A polypeptide for inhibiting the activity of coronavirus 3c-like protease, a coding gene and application thereof
The peptides 3CL pro-6 and 3CL pro-8 were screened using phage display technology, which solved the problem of the lack of inhibitors for the 3C-like protease of the novel coronavirus, achieved effective targeted therapy against SARS-CoV-2, and showed broad-spectrum inhibitory ability against a variety of coronaviruses.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-07-23
- Publication Date
- 2026-04-07
AI Technical Summary
There is a lack of targeted therapies and drugs for the novel coronavirus (SARS-CoV-2) in the current technology, especially effective inhibitors of 3C-like proteases.
Phage display technology was used to screen for peptides that can specifically bind to coronavirus 3C-like protease. Two peptides (3CL pro-6 and 3CL pro-8) were screened using phage display technology. These peptides can effectively inhibit the activity of SARS-CoV-2 3C-like protease and were prepared into drugs through chemical synthesis.
Significant inhibition of SARS-CoV-2 3C-like protease was achieved, with IC50 values of 41.52 μM and 35.61 μM, respectively, providing an effective targeted treatment method and enabling the preparation of drugs against the novel coronavirus. It also showed inhibitory effects on the 3C-like protease of other coronaviruses such as SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, HCoV-NL63 and HCoV-HKU1.
Smart Images

Figure BDA0003177055850000061 
Figure HDA0003177055860000011 
Figure HDA0003177055860000012
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a polypeptide for inhibiting the activity of coronavirus 3C-like protease, a coding gene thereof and application, in particular to a polypeptide capable of specifically binding to novel coronavirus 3C-like protease and thereby inhibiting the activity of the novel coronavirus 3C-like protease, a coding gene thereof and application in preparing a medicine for resisting novel coronavirus infection. BACKGROUND
[0002] Coronaviruses are a class of positive-strand RNA viruses that can cause significant health risks, and the diseases caused by them range from common cold to severe diseases such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). The novel coronavirus (SARS-CoV-2) is a newly discovered coronavirus strain in recent years. After human infection with SARS-CoV-2, common signs include respiratory symptoms, fever, cough, shortness of breath and difficulty breathing. In more severe cases, infection can lead to pneumonia, severe acute respiratory syndrome, kidney failure, and even death, causing serious social harm and economic loss. However, there is still a lack of targeted therapy for diseases caused by SARS-CoV-2.
[0003] It is known that 3C-like protease (3CL pro, 3C-like protease) is a hydrolytic enzyme expressed on the 5' terminal genome nsp5 of coronavirus, and its main function is to cut at least 11 sites on the polyprotein ppla and pplb, and it can recognize specific cleavage sites to cut the polyprotein precursor into multiple non-structural proteins, and finally assemble into a virus replication-transcription enzyme complex. Therefore, 3CL pro has become one of the most characteristic targets in coronavirus, and also one of the hot target spots for anti-coronavirus drug research and development. However, the current inhibitors for novel coronavirus 3C-like protease only include a few such as diselenide compounds (see patent document CN112137991A), GC376 (a broad-spectrum polypeptide analogue inhibitor, see patent document CN111135167A), and there is still a great lack of effective targeted treatment means and drugs for diseases caused by SARS-CoV-2. SUMMARY
[0004] In view of one or more problems in the prior art, one aspect of the present application provides a polypeptide which can inhibit the activity of coronavirus 3C-like protease, the polypeptide being one of the following a-c:
[0005] a. a polypeptide containing an amino acid sequence as shown in SEQ ID NO: 3 and capable of specifically binding to coronavirus 3C-like protease;
[0006] b. a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 4 and capable of specifically binding to a coronavirus 3C-like protease;
[0007] c. an acetylated, carboxylated, glycosylated or phosphorylated form of the polypeptide of a or b.
[0008] In preferred embodiments, the polypeptide is a1 or b1 as follows:
[0009] a1. a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 3;
[0010] b1. a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 4.
[0011] The coronavirus mentioned above is selected from one or more of SARS-Cov-2, SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, HCoV-NL63 and HCoV-HKU1.
