or additions made to the polypeptide or protein sequence that alter, add to, or delete individual amino acids or a small subset of amino acids in the encoded sequence, resulting in the substitution of an amino acid with a chemically similar amino acid, are “conservatively modified variants.” Thus, any number of amino acid residues selected from integers from 1 to 30 can also be changed. For example, 1, 2, 3, 4, 5, 7, 10, 15, 20, or 25 changes can be made. Conservatively modified variants generally provide biological activity similar to that of the unmodified polypeptide sequence from which they are derived. For example, the enzyme activity is typically at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the native protein relative to its native substrate, preferably 60-90%. Conservative substitution tables providing functionally similar amino acids are well known in the art.

[0062] Any polypeptide / gene that shares high homology (e.g., 70% or higher; preferably 80% or higher; more preferably 90% or higher, such as 95%, 98%, or 99%) with the NR1.2 specifically referenced in this invention and has the same function as NR1.2 is also included in this invention. In this invention, NR1.2 also includes its homologs, i.e., polypeptides / genes present in species other than rice that share homology with the sequences described above and have the same function as NR1.2 in this invention, or that play the same or similar roles in the same or similar signaling pathways. Since NR1.2 is conserved in many species, it should be understood that although the NR1.2 gene presented in the embodiments of this invention is preferred, this invention is not limited to the gene specifically listed in the embodiments.

[0063] This invention discovers that NR1.2 plays a role in nitrogen use efficiency in plants, and its deletion can reduce nitrogen use efficiency and plant height during the seedling stage. This invention regulates the expression or activity of NR1.2 to modulate the plant's nitrate reduction capacity, thereby affecting nitrogen use efficiency, and can provide genetic resources and technical support for breeding crops with high nitrogen use efficiency.

[0064] Chlorate, an analogue of nitrate, is absorbed by plants and assimilated into hypochlorite, which has a significant toxic effect on plants. Therefore, chlorate resistance is often used to indicate the efficiency of nitrate uptake or reduction in plants. The inventors found that treatment with chlorate in loss-of-function mutants and wild-type plants resulted in stronger tolerance to chlorate toxicity, indicating that the OsNR1.2 gene is involved in the nitrogen utilization pathway in plants. Furthermore, knocking out the OsNR1.2 gene in plants significantly reduces the activity of nitrate reductase. Therefore, the inventors investigated the function of this gene by expressing and purifying the OsNR1.2 protein in vitro, finding that it is an NADH-dependent nitrate reductase rather than an NADPH-dependent one. Field trials showed that, compared to ZH11, OsNR1.2 knockout plants exhibited greater reductions in relative tiller number and yield under low nitrogen conditions.

[0065] Surprisingly, when the OsNR1.2 gene significantly reduced nitrate reductase activity in plants in a targeted manner, this invention observed that its effect was most significant in seedlings, resulting in reduced seedling height and thus enhancing drought resistance, effectively improving the survival rate of seedlings under drought conditions. This effect of downregulating the OsNR1.2 gene on seedlings was particularly significant under low-nitrogen conditions, such as soil nitrogen content reduced to below 20%, 15%, 10%, 5%, 2%, 1%, 0.8%, 0.5%, or lower.

[0066] After reading about the functions of NR1.2 as described in this invention, various methods well-known to those skilled in the art or being developed in the art can be used to regulate the expression or activity of NR1.2, particularly by reducing or eliminating NR1.2 expression. The invention also provides substances (such as biomolecules or biological agents, small chemical molecules or their formulations) for downregulating NR1.2, which exert a function of improving plant traits by downregulating NR1.2.

[0067] As used in this invention, the downregulator of NR1.2 or its encoding gene refers to any substance that can reduce the stability of NR1.2 or its encoding gene, downregulate NR1.2 expression, reduce the activity of NR1.2 protein, reduce the effective duration of NR1.2 protein action, or inhibit the transcription and translation of the NR1.2 gene. These substances can all be used in this invention as substances useful for downregulating NR1.2, thereby enhancing plant drought resistance. For example, the downregulator is: interfering RNA molecules or antisense nucleotides that specifically interfere with NR1.2 gene expression; antibodies or ligands that specifically bind to the protein encoded by the NR1.2 gene; etc. They can be compounds, small chemical molecules, or biomolecules. The biomolecules can be at the nucleic acid level (including DNA and RNA), or at the protein level, or can be designed for combined regulation at both levels.

[0068] As a preferred embodiment of the present invention, targeted gene editing technology is used for NR1.2 gene knockout / knockdown, which can typically be achieved using a CRISPR / Cas (e.g., Cas9) system. Common methods for knocking out / knocking down the NR1.2 gene include co-transferring sgRNA or a nucleic acid capable of forming said sgRNA, Cas9 mRNA or a nucleic acid capable of forming said Cas9 mRNA, to a target region or target cell. After identifying the target gene / target site to be mutated, known methods can be used to introduce sgRNA and Cas9 into the target cell. For example, the nucleic acid capable of forming said sgRNA may be a nucleic acid construct or expression vector, or the nucleic acid capable of forming said Cas9 mRNA may be a nucleic acid construct or expression vector. These expression vectors are introduced into the target cell, thereby forming active sgRNA and Cas9 mRNA within the cell. The embodiments of the present invention provide preferred targeted gene editing reagents that can appropriately and efficiently target mutations in NR1.2 to achieve appropriate and effective downregulation (e.g., downregulation of 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 80-90%, or 90-100%).

