Protein mutants, nucleoside-producing recombinant microorganisms, and uses thereof

By mutating phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase in Bacillus subtilis, the problem of low nucleoside conversion rate in microbial fermentation was solved, and efficient production of nucleosides or their derivatives was achieved.

CN115678871BActive Publication Date: 2025-11-21MEIHUA (SHANGHAI) BIOLOGICAL TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202110859952.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-07-28
Publication Date
2025-11-21
Estimated Expiration
2041-07-28

AI Technical Summary

Technical Problem

Existing microbial fermentation methods for producing nucleosides have low conversion rates, making it difficult to meet the needs of large-scale industrial production.

Method used

By mutating phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase in Bacillus subtilis, mutant phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase were obtained, thereby improving the nucleoside synthesis capacity of microorganisms.

Benefits of technology

It significantly improved the yield and conversion rate of nucleosides or their derivatives, promoted the accumulation of nucleosides or their derivatives, and met the needs of industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003185477100000051
    Figure BDA0003185477100000051
Patent Text Reader

Abstract

The present application relates to the field of microbial technology, in particular to protein mutants, recombinant microorganisms for producing nucleosides and application thereof. The present application provides a phosphoglycolate kinase mutant, which contains a mutation that the valine at position 31 is substituted by an amino acid other than valine. The present application also provides a pyrimidine-specific carbamoyl phosphate synthase mutant, which contains a mutation that the serine at position 160 is substituted by an amino acid other than serine. The above protein mutants can significantly improve the nucleoside synthesis capacity of microorganisms and effectively promote the accumulation of nucleosides or derivatives thereof. The present application further provides recombinant microorganisms expressing the above mutants, which can efficiently produce nucleosides or derivatives thereof and are of great significance to improve the production performance of nucleoside and derivative production strains.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbiological technology, in particular to protein mutants, recombinant microorganisms for producing nucleosides and applications thereof. BACKGROUND

[0002] Nucleosides are a class of glycosides, which are condensed by D-ribose or D-Z-deoxyribose and pyrimidine base or purine base, generally colorless crystals, insoluble in ordinary organic solvents, easily soluble in hot water, and the melting point is 160-240℃. Nucleosides are the components of nucleic acids and nucleotides, among which, the nucleosides generated from D-ribose are called ribonucleosides, which participate in the composition of RNA, and the nucleosides generated from D-alpha-deoxyribose are called deoxyribonucleosides, which participate in the composition of DNA. D-ribose is condensed with adenine, guanine, cytosine, thymine or uracil to generate the corresponding adenine riboside, guanosine riboside, cytosine riboside, thymine riboside and uracil riboside, which are simply referred to as adenosine (A), guanosine (G), cytosine (C), thymidine (T) and uridine (U) respectively.

[0003] Guanosine and inosine have a wide range of applications in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of guanylate disodium and inosinate disodium, respectively, and the combination of guanylate disodium and inosinate disodium is used as a food enhancer and widely used in condiments such as chicken essence and soy sauce. In the pharmaceutical field, guanosine and inosine can be used as pharmaceutical intermediates for a variety of antiviral drugs, such as acyclovir, ribavirin, guanosine triphosphate sodium, etc., which all use guanosine as a synthetic raw material. Inosine is an important precursor of inosinic acid, which can be used as a precursor for the synthesis of adenosine acid (AMP) and guanosine acid (GMP), and is suitable for leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, etc. caused by various reasons, and can also be used to treat central retinal inflammation, optic atrophy, etc.

[0004] At present, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus, etc. In the process of breeding and modification of growing strains, high-yield nucleoside strains are obtained by using ultraviolet mutagenesis, diethyl sulfate mutagenesis breeding, and directional breeding; or according to the metabolic pathway and regulation mechanism of nucleotides in bacteria, the genetic background and strain characteristics of the strain are deeply understood, and the strain is modified by metabolic engineering means, so as to obtain a production strain with excellent properties and high yield of nucleosides. However, the fermentation performance of the nucleoside strain is still poor, and the conversion rate of nucleosides is still low, which cannot meet the needs of large-scale industrial production. SUMMARY

[0005] The first object of the present application is to provide phosphoglycerate kinase mutants, pyrimidine-specific carbamoyl phosphate synthase mutants and applications thereof.

[0006] A second object of the present application is to provide a recombinant microorganism for producing a nucleoside or a derivative thereof, a method for constructing the same, and use thereof.

[0007] A third object of the present application is to provide a method for fermentatively producing a nucleoside or a derivative thereof.

[0008] Specifically, the present application provides the following technical solutions:

[0009] The protein mutant of the present application is a phosphoglycerate kinase mutant and / or a pyrimidine-specific carbamoyl phosphate synthase mutant, wherein the phosphoglycerate kinase mutant has a mutation in which valine at position 31 is substituted with an amino acid other than valine, and the pyrimidine-specific carbamoyl phosphate synthase mutant has a mutation in which serine at position 160 is substituted with an amino acid other than serine, with reference to the wild-type phosphoglycerate kinase of Bacillus subtilis and the wild-type pyrimidine-specific carbamoyl phosphate synthase of Bacillus subtilis, respectively.