[0012] In preferred embodiments, the coronavirus mentioned above is SARS-Cov-2.
[0013] The present application also provides a gene encoding the polypeptide mentioned above, which comprises or consists of a nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
[0014] The present application also provides the use of the polypeptide mentioned above in the preparation of an anti-coronavirus drug or a coronavirus 3C protease inhibitor. In the use, the blood concentration of the polypeptide is at least 35 μM, preferably at least 40 μM, when the anti-coronavirus drug or the coronavirus 3C protease inhibitor is administered to a patient infected with a coronavirus. More specifically, when the amino acid sequence of the polypeptide is as set forth in SEQ ID NO: 3, the blood concentration of the polypeptide is at least 40 μM; and when the amino acid sequence of the polypeptide is as set forth in SEQ ID NO: 4, the blood concentration of the polypeptide is at least 35 μM.
[0015] An anti-coronavirus drug or a coronavirus 3C protease inhibitor comprising the polypeptide mentioned above as an active ingredient for inhibiting the activity of a coronavirus 3C-like protease also belongs to the content of the present application.
[0016] The polypeptide provided by the above technical scheme can specifically bind to the 3C-like protease of the coronavirus (especially the novel coronavirus), and can further block the replication-transcription enzyme complex formed by the assembly thereof. The results of the examples prove that the polypeptide provided by the present application has a relatively obvious inhibitory effect on the 3C-like protease of the novel coronavirus. The IC50 values of the polypeptides with the amino acid sequences of SEQ ID NO: 3 and SEQ ID NO: 4 for inhibiting the 3C-like protease of the novel coronavirus are 41.52 μM and 35.61 μM, respectively. Therefore, the polypeptide provided by the present application can be effectively used for preparing an anti-coronavirus (especially an anti-novel coronavirus) drug or a 3C-like protease inhibitor of the coronavirus (especially the novel coronavirus), and provides a novel and effective target drug for the treatment of coronavirus infection. 50 BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 Figure 1 is a blue plaque photo of a phage monoclonal after 5 rounds of subtractive screening of a phage library;
[0018] Figure 2 Figure 4 is a statistical column chart of the affinity of 48 phage monoclonals to the 3C-like protease of SARS-CoV-2 detected by ELISA;
[0019] Figure 3 Figure 6 is a curve of the change of the fluorescence intensity of the substrate peptide under the metabolism of the 3C-like protease of SARS-CoV-2 with different concentrations of 3CL pro-6 over time;
[0020] Figure 4 Figure 8 is a curve of the change of the relative fluorescence intensity of the substrate peptide under the metabolism of the 3C-like protease of SARS-CoV-2 with different concentrations of 3CL pro-8 over time;
[0021] Figure 5 Figure 10 is an inhibition curve of 3CL pro-6 on the 3C-like protease of SARS-CoV-2;
[0022] Figure 6 Figure 12 is an inhibition curve of 3CL pro-8 on the 3C-like protease of SARS-CoV-2. DETAILED DESCRIPTION
[0023] In view of the fact that there is still a lack of targeted treatment means and drugs for diseases caused by coronaviruses (such as SARS-CoV-2) in the prior art, the present application is directed to the 3C-like protease of a coronavirus, and polypeptides capable of specifically binding to the 3C-like protease of a coronavirus and inhibiting the activity of the 3C-like protease of the coronavirus are screened by using phage display technology. The phage display technology is a screening technology for specific polypeptides or proteins, which can insert a specific gene fragment into the phage DNA to express the corresponding polypeptide on the PIII coat protein to form a fusion protein to display the surface of the phage. The displayed polypeptide can maintain a relatively independent spatial structure and biological activity, so that a direct connection between a large number of random polypeptides and their DNA coding sequences is established, so that polypeptide ligands of various target molecules (such as antibodies, enzymes and cell surface receptors, etc.) can be quickly identified through in vitro affinity panning programs. Based on the above principle, the present application screens two polypeptides capable of specifically binding to the 3C-like protease of SARS-CoV-2 and inhibiting the activity of the 3C-like protease of SARS-CoV-2 by using phage display technology, and the two polypeptides have good inhibitory effect on the activity of the 3C-like protease of SARS-CoV-2, and can be used for preparing anti-SARS-CoV-2 drugs or 3C-like protease inhibitors of SARS-CoV-2.