[0069] As an optional approach of this invention, homologous recombination can be used to specifically target NR1.2, resulting in NR1.2 gene knockout / knockdown. Alternatively, Cre and Loxp methods can be applied to selectively knock out, reduce, or inactivate related genes in the genome of animals or cells.

[0070] As an alternative, the downregulator can be an NR1.2-specific interfering RNA molecule (such as shRNA, siRNA, miRNA, etc.), which can be prepared using the NR1.2 sequence information provided in this invention. Methods for preparing the interfering RNA molecule can be, but are not limited to, in vitro transcription, artificial synthesis, etc. The interfering RNA can be delivered into cells using appropriate transfection reagents. RNAi is used to inhibit NR1.2. RNAi is an evolutionarily conserved cellular defense mechanism used to control the expression of exogenous genes in most eukaryotes, including humans. RNAi is typically triggered by double-stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of single-stranded target RNA. The mediator of mRNA degradation is small interfering RNA duplexes (siRNAs), usually produced by enzymatic cleavage of long dsRNA within the cell. siRNAs are typically about 21 nucleotides long (e.g., 21-23 nucleotides). After the interfering RNA is introduced into the cell, the sequence is delivered to an enzyme complex called the RISC (RNA-induced silencing complex). The RISC recognizes the target and cleaves it with a nuclease. If a large RNA sequence is delivered to a cell, the RNase III enzyme (Dicer) converts the longer dsRNA into 21-23 nt ds-siRNA fragments. Alternatively, shRNA technology can be used for interference. shRNA is an RNA sequence that can rotate a tight hairpin, which can be used to silence gene expression via RNA interference. shRNA uses a vector to introduce it into the cell and utilizes a promoter to ensure that the shRNA is always expressed. This vector is usually delivered to daughter cells, allowing gene silencing to be inherited. The shRNA hairpin structure is cleaved into siRNA by cellular mechanisms and then binds to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the bound siRNA. shRNA is transcribed by RNA polymerase III.

[0071] As another alternative implementation, NR1.2 expression is modulated using antisense compounds that specifically hybridize with one or more nucleic acids encoding NR1.2. The specific hybridization of oligomers with their target nucleic acids interferes with the normal function of the nucleic acids. This modulation of target nucleic acid function by compounds that specifically hybridize with the target nucleic acid is commonly referred to as "antisense".

[0072] As an alternative approach, the downregulator is a small molecule compound targeting NR1.2. Screening for such small molecule compounds can be performed using methods suitable for small molecule compounds. This screening can rely on various existing or future compound libraries in the art, or new compound libraries can be established independently.

[0073] In a preferred embodiment of the present invention, a CRISPR-CAS9 knockout expression vector is constructed using genetic engineering technology and transformed into wild-type plant callus tissue via Agrobacterium-mediated transformation, resulting in the absence of NR1.2 expression in the wild-type. The deletion mutant plants exhibit low nitrogen sensitivity. To facilitate the identification and screening of transgenic plant cells or plants, the transformation vector contains antibiotic resistance markers (kanamycin, hygromycin). The CRISPR-CAS9 knockout vector carrying the OsNR1.2 gene of the present invention can be transformed into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, and Agrobacterium-mediated flower immersion, and the transformed plants can then be cultured into plants.

[0074] This invention also provides expression vectors containing any of the above-mentioned biomolecules with downregulation activity, preferably plant expression vectors; more preferably expression vectors suitable for subsequent transgenic operations (such as transgenic operations using Agrobacterium). Expression vectors can be constructed using methods known in the art, and generally contain a promoter and a target gene sequence. Expression vectors also include ribosome binding sites for translation initiation, transcription terminators, etc.

[0075] This invention also provides genetically engineered host cells containing gene-editing molecules (such as CRISPR / Cas editing reagents), interference molecules, or silencing sequences, or containing vectors containing interference molecules or silencing sequences. The host cells are typically plant cells. Transformed plants can generally be achieved using methods such as Agrobacterium-mediated transformation or gene gun transformation, for example, leaf disc transformation or embryo transformation.

[0076] In previous studies in this field, the function of the NR1.2 gene had not been analyzed. The inventors of this invention are the first to discover that the NR1.2 gene plays a role in plant drought tolerance. Based on this discovery, this invention also relates to the application of NR1.2 as a molecular marker, which can serve as a tracking marker for the progeny of gene-transformed plants. This invention also includes a method for early determination of plant drought tolerance by detecting the expression or activity of NR1.2 in plants.