[0024] The present application will be further described in conjunction with specific examples. It should be understood that the specific examples are only used to further illustrate the present application, and are not used to limit the content of the present application.
[0025] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Molecular Cloning: A Laboratory Manual) Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).
[0026] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Molecular Cloning: A Laboratory Manual) Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).
[0027] The sequences involved in the following examples can all be synthesized using existing technologies, and the short peptides involved can be synthesized by chemical synthesis.
[0028] Example 1 Phage display screens select bioactive peptides that specifically bind to the 3C-like protease of the novel coronavirus.
[0029] This embodiment mainly employs phage display technology. First, the novel coronavirus 3C-like protease is immobilized on carboxyl magnetic beads. Then, a mixed library of random nonapeptide and dodecapeptide phage displays is incubated with the target. After five rounds of panning and screening, the affinity of selected phage monoclonals is detected by ELISA. Several positive monoclonals are selected for sequencing, synthesis, and affinity testing. From these, bioactive peptides that can specifically bind to the novel coronavirus 3C-like protease are screened out. The specific steps include the following steps.
[0030] 1.1 Immobilization of BSA protein with carboxyl magnetic beads: Take 100 μl of carboxyl magnetic beads (Invitrogen, Dynabeads) TM MyOne TM Carboxylic Acid (#65012) was washed four times with 200 μl of ultrapure water. The beads were then magnetically hooked, and the supernatant was discarded. 100 μl of prepared NHS (N-hydroxysuccinimide, CAS No.: 6066-82-6) and 100 μl of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, CAS No.: 25952-53-8) were slowly thawed at room temperature. The NHS was added to the EDC and mixed well, then added to the magnetic beads from the previous step. The mixture was incubated on a shaker at room temperature for 20 min. The beads were then magnetically hooked, the supernatant was discarded, and the mixture was washed twice with 200 μl of PBS. 10 μl of BSA protein (2 mg / ml, Abcam) was added to 95 μl of pH 3.6 NaAC solution and mixed well. This mixture was then added to the magnetic beads from the previous step and incubated on a shaker at room temperature for 60 min. The beads were then magnetically hooked, and the supernatant was discarded. Add 100 μl of 1M ethanolamine (pH 8.5) to the magnetic beads from the previous step and incubate at room temperature on a shaker for 10 min. Use a magnet to pick up the magnetic beads, discard the supernatant, and wash four times with 200 μl of PBS to obtain carboxyl-modified magnetic beads immobilized with BSA protein, denoted as MB-BSA, for later use.
[0031] 1.2, Carboxyl magnetic beads immobilize SARS-CoV-2 3C-like protease protein: Take 100 μl carboxyl magnetic beads, wash 4 times with 200 μl ultrapure water, magnet fish magnetic beads, remove supernatant. Take 50 μl of NHS and 50 μl of EDC prepared, slowly thaw at room temperature, mix NHS into EDC, add to the magnetic beads in the previous step. Incubate at room temperature for 20 min on a shaker, magnet fish magnetic beads, remove supernatant, wash 2 times with 200 μl PBS. Take 10 μl of SARS-CoV-2 3C-like protease protein (hereinafter referred to as SARS-Cov-2 3C-like protease, concentration 2.2 mg / ml, purchased from Sino Biological), add 30 μl of NaAC pH 3.6, add to the magnetic beads in the previous step. Incubate at room temperature for 60 min on a shaker, magnet fish magnetic beads, remove supernatant. Take 100 μl of 1M ethanolamine pH 8.5 and add to the magnetic beads in the previous step. Incubate at room temperature for 10 min on a shaker. Magnet fish magnetic beads, remove supernatant, wash 4 times with 200 μl PBS to obtain carboxyl magnetic beads immobilized with SARS-CoV-2 3C-like protease protein, marked as MB-3C, ready for use.
[0032] 1.3, Screening
[0033] (1) Wash the 100 μl MB-BSA magnetic beads obtained in step 1.1 more than 3 times with sterile PBS on a clean bench, remove the supernatant. Take 200 μl of random nonapeptide and dodecapeptide phage display mixed library (random nonapeptide phage display library and random dodecapeptide phage display library mixed in equal proportions, both purchased from New England Biolabs, USA) and add to the magnetic beads in the previous step, mix well with a gun. Incubate at room temperature for 50 min on a rotary shaker, magnet fish magnetic beads, the supernatant is marked as pool-, take out 1 μl for titer determination library blue-white spot number.
[0034] (2) Wash the MB-BSA magnetic beads obtained in step 1.1 4 times with 200 μl PBST (0.1% Tween-20 in PBS). Add 100 μl of glycine hydrochloride solution (pH 2.2), mix well with a gun. Incubate at room temperature for 10 min on a rotary shaker, magnet fish magnetic beads, transfer the supernatant to a new 1.5 ml centrifuge tube, add 20 μl of Tris solution (1M, pH 9.0) and 80 μl of PBS solution for neutralization, marked as Elution-, take out 1 μl for titer determination, negative screening blue-white spot number, used to calculate the retention rate.
[0035] (3) The MB-3C magnetic beads obtained in step 1.2 were washed with sterile PBS for more than 3 times on a clean bench, and the supernatant was removed. The above-mentioned pool- screened in step (1) was added and mixed by gun blowing. Incubation was performed at room temperature for 50 min on a rotary shaker, the magnetic beads were fished with a magnet, and the supernatant was removed. The MB-3C magnetic beads were washed with 200 μl of PBST (PBS containing 0.1% tween-20) for 4 times. 100 μl of glycine hydrochloride solution (pH 2.2) was added and mixed by gun blowing. Incubation was performed at room temperature for 10 min on a rotary shaker, the magnetic beads were fished with a magnet, and the supernatant was transferred into a new 1.5 ml centrifuge tube. Neutralization was performed again by adding 20 μl of Tris solution (1M, pH 9.0) and 80 μl of PBS solution, which was recorded as Elution+, 1 μl of which was taken out for titer determination, counting the number of blue-white spots for positive screening, and used for calculating the retention rate.
[0036] (4) The Elution+ obtained in step (3) was added to 20 ml of ER2738 bacterial solution (E. coli ER2738, purchased from New England Biolabs, USA) with OD600=0.5, mixed, and placed in a shaker for incubation at 37°C and 220 rpm for 4.5 h for amplification. The amplified product was transferred into a new centrifuge tube, centrifuged at 4°C and 8000 g for 20 min, and the supernatant was transferred into another centrifuge tube for repeated centrifugation. The upper 80% of the supernatant was transferred into a fresh centrifuge tube, 1 / 6 volume of PEG / NaCl (20% [w / v] PEG-8000, 2.5M NaCl) was added, and precipitation was performed at 4°C overnight. After centrifugation again, resuspension in 1 ml of PBS, PEG / NaCl precipitation for 20 min, the product was dissolved in 200 μl of PBS, centrifuged at 14000 rpm for 1 min, and the supernatant was transferred into another fresh centrifuge tube, which was the eluate after amplification (phage eluted), 1 μl of which was taken out for titer determination, and the others were used for the next round of screening or preservation.
[0037] In the 2nd to 5th rounds of screening (each round of screening using the eluate after amplification as the initial phage display library, repeating steps (1) to (4) above), the Tween-20 concentration in the washing solution PBST was increased to 0.5% for each round, the incubation time with the target protein was reduced to 30 min for each round, the number of washes was increased to 8 for each round, and the rest of the conditions and steps were the same as the first round.