[0077] The method for specifically identifying the drought resistance of plants according to the present invention includes: identifying NR1.2 in the test plant; if the test plant expresses NR1.2 at low levels or not at all, it is a drought-resistant plant. Simultaneously, this plant has a shorter above-ground height during the seedling stage than conventional wild-type plants; this difference in plant morphology can also serve as an auxiliary means for the identification method described in this invention. Furthermore, various techniques known or under development in the art can be used for nucleic acid sequence analysis or protein analysis.

[0078] The ability to identify a plant's drought resistance early in the planting process or even before planting can facilitate plant breeding. For example, identification can be conducted at the seed stage to determine the quality of seeds and make appropriate selections based on the identification results.

[0079] Having learned about the function and molecular mechanism of NR1.2, targeted screening of plants can be conducted based on this understanding. This new discovery can also be used to screen for potential substances that regulate plant drought tolerance by modulating NR1.2.

[0080] The present invention provides a method for screening potential substances to improve plant drought resistance, the method comprising: (1) treating an expression system expressing NR1.2 with a candidate substance; and (2) detecting the expression or activity of NR1.2 in the system; if the candidate substance statistically reduces the expression or activity of NR1.2, it indicates that the candidate substance is a potential substance to improve plant drought resistance.

[0081] Methods for screening substances that act on proteins or genes or specific regions thereof as targets are well known to those skilled in the art, and these methods can all be used in this invention. The candidate substances can be selected from: peptides, polymeric peptides, peptide-like substances, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, and nucleic acid sequences, etc. Depending on the type of substance to be screened, those skilled in the art understand how to select an appropriate screening method.

[0082] Through large-scale screening, a class of substances that specifically act on NR1.2 or its signaling pathways or related genes in its upstream and downstream pathways can be obtained.

[0083] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0084] reagents and solutions

[0085] The 1000X Yoshida mother liquors are as follows:

[0086]

[0087] Sequence information

[0088] LOC_Os08g36500(SEQ ID NO:1)

[0089]

[0090] OsNR1.2 protein (SEQ ID NO:2)

[0091] MAASVQPRQFGHLEPGSAPVCGAASSNGAKAYPPANGIPRRADSPVRGCGFPPLVSPPSRKPPSDGSDDEEEEQEDWRELYGSHLQLEVEPSVRDARDEGTADAWIERNPLLIRLTGKHPLNCEAPLARLMHHGFITPAALHFVRNHGAVPRGDWSTWTVEVTGLVKRPMRLTVDELVNGFPAVEVPVTLACSGNRRKEQNMVQQTVGFNFGAAAVSTSVWHGARLRDVLRRCGIMPSKGGALNVCFEGAEDLPGGGGSKYGTSITRQWALDPSRDIMLAYMQNGEPLLPDHGFPVRAIIPGCTGGRMVKWVKRIIVTTAESDNYYHYKDNRVFPSHVDAELANADAWWYKPEYIINELNVNSVITAPGHDEILPINGITTQRGYTMKGYAYSGGGKRITRVEVTLDGGETWLVCVLDLPEKPTKYGKHWCWCFWSVEVEVLDLLGAKEIAVRAWDQSHNTQPEKLIWNLMGMMNNCWFKVKVNVCRPHKGEIGLVFEHPTQPGNQTGGWMARQKHLETAEAAAPGLKRSTSTPFMNTTDGKQFTMSEVRKHSSQDSAWIVVHGHVYDCTAFLKDHPGGADSILINAGTDCTEEFDAIHSDKAKALLDTYRIGELITTGAGYSSDNSVHGASNLSQLAPIREAIKAPAPVALSSPRDKVPCQLVDKKELSRDVRLFRFALPSSDQVLGLPVGKHIFVCASIEGKLCMRAYTPTSMVDEVGHFDLLIKVYFKNEHPKFPDGGLMTQYLDSLPVGAYIDVKGPLGHVEYTGRGEFVINGKPRNARRLAMIAGGSGITPMYQVIQSVLRDQPEDTTEMHLVYANRTEDDILLRDELDRWAAEYPDRLKVWYVIDQVKRPEEGWKYGVGFVTEEVLREHVPEGGDDTLALACGPPPMIKFAVSPNLEKMKYDMANSFIVF*

[0092] Example 1: Establishment of OsNR1.2 CRISPR-CAS9 knockout transgenic mutant plants

[0093] 1. Construction of mutant vectors and identification of homozygous mutants

[0094] (1) Construction of OsNR1.2 knockout mutant vector.

[0095] Primers for designing point mutant vectors:

[0096]

[0097] Four-primer PCR amplification was performed using pCBC-DT1T2 (obtained from the College of Biological Sciences, China Agricultural University) diluted 100-fold as a template. OsNR1.2-DT1-BsF / OsNR1.2-DT2-BsR were used at the normal primer concentration (10 μM); OsNR1.2-DT1-F0 / Os-NR1.2-DT2-R0 were diluted 20-fold. The PCR products were purified and recovered, and an enzyme digestion-ligation system was established to ligate the target fragment into the expression vector pHEE401 (obtained from the College of Biological Sciences, China Agricultural University).