[0038] 1.4, determination of phage titer: the phage eluted in step (4) of step 1.3 above was diluted 100 times with PBS, 10 μl of the diluted phage was mixed with 200 μl of logarithmic growth period E. coli ER2738 bacterial solution, and was added to the top layer of LB agar at 45°C. After rapid pouring onto a plate containing LB / IPTG / Xgal, it was incubated overnight, and the number of blue phage plaques was counted, as shown in Figure 1The blue plaques of the phages after 5 rounds of subtractive screening are shown.
[0039] 1.5, ELISA identification of phage polypeptides: After 5 rounds of subtractive screening, 48 phage clones (i.e., 48 blue plaques) were randomly picked from the plate for determining the phage titer, and the affinity of the phage clones to the SARS-Cov-2 3C-like protease was preliminarily identified by ELISA. The specific identification method was as follows: the SARS-Cov-2 3C-like protease was coated on an ELISA plate at 4°C overnight, blocked with 5% skimmed milk at room temperature for 2 hours, washed 4 times with 0.05% PBST, and the 48 phage monoclonal antibodies were added and incubated for 4 hours; HRP-anti M13 antibody (purchased from Abeam) was added and incubated at 37°C for 1 hour, TMB was used for color development (100 μl per well, color development for 8-15 minutes, purchased from Abeam), and an equal volume of 1M HCl was added to terminate the reaction, and the reading was taken at 450nm by an enzyme-labeled instrument (recorded as P). BSA protein was coated as a negative control (recorded as N), and when P / N>2, the phage clone was identified as a positive clone specifically combined with the SARS-Cov-2 3C-like protease, and the results are shown in Figure 2 , which shows the ELISA identification results of the affinity of the 48 phage clones to the SARS-Cov-2 3C-like protease. It can be seen from Figure 2 that the phage clones corresponding to numbers 2, 6, 8, 14, 15, 29, 34, 37, 38, and 40 are positive phage monoclonals, and the positive phage monoclonals corresponding to numbers 6 and 8 have higher affinity to the SARS-Cov-2 3C-like protease than other positive monoclonals, and in particular, the positive monoclonal corresponding to number 6 has significantly higher affinity to the SARS-Cov-2 3C-like protease than other positive monoclonals, so the positive monoclonals corresponding to numbers 6 and 8 are preferred for gene extraction and sequencing.
[0040] 1.6, Gene extraction and sequencing: The phage monoclonal corresponding to No. 6 and 8 in the ELISA preliminarily identified positive clones were respectively carried out plaque amplification, centrifugation, the phage supernatant was transferred into a new centrifuge tube, 200 μL PEG / NaCl was added, and it was inverted and mixed uniformly, and it was placed at room temperature for 10 min. 12000 rpm centrifugation for 10 min, discard the supernatant. Short-term centrifugation, carefully suck the residual supernatant. The precipitate was completely resuspended in 100 μl of iodide buffer, and 250 μl of ethanol was added. Incubate at room temperature for 10 min. Short-term incubation at room temperature causes single-stranded phage DNA to precipitate while most phage proteins remain in solution. 12000 rpm centrifugation for 10 min, discard the supernatant. Wash the precipitate with pre-cooled 70% ethanol, and briefly vacuum dry. Resuspend the precipitate in 30 μl of ddH2O, and send it to General Biotechnology Co., Ltd. for monoclonal sequencing. The sequencing results are shown in Table 1, and the corresponding amino acid sequences are shown in Table 2.