[0098] (2) Transfer the enzyme-linked vector into Agrobacterium for later use.

[0099] (3) Identification of OsNR1.2 mutant: gene amplification primers

[0100] OsNR1.2-CRISPR-F:gccaaagttgaaccccacag (SEQ ID NO:7);

[0101] OsNR1.2-CRISPR-R: aggagggagcaggaggactg (SEQ ID NO:8).

[0102] (4) Extract total DNA from plant leaves and use the DNA as a template to perform two rounds of PCR to verify the homozygosity of the mutant using the designed mutant primers.

[0103] (5) RNA was extracted from the identified homozygous mutants and quantitative real-time PCR was used to identify the expression level of gene OsNR1.2.

[0104] (6) The homozygous mutant was named osnr1.2.

[0105] 2. Molecular identification of transgenic seedlings

[0106] Total RNA was extracted from leaves of different lines of transgenic material, and total cDNA was reverse transcribed and identified by quantitative real-time PCR. The identification process included: extraction of total RNA, synthesis of total cDNA, and quantitative PCR.

[0107] After screening, the inventors obtained plants with significant silencing effects, named osnr1.2-19 and osnr1.2-29 transgenic lines ( Figure 1 ).

[0108] In the osnr1.2-19 transgenic line, 1 bp base was deleted at position 511 of the OsNR1.2 gene (CDS sequence), which is equivalent to deleting 1 C, resulting in a shift mutation in the protein encoded by the gene from that codon.

[0109] In the osnr1.2-29 transgenic line, a 1bp base was inserted after position 513 of the OsNR1.2 gene (CDS sequence), that is, an A was inserted, which caused the protein encoded by the gene to undergo a shift mutation from that codon.

[0110] Example 2: Chlorate tolerance analysis of wild-type and transgenic plants

[0111] Chlorate, an analogue of nitrate, is absorbed by rice and assimilated into hypochlorite, which has a very significant toxic effect on rice. Therefore, chlorate resistance can be used as an indicator of the plant's absorption or reduction efficiency of nitrate.

[0112] In this embodiment, the tolerance of ZH11 and the aforementioned constructed OsNR1.2 CRISPR-CAS9 knockout mutant plants to Chlorate was analyzed.

[0113] The processing method for Chlorate tolerance analysis is as follows:

[0114] (1) After the rice seeds germinate, they are cultured in tap water for 3 days;

[0115] (2) Culture in Yoshida medium for 5-7 days;

[0116] (3) Replace the NH4NO3 in the mother liquor A with 2mM KNO3 and incubate for 2 days;

[0117] (4) Then treat with 2mM sodium chlorate for 1 to 2 days and observe the phenotype at any time.

[0118] Two days after treatment in step (4), the tolerance responses of the ZH11 and NR1.2 transgenic knockout materials osnr1.2-19 and osnr1.2-29 to the nitrate toxic analogue Chlorate were as follows: Figure 2 As shown, wild-type ZH11 seedlings withered and turned yellow after being treated with 2mM sodium chlorate and could not survive; while transgenic OsNR1.2 knockout plants in the seedling stage, although their leaves were lighter in color compared to the untreated group, were still able to survive.

[0119] The transgenic knockout mutant plants are more resistant to chlorate toxicity, indicating that they absorb and utilize less chlorate. This result suggests that they absorb and utilize less nitrate and have lower nitrogen use efficiency.

[0120] Example 3: Seedling height analysis

[0121] Meanwhile, the applicant hydroponically cultured wild-type and transgenic OsNR1.2 knockout plants under normal nitrogen (2mM KNO3) and low nitrogen (0.01mM KNO3) conditions and observed their growth.

[0122] The applicant observed that under normal nitrogen conditions, the growth of transgenic OsNR1.2 knockout plants was similar to that of wild-type plants. However, under low nitrogen conditions, the seedlings of transgenic OsNR1.2 knockout plants showed reduced plant height and decreased above-ground fresh weight, such as... Figure 3 As shown, this significant decrease in plant height helps the plant resist drought.

[0123] Further growth observations revealed that after the transgenic lines reached maturity, their plant height was close to that of the wild type, indicating that transgenic plants exhibited enhanced drought resistance during the seedling stage, a period highly susceptible to drought.

[0124] The results suggest that transgenic lines improve drought resistance by reducing nitrogen use efficiency during the seedling stage.

[0125] Example 4: Determination of nitrate reductase (NR) activity

[0126] After 3 weeks of hydroponic cultivation of rice, the aboveground parts were collected for nitrate reductase assay, which was performed using a nitrate reductase activity assay kit purchased from Shanghai Youxuan Biotechnology Co., Ltd. Each sample was placed in one assay tube and one control tube, along with standard tubes and blank tubes. During sample addition, all components were added in the correct order.