[0041] Table 1: Nucleotide sequences of phage monoclonal No. 6 and 8
[0042] Monoclonal Number Monoclonal Nucleotide Sequence (3' to 5') 6 CGACGGCTCCAGCAACGACCAACAAGC (SEQ ID NO: 1) 8 AGAAGAACACGCCCTAGGCACATGACAATGCGAAGC (SEQ ID NO: 2)
[0043] Table 2: Amino acid sequences corresponding to the nucleotide sequences of phage monoclonal No. 6 and 8
[0044]
[0045] 1.7, Bioinformatics analysis of sequences: The nucleotide sequences and corresponding amino acid sequences of phage monoclonal No. 6 and 8 were subjected to bioinformatics analysis in the National Center for Biotechnology Information (NCBI) GenBank DNA sequence database and Swiss-Prot protein database, and homologous sequences were queried. It was found that the sequences of both had no homology with known genes and proteins in the NCBI GenBank DNA sequence database and Swiss-Prot protein database, and there was no report in the prior art. Therefore, the present application obtained two new polypeptides capable of specifically binding to SARS-Cov-2 3C-like protease, and according to Figure 2 the affinity detection results shown in Table 1, the two polypeptides have higher binding affinity than the polypeptides obtained from other positive monoclonals. The polypeptides obtained from positive monoclonal No. 6 and 8 were named 3CL pro-6 and 3CL pro-8, respectively, and the amino acid sequences of the two polypeptides are shown in Table 2.
[0046] The polypeptide sequences of 3CL pro-6 and 3CL pro-8 above can be obtained by chemical synthesis method, and modifications can be introduced in the polypeptide, which can include deletion, insertion and / or substitution of one or more amino acids, and addition or deletion of one or several amino acids at the C-terminal and / or N-terminal; such modifications can also include acetylation, carboxylation, glycosylation, phosphorylation (e.g. with phosphorylated amino acid residues (including but not limited to: phosphotyrosine, phosphoserine, phosphothreonine)) forms of the polypeptide, as long as the modified polypeptide can still specifically bind to SARS-Cov-2 3C-like protease.
[0047] Example 2 Biological effects of 3CL pro-6 and 3CL pro-8 as SARS-Cov-2 3C-like protease inhibitors
[0048] In order to verify the biological effects of 3CL pro-6 and 3CL pro-8 polypeptides as SARS-Cov-2 3C-like protease inhibitors shown in Table 1 above, the substrate {DABCYL}-KTSAVLQSGFRKM-{Glu-EDANS} (hereinafter referred to as substrate peptide) used in this embodiment was diluted with Tris-EDTA buffer, and the concentration of SARS-Cov-2 3C-like protease used was 4 μg / mL, and the concentration of 3CL pro-6 and 3CL pro-8 polypeptides was 0.05 μM-1 mM.
[0049] 2.1 Biological activity of 3CL pro-6 and 3CL pro-8 as SARS-Cov-2 3C-like protease inhibitors
[0050] This experiment detects the change of fluorescence intensity of substrate peptide under SARS-Cov-2 3C-like protease metabolism with time under different concentrations of inhibitors (3CL pro-6 and 3CL pro-8) to verify that 3CL pro-6 and 3CL pro-8 can inhibit the activity of SARS-Cov-2 3C-like protease, which specifically includes the following steps.
[0051] (1) SARS-Cov-2 3C-like protease and substrate peptide stock solution were stored in -80°C refrigerator, the substrate peptide stock solution was thawed in a freeze plate (-4 to 4°C) at room temperature, and diluted with Tris-EDTA buffer (PH=7.4) to a concentration of 0.5 mM for standby;
[0052] (2) Thaw the SARS-CoV-2 3C-like protease in a cryopreservation plate (-4 to 4°C) at room temperature, take 1 μl and add it to 15 μl of Tris-EDTA buffer (pH=7.4), and add it to the well of the detection plate to make the concentration of SARS-CoV-2 3C-like protease 4 μg / mL;
[0053] (3) Dilute 3CL pro-6 and 3CL pro-8 with PBS in a 3-fold serial dilution method (concentrations of approximately 1000 μM, 333 μM, 111 μM, 37 μM, 12 μM, 4 μM, 1.4 μM, 0.46 μM, 0.15 μM, and 0.05 μM, respectively), and add 2 μL of each to the wells of the detection plate in step (2) above, and incubate at room temperature for 30 min;
[0054] (4) Add 2 μL of substrate peptide (0.5 mM) of the same concentration to the wells of the detection plate in step (3) above, incubate at room temperature in the dark for 30 min, and monitor the fluorescence emission value at 360 nm excitation and 490 nm using a fluorescence microplate reader.