[0127] The results of nitrate reductase activity determination in the ZH11 and NR1.2 transgenic knockout materials osnr1.2-19 and osnr1.2-29 are as follows: Figure 4The results showed that wild-type ZH11 plants had high nitrate reductase activity, while transgenic OsNR1.2 knockout plants showed a significant decrease in nitrate reductase activity.

[0128] Therefore, the protein encoded by OsNR1.2 is a nitrate reductase.

[0129] Example 5: OsNR1.2 is a NADH-dependent nitrate reductase.

[0130] Construction of OsNR1.2 prokaryotic expression vector and transformation in E. coli:

[0131] Based on the cDNA sequence of OsNR1.2, specific primers with the stop codon removed were designed. Using the full-length cDNA as a template, PCR amplification was performed using the high-fidelity enzyme KODplus (TOYOBO). The PCR products were recovered by electrophoresis and cloned into the prokaryotic expression vector pGEX4T-1 via homologous recombination. Positive clones were sequenced to verify their correctness and then stored.

[0132] The obtained recombinant plasmid was transformed into competent Escherichia coli BL21 strain. After protein expression and purification, purified OsNR1.2 protein was obtained. Subsequently, Shanghai Youxuan Biotechnology Co., Ltd. was commissioned to determine the nitrate reductase activity and NADH and NADPH dependence of the purified OsNR1.2 protein.

[0133] The results are as follows Figure 5 The results showed that the purified OsNR1.2 protein expressed in vitro was identified as an NADH-dependent nitrate reductase rather than an NADPH-dependent nitrate reductase.

[0134] Example 6: Drought resistance phenotypes of plants under simulated drought conditions using PEG 4000

[0135] In this embodiment, 20% PEG 4000 was used to simulate a drought environment to determine the drought tolerance of ZH11 and OsNR1.2 CRISPR-CAS9 knockout mutants. The experimental steps are as follows:

[0136] 1) After the rice seeds germinate, they are cultured in tap water for 3 days;

[0137] 2) Culture in Yoshida medium for 3 weeks;

[0138] 3) Treat with 20% PEG 4000 for 20 days, then switch back to Yoshida medium to recover for 10 days, and observe the phenotype at any time.

[0139] The results are as follows Figure 6As shown in the figure, wild-type ZH11 has low drought tolerance, while transgenic OsNR1.2 knockout plants have significantly improved drought tolerance; in particular, the OsNR1.2 knockout transgenic osnr1.2-29 has even more ideal drought tolerance.

[0140] Example 7: Study on plant drought resistance phenotypes under arid soil conditions

[0141] Rice seeds were directly subjected to drought treatment in the soil, and the drought tolerance of ZH11 and OsNR1.2 CRISPR-CAS9 knockout mutants was determined. The experimental procedures are as follows:

[0142] 1) After the rice seeds germinate, they are cultured in tap water for 3 days;

[0143] 2) Plant directly in soil and cultivate normally (with normal watering) for 2 weeks;

[0144] 3) Stop water supply and allow the area to dry for 10 days, observing the phenotype at all times.

[0145] The results are as follows Figure 7 As shown in the figure, the wild-type ZH11 showed low drought tolerance, while the transgenic OsNR1.2 knockout plants showed significantly higher drought tolerance than the wild-type plants.