[0055] The fluorescence intensity of the substrate peptide under SARS-CoV-2 3C-like protease metabolism over time was observed in the presence of inhibitors (3CL pro-6 and 3CL pro-8) as shown in the following results. Figure 3 and Figure 4 As shown, where Figure 3 This represents the fluorescence intensity change over time of the substrate peptide during metabolism by the SARS-CoV-2 3C-like protease in the presence of 3CL pro-6. Figure 4 This represents the fluorescence intensity change over time of the substrate peptide during metabolism by the SARS-CoV-2 3C-like protease in the presence of 3CL pro-8. Figure 3 and Figure 4 It is known that in the presence of 3CL pro-6 or 3CL pro-8, the fluorescence enhancement produced by the substrate peptide catalyzed by SARS-Cov-2 3C-like protease can be significantly inhibited by 3CL pro-6 or 3CL pro-8 as inhibitors. That is, both 3CL pro-6 and 3CL pro-8 can act as inhibitors of SARS-Cov-2 3C-like protease, and this inhibition phenomenon is concentration-dependent. In the presence of either 3CL pro-6 or 3CL pro-8, when the concentration of the inhibitor is above approximately 100 μM, the fluorescence signal of the substrate peptide under the metabolism of SARS-Cov-2 3C-like protease is almost undetectable. In other words, the enzyme activity of SARS-Cov-2 3C-like protease is almost completely inhibited by the inhibitor.
[0056] 2.2 Determination of the ability of 3CL pro-6 and 3CL pro-8 to inhibit SARS-CoV-2 3C-like protease activity
[0057] This experiment determined the inhibitory effects of the inhibitors 3CL pro-6 and 3CL pro-8 on the activity of SARS-CoV-2 3C-like protease, and specifically included the following steps.
[0058] (1) The SARS-CoV-2 3C-like protease and substrate peptide stock solutions were stored in a -80°C freezer. The substrate peptide stock solution was thawed at room temperature in a cryovial (-4 to 4°C) and diluted with Tris-EDTA buffer (pH=7.4) to a concentration of 0.5 mM for later use.
[0059] (2) Thaw the SARS-CoV-2 3C-like protease in a cryopreservation plate (-4 to 4°C) at room temperature, take 1 μl and add it to 15 μl of Tris-EDTA buffer (pH=7.4), and add it to the well of the detection plate to make the concentration of SARS-CoV-2 3C-like protease 4 μg / mL;
[0060] (3) Dilute 3CL pro-6 and 3CL pro-8 with PBS in a 3-fold serial dilution method (concentrations of approximately 1000 μM, 333 μM, 111 μM, 37 μM, 12 μM, 4 μM, 1.4 μM, 0.46 μM, 0.15 μM, and 0.05 μM, respectively), and add 2 μL of each to the wells of the detection plate in step (2) above, and incubate at room temperature for 30 min;
[0061] (4) Add 1 μL of substrate peptide (0.5 mM) of the same concentration to the wells of the detection plate in step (3) above, incubate at room temperature in the dark for 30 min, and monitor the fluorescence emission values at 360 nm excitation and 490 nm using a fluorescence microplate reader; count the fluorescence emission values at 360 nm excitation and 490 nm before and after incubation for each group.
[0062] (5) Using the fluorescence change value before and after incubation of the blank control group (inhibitor concentration of 0) as 100, the fluorescence change values before and after incubation of different inhibitor concentration groups were compared with those to obtain the residual activity value. Using GraphPad Prism6 software, a graph was plotted with the logarithm of the inhibitor concentration (logC(Inhibitor)) on the x-axis and the corresponding residual activity value on the y-axis to obtain the inhibition curve of the inhibitor on SARS-CoV-2 3C-like protease. This graph plots the ratio of different inhibitor concentrations to the inhibition of enzyme activity, from which the inhibitor's inhibitory ability on enzyme activity can be obtained. The inhibitor concentration at which half of the enzyme activity is inhibited (IC50) can be used as the value.50 Its calculation formula is Y = 100 / (1 + 10^((X - LogIC)). 50 ))), where Y represents the remaining activity value, X represents the common logarithm of the inhibitor compound concentration, and ∧ refers to the exponential method. The results are as follows Figure 5 and Figure 6 As shown, where Figure 5 The inhibition curve of 3CL pro-6 against SARS-CoV-2 3C-like protease is shown. Figure 6 The inhibition curve of 3CL pro-8 against SARS-CoV-2 3C-like protease is shown.