[0146] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> Nitrate reductase genes and their application as targets for plant stress resistance regulation <130> 209723 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2751 <212> DNA <213> Rice (Oryza sativa L.) <400> 1 atggccgctt ccgtgcagcc gcggcagttc ggccacctcg agccgggctc cgcgccggtg 60 tgcggcgccg catcctcgaa cggcgccaag gcgtaccctc ccgcgaacgg catcccgcgc 120 cgcgccgact caccggtgcg cgggtgcggc ttccctcccc tcgtctcgcc accttcgcgg 180 aagccgccca gcgatgggtc ggacgacgag gaggaggagc aggaggactg gcgggagctg 240 tacggctcgc acctgcagct ggaggtggaa ccgtcggtgc gcgacgcgcg cgacgagggc 300 accgccgacg cgtggatcga gcgcaacccg ttgctgatcc ggctcaccgg gaaacacccg 360 ctgaactgcg aggcgccgct ggcgaggctc atgcaccacg gcttcatcac cccggctgcg 420 ctgcacttcg tgcgcaacca cggcgcagtg ccgcggggtg actggtcgac gtggaccgtc 480 gaggtgacgg ggctcgtcaa gcgtcccatg cggctcaccg tggacgagct ggtcaacggc 540 ttccccgccg tggaggtccc cgtcacgctg gcctgctcgg ggaaccgccg caaggagcag 600 aacatggtgc agcagactgt ggggttcaac tttggcgccg ccgccgtgtc cacgtcggtg 660 tggcacggcg cccgcctccg cgacgtgctc cggcggtgcg gcatcatgcc cagcaagggc 720 ggtgcgctca acgtgtgctt cgagggcgcc gaggacctcc ccggcggcgg cggctccaag 780 tacggcacca gcatcacacg ccagtgggcg ctggacccgt cgcgggacat catgctcgcc 840 tacatgcaga atggcgagcc gctgctcccc gaccacggct tccccgtccg cgccatcatc 900 cccgggctca ccggcggccg catggtcaag tgggtcaagc gcatcatcgt caccaccgcc 960 gagtccgaca actactacca ttacaaggac aaccgcgtct tcccgtccca tgtcgacgcc 1020 gagctcgcca acgccgatgc gtggtggtac aagccggagt acatcatcaa cgagctgaac 1080 gtgaactcgg tgatcacggc gcccgggcac gacgagatcc tgcccatcaa cggcatcacc 1140 acgcagcgcg gctacaccat gaaggatac gcctactccg gcggcggcaa gaggatcacg 1200 cgggtggagg tgacgctgga cggcggcgag acatggctgg tgtgcgtgct ggacctcccg 1260 gagaagccca ccaagtacgg caagcactgg tgctggtgct tctggtccgt cgaggtcgag 1320 gtgctcgacc tcctcggcgc caaggagatc gccgtgcgcg cctgggacca gtcgcacaac 1380 acccagcccg agaagctcat ctggaatctc atggggatga tgaacaactg ctggttcaag 1440 gtgaaggtga acgtgtgccg gccgcacaag ggtgagatcg ggctggtgtt cgagcacccg 1500 acgcagcccg ggaaccagac cggcgggtgg atggcgaggc agaagcacct ggagacggcg 1560 gaggcggccg caccggggct gaagcggagc acgtcgacgc cgttcatgaa caccaccgac 1620 ggcaagcagt ttaccatgtc cgaggtgcgc aagcactcgt cgcaggactc ggcgtggatc 1680 gtcgtccacg gtcacgtcta cgactgcacg gccttcctca aggaccaccc cggcggcgcc 1740 gacagcatcc tcatcaacgc cggcaccgac tgcaccgagg agttcgacgc catccactcc 1800 gacaaggcca aggcgctcct cgacacctac cgcatcggcg agctcatcac caccggcgcc 1860 gggtacagct ccgacaactc cgtccacggc gcgtccaacc tctcccagct cgcccccatc 1920 cgcgaggcca tcaaggcgcc ggcgcccgtc gcgctctcca gcccgcgcga caaggtcccc 1980 tgccaactcg tcgacaagaa ggagctctcc cgcgacgtcc gcctcttccg cttcgcgctg 2040 ccgtcctccg accaggtgct cggcctcccc gtcggcaagc acatcttcgt gtgcgccagc 2100 atcgaaggga agctgtgcat gcgggcgtac acgccgacga gcatggtcga cgaggtcggc 2160 cacttcgacc tcctcatcaa ggtgtacttc aagaacgagc accccaagtt ccccgatggc 2220 gggctcatga cgcagtacct ggactcgctc cccgtgggcg cctacatcga cgtcaagggg 2280 ccactcggcc acgtcgagta caccggccgc ggcgagttcg tcatcaacgg caagccgcgg 2340 aacgcgcggc ggctggcgat gatcgccggc gggagcggga tcacgcccat gtaccaggtc 2400 atccagtcgg tgctgcgcga ccagccggag gacacgacgg agatgcacct ggtgtacgcg 2460 aaccggacgg aggacgacat cctcctccgc gacgagctcg accggtgggc ggcggagtac 2520 ccggacaggc tcaaggtgtg gtacgtcatc gaccaggtga agcggccgga ggaagggtgg 2580 aagtacggcg tcgggttcgt cacggaggag gtgctgcggg agcacgtgcc ggagggcggc 2640 gacgacacgc tcgcgctcgc ctgcgggccg ccgccgatga tcaagttcgc cgtctcgccg 2700 aacctggaga agatgaagta cgacatggcc aattctttca tcgtgttcta a 2751 <210> 2 <211> 916 <212> PRT <213> Oryza sativa L. <400> 2 Met Ala Ala Ser Val Gln Pro Arg Gln Phe Gly His Leu Glu Pro Gly 1 5 10 15 Ser Ala Pro Val Cys Gly Ala Ala Ser Ser Asn Gly Ala Lys Ala Tyr 20 25 30 Pro Pro Ala Asn Gly Ile Pro Arg Arg Ala Asp Ser Pro Val Arg Gly 35 40 45 Cys Gly Phe Pro Pro Leu Val Ser Pro Pro Ser Arg Lys Pro Pro Ser 50 55 60 Asp Gly Ser Asp Asp Glu Glu Glu Glu Gln Glu Asp Trp Arg Glu Leu 65 70 75 80 Tyr Gly Ser His Leu Gln Leu Glu Val Glu Pro Ser Val Arg Asp Ala 85 90 95 Arg Asp Glu Gly Thr Ala Asp Ala Trp Ile Glu Arg Asn Pro Leu Leu 100 105 110 Ile Arg Leu Thr Gly Lys His Pro Leu Asn Cys Glu Ala Pro Leu Ala 115 120 125 Arg Leu Met His His Gly Phe Ile Thr Pro Ala Ala Leu His Phe Val 130 135 140 Arg Asn His Gly Ala Val Pro Arg Gly Asp Trp Ser Thr Trp Thr Val 145 150 155 160 Glu Val Thr Gly Leu Val Lys Arg Pro Met Arg Leu Thr Val Asp Glu 165 170 175 Leu Val Asn Gly Phe Pro Ala Val Glu Val Pro Val Thr Leu Ala Cys 180 185 190 Ser Gly Asn Arg Arg Lys Glu Gln Asn Met Val Gln Gln Thr Val Gly 195 200 205 Phe Asn Phe Gly Ala Ala Ala Val Ser Thr Ser Val Trp His Gly Ala 210 215 220 Arg Leu Arg Asp Val Leu Arg Arg Cys Gly Ile Met Pro Ser Lys Gly 225 230 235 240 Gly Ala Leu Asn Val Cys Phe Glu Gly Ala Glu Asp Leu Pro Gly Gly 245 250 255 Gly Gly Ser Lys Tyr Gly Thr Ser Ile Thr Arg Gln Trp Ala Leu Asp 260 265 270 Pro Ser Arg Asp Ile Met Leu Ala Tyr Met Gln Asn Gly Glu Pro Leu 275 280 285 Leu Pro Asp His Gly Phe Pro Val Arg Ala Ile Ile Pro Gly Cys Thr 290 295 300 Gly Gly Arg Met Val Lys Trp Val Lys Arg Ile Ile Val Thr Thr Ala 305 310 315 320 Glu Ser Asp Asn Tyr Tyr His Tyr Lys Asp Asn Arg Val Phe Pro Ser 325 330 335 His Val Asp Ala Glu Leu Ala Asn Ala Asp Ala Trp Trp Tyr Lys Pro 340 345 350 Glu Tyr Ile Ile Asn Glu Leu Asn Val Asn Ser Val Ile Thr Ala Pro 355 360 365 Gly His Asp Glu Ile Leu Pro Ile Asn Gly Ile Thr Thr Gln Arg Gly 370 375 380 Tyr Thr Met Lys Gly Tyr Ala Tyr Ser Gly Gly Gly Lys Arg Ile Thr 385 390 395 400 Arg Val Glu Val Thr Leu Asp Gly Gly Glu Thr Trp Leu Val Cys Val 405 410 415 Leu Asp Leu Pro Glu Lys Pro Thr Lys Tyr Gly Lys His Trp Cys Trp 420 425 430 Cys Phe Trp Ser Val Glu Val Glu Val Leu Asp Leu Leu Gly Ala Lys 435 440 445 Glu Ile Ala Val Arg Ala Trp Asp Gln Ser His Asn Thr Gln Pro Glu 450 455 460 Lys Leu Ile Trp Asn Leu Met Gly Met Met Asn Asn Cys Trp Phe Lys 465 470 475 480 Val Lys Val Asn Val Cys Arg Pro His Lys Gly Glu Ile Gly Leu Val 485 490 495 Phe Glu His Pro Thr Gln Pro Gly Asn Gln Thr Gly Gly Trp Met Ala 500 505 510 Arg Gln Lys His Leu Glu Thr Ala Glu Ala Ala Ala Pro Gly Leu Lys 515 520 525 Arg Ser Thr Ser Thr Pro Phe Met Asn Thr Thr Asp Gly Lys Gln Phe 530 535 540 Thr Met Ser Glu Val Arg Lys His Ser Ser Gln Asp Ser Ala Trp Ile 545 550 555 560 Val Val His Gly His Val Tyr Asp Cys Thr Ala Phe Leu Lys Asp His 565 570 575 Pro Gly Gly Ala Asp Ser Ile Leu Ile Asn Ala Gly Thr Asp Cys Thr 580 585 590 Glu Glu Phe Asp Ala Ile His Ser Asp Lys Ala Lys Ala Leu Leu Asp 595 600 605 Thr Tyr Arg Ile Gly Glu Leu Ile Thr Thr Gly Ala Gly Tyr Ser Ser 610 615 620 Asp Asn Ser Val His Gly Ala Ser Asn Leu Ser Gln Leu Ala Pro Ile 625 630 635 640 Arg Glu Ala Ile Lys Ala Pro Ala Pro Val Ala Leu Ser Ser Pro Arg 645 650 655 Asp Lys Val Pro Cys Gln Leu Val Asp Lys Lys Glu Leu Ser Arg Asp 660 665 670 Val Arg Leu Phe Arg Phe Ala Leu Pro Ser Ser Asp Gln Val Leu Gly 675 680 685 Leu Pro Val Gly Lys His Ile Phe Val Cys Ala Ser Ile Glu Gly Lys 690 695 700 Leu Cys Met Arg Ala Tyr Thr Pro Thr Ser Met Val Asp Glu Val Gly 705 710 715 720 His Phe Asp Leu Leu Ile Lys Val Tyr Phe Lys Asn Glu His Pro Lys 725 730 735 Phe Pro Asp Gly Gly Leu Met Thr Gln Tyr Leu Asp Ser Leu Pro Val 740 745 750 Gly Ala Tyr Ile Asp Val Lys Gly Pro Leu Gly His Val Glu Tyr Thr 755 760 765 Gly Arg Gly Glu Phe Val Ile Asn Gly Lys Pro Arg Asn Ala Arg Arg 770 775 780 Leu Ala Met Ile Ala Gly Gly Ser Gly Ile Thr Pro Met Tyr Gln Val 785 790 795 800 Ile Gln Ser Val Leu Arg Asp Gln Pro Glu Asp Thr Thr Glu Met His 805 810 815 Leu Val Tyr Ala Asn Arg Thr Glu Asp Asp Ile Leu Leu Arg Asp Glu 820 825 830 Leu Asp Arg Trp Ala Ala Glu Tyr Pro Asp Arg Leu Lys Val Trp Tyr 835 840 845 Val Ile Asp Gln Val Lys Arg Pro Glu Glu Gly Trp Lys Tyr Gly Val 850 855 860 Gly Phe Val Thr Glu Glu Val Leu Arg Glu His Val Pro Glu Gly Gly 865 870 875 880 Asp Asp Thr Leu Ala Leu Ala Cys Gly Pro Pro Pro Met Ile Lys Phe 885 890 895 Ala Val Ser Pro Asn Leu Glu Lys Met Lys Tyr Asp Met Ala Asn Ser 900 905 910 Phe Ile Val Phe 915 <210> 3 <211> 39 <212> DNA <213> Primer <400> 3 atatatggtc tcgattggct cgtcaagcgt cccatggtt 39 <210> 4 <211> 41 <212> DNA <213> Primer <400> 4 tggctcgtca agcgtcccat ggttttagag ctagaaatag c 41 <210> 5 <211> 43 <212> DNA <213> Primer <400> 5 aaccatggga cgcttgacga gccaatctct tagtcgactc tac 43 [[ID=I7]]<210> 6 <211> 37 <212> DNA <213> Primer <400> 6 attattggtc tcgaaaccat gggacgcttg acgagcc 37<u <210> 7 <211> 20[[ID=3d]] <212> DNA <213> Primer <400> 7 gccaaagttg aaccccacag 20 <210> 8 <211> 19[[ID=4t]] <212> DNA <213> Primer <400> 8 aggaggagca ggaggactg 19 It should be noted that there may be some inaccuracies in the original text, especially the inconsistent tags like <u . This translation is based on the best understanding of the provided content.