[0063] Depend on Figure 5 and Figure 6 It can be seen that both 3CL pro-6 and 3CL pro-8 have significant inhibitory effects on the 3C-like protease of the novel coronavirus. The IC50 values for 3CL pro-6 and 3CL pro-8 are shown to be [missing information]. 50 The values were 41.52 μM and 35.61 μM, respectively, indicating that these two peptides could effectively inhibit the activity of SARS-CoV-2 3C-like protease. Given that sequence analysis shows high similarity between coronavirus 3C-like proteases, these two peptides can also effectively inhibit the activity of other coronavirus 3C-like proteases, especially those of SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1.
[0064] In summary, both polypeptides 3CL pro-6 and 3CL pro-8 provided by this invention can effectively inhibit the activity of SARS-CoV-2 3C-like protease, with corresponding IC50 values. 50 The values are 41.52 μM and 35.61 μM, respectively. Therefore, these two peptides or a mixture thereof can be used to prepare targeted drugs against the SARS-CoV-2 3C-like protease. After administration of the drug to a patient, it is preferable to achieve a blood concentration of 3CL pro-6 of ≥41.52 μM and a blood concentration of 3CL pro-8 of ≥35.61 μM. On the other hand, since coronavirus 3C-like proteases are highly similar, the two peptides 3CL pro-6 and 3CL pro-8 provided by the present invention can also be used to inhibit the activity of 3C-like proteases of other coronaviruses (especially SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1) and prepare targeted drugs against other coronaviruses. Furthermore, the peptide sequences provided by the present invention are relatively short, thus they are easy to synthesize and can be mass-produced.
[0065] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. sequence list <110> Hefei Zhongke Puruisheng Biomedical Technology Co., Ltd. <120> A polypeptide that inhibits the activity of coronavirus 3C-like protease, its encoding gene, and its applications. <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 27 <212> DNA <213> Artificial Sequence <400> 1 cgacggctcc agcaacgacc aacaagc 27 <210> 2 <211> 36 <212> DNA <213> Artificial Sequence <400> 2 agaagaacac gccctaggca catgacaatg cgaagc 36 <210> 3 <211> 9 <212> PRT <213> Artificial Sequence <400> 3 Cys Trp Ser Leu Leu Glu Pro Ser Cys 1 5 <210> 4 <211> 12 <212> PRT <213> Artificial Sequence <400> 4 Ala Ser His Cys His Val Pro Arg Ala Cys Ser Ser 1 5 10
Claims
1. A polypeptide, said polypeptide being one of the following a or b: a. A polypeptide with the amino acid sequence shown in SEQ ID NO:3, and capable of specifically binding to coronavirus 3C-like protease; b. A polypeptide with the amino acid sequence shown in SEQ ID NO:4, which can specifically bind to coronavirus 3C-like protease.
2. The use of the polypeptide of claim 1 in the preparation of an anti-coronavirus drug; wherein the coronavirus is SARS-CoV-2.
3. An anti-coronavirus drug comprising the polypeptide of claim 1 as an active ingredient.
4. A coronavirus 3C protease inhibitor comprising the polypeptide of claim 1 as an active ingredient.
Citation Information
Patent Citations
Application of GC376 in preparation of novel coronavirus SARS-CoV-2 inhibitor
CN111135167A
Application of diselenide compound as coronavirus 3C-like protease inhibitor, inhibitor and drug
CN112137991A
Inhibitors of SARS-coronavirus 3CL protease for severe acute respiratory syndrome and method for screening thereof
KR1020120081768A