Claims

1. A method for regulating plant traits, comprising: The expression or activity of NR1.2 in plants was targeted downregulated, and the traits included enhanced drought resistance and reduced aboveground height of seedlings. The NR1.2 is a polypeptide with the amino acid sequence shown in SEQ ID NO: 2, the plant is rice, and the downregulation of NR1.2 expression or activity in the plant is achieved by knocking out the NR1.2 coding gene.

2. The method as described in claim 1, characterized in that, Knocking out the NR1.2 coding gene in plants includes: using the CRISPR system to edit the gene to knock out the NR1.2 coding gene; or using homologous recombination to knock out the NR1.2 coding gene.

3. The method as described in claim 1, characterized in that, Gene editing using CRISPR to knock out the coding gene for NR1.2, wherein the reagent for gene editing using the CRISPR system is an sgRNA construct.

4. The method as described in claim 1, characterized in that, Gene knockout was performed using primers shown in SEQ ID NO: 3-6, based on the CRISPR system, targeting the coding gene of NR1.

2.

5. The method according to any one of claims 1 to 4, characterized in that, The reduction of the aboveground height of plant seedlings refers to reducing the aboveground height of plant seedlings under low nitrogen conditions.

6. The method according to any one of claims 1 to 4, characterized in that, After downregulating the activity of NR1.2 in plants, the plants improved their resistance to drought by reducing nitrogen use efficiency during the seedling stage.

7. Use of a downregulator of NR1.2, wherein the use is to enhance the drought resistance of plants and reduce the aboveground height of plant seedlings, or to prepare a formulation that enhances the drought resistance of plants and reduces the aboveground height of plant seedlings; The NR1.2 is a polypeptide with the amino acid sequence shown in SEQ ID NO: 2, the plant is rice, and the downregulator is a reagent for knocking out the gene encoding NR1.

2.

8. The use as described in claim 7, characterized in that, The downregulator is a CRISPR gene-editing reagent for NR1.2, which induces a loss-of-function mutation in NR1.

2.

9. The use as described in any one of claims 7 to 8, characterized in that, The reduction of the aboveground height of plant seedlings refers to reducing the aboveground height of plant seedlings under low nitrogen conditions.

10. The use as described in any one of claims 7 to 8, characterized in that, After the downregulator lowers NR1.2 in plants, the plants improve their resistance to drought by reducing nitrogen use efficiency during the seedling stage.