[0010] The protein mutant of the present application can be a phosphoglycerate kinase mutant, a pyrimidine-specific carbamoyl phosphate synthase mutant, or a combination of both.

[0011] In the present application, the phosphoglycerate kinase is encoded by the pgk gene, catalyzing the production of 3-phosphoglycerate from 1,3-bisphosphoglycerate, and generating one molecule of ATP. The present application has obtained a phosphoglycerate kinase mutant by modifying the phosphoglycerate kinase, which can effectively improve the nucleoside synthesis capacity of microorganisms.

[0012] The pyrimidine-specific carbamoyl phosphate synthase is encoded by the pyrAB gene, catalyzing the synthesis of carbamoyl phosphate from NH3, CO2, and two molecules of ATP. The present application has obtained a pyrimidine-specific carbamoyl phosphate synthase mutant by modifying the pyrimidine-specific carbamoyl phosphate synthase, which can effectively improve the nucleoside synthesis capacity of microorganisms.

[0013] Preferably, with reference to the wild-type phosphoglycerate kinase of Bacillus subtilis, the phosphoglycerate kinase mutant has a mutation in which valine at position 31 is substituted with isoleucine, leucine, or alanine. With reference to the wild-type pyrimidine-specific carbamoyl phosphate synthase of Bacillus subtilis, the pyrimidine-specific carbamoyl phosphate synthase mutant has a mutation in which serine at position 160 is substituted with isoleucine, leucine, or valine.

[0014] Specifically, the phosphoglycerate kinase mutant has an amino acid as shown in any one of SEQ ID NO. 1-3. The pyrimidine-specific carbamoyl phosphate synthase mutant has an amino acid as shown in any one of SEQ ID NO. 7-9.

[0015] It should be understood by those skilled in the art that the addition of a tag protein or fusion with other proteins at the N-terminus or C-terminus of the above-mentioned protein mutant sequence to form a fusion protein does not change the activity of the above-mentioned mutant protein itself, and the above-mentioned tagged protein or fusion protein is also within the protection scope of the present application.

[0016] The present application finds that the above-mentioned phosphoglycerate kinase mutant and pyrimidine-specific carbamoyl phosphate synthetase mutant can significantly enhance the synthesis of nucleosides or derivatives thereof in microorganisms when used alone, thereby improving the yield and conversion rate of nucleosides or derivatives thereof. The effect of the combination of the phosphoglycerate kinase mutant and the pyrimidine-specific carbamoyl phosphate synthetase mutant is more optimal, which can further improve the yield and conversion rate of nucleosides or derivatives thereof on the basis of the use of each mutant alone. In addition, the above-mentioned phosphoglycerate kinase mutant and pyrimidine-specific carbamoyl phosphate synthetase mutant can also better ensure the growth characteristics of microorganisms.

[0017] The present application also provides a gene encoding the above-mentioned protein mutant.

[0018] Based on the above-mentioned amino acid sequence of the protein mutant, those skilled in the art can obtain the sequence of the encoding nucleic acid. Based on the degeneracy of codons, there are more than one nucleic acid sequences encoding the above-mentioned amino acid sequence, and all nucleic acids capable of encoding the above-mentioned protein mutant are within the protection scope of the present application.

[0019] As an embodiment of the present application, the nucleotide sequence of the gene encoding the phosphoglycerate kinase mutant is shown in any one of SEQ ID NO. 4-6. The nucleotide sequence of the gene encoding the pyrimidine-specific carbamoyl phosphate synthetase mutant is shown in any one of SEQ ID NO. 10-12.

[0020] The present application also provides a biological material containing the above-mentioned gene, which is a recombinant DNA, a vector or a host cell.

[0021] The above-mentioned recombinant DNA includes a recombinant DNA obtained by connecting an element for driving the transcription and expression of the gene at the upstream or downstream of the gene.

[0022] The above-mentioned vector can be an expression vector or a cloning vector, including but not limited to a plasmid vector, a bacteriophage vector, a transposon, etc.

[0023] The above-mentioned host cell is a microbial cell.

[0024] Based on the function of the above-mentioned protein mutant, the present application provides the following any one application of the protein mutant, the encoding gene thereof or the biological material containing the encoding gene thereof:

[0025] (1) application in the fermentation production of nucleosides or derivatives thereof;

[0026] (2) use in constructing a nucleoside or derivative thereof-producing strain;

[0027] (3) use in increasing the yield and / or conversion rate of a nucleoside or derivative thereof.

[0028] In the present application, the nucleoside is preferably a purine nucleoside, more preferably adenosine, inosine or guanosine.

[0029] In the present application, the nucleoside derivative is a substance synthesized using a nucleoside as a precursor, including but not limited to adenine, adenylic acid, inosinic acid, guanine, guanylic acid, hypoxanthine, diacetylguanine, riboflavin, etc.

[0030] Those skilled in the art will understand that, in the case where the nucleoside synthesis ability of a microorganism is enhanced, downstream products using a nucleoside as a precursor will also have enhanced synthesis ability due to the enhanced supply of their precursors.

[0031] The present application also provides a recombinant microorganism in which the expression amount and / or enzyme activity of one or both of the enzymes selected from the group consisting of phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase is reduced.

[0032] Specifically, the expression and / or enzyme activity reduction can be achieved by a combination of one or more of the following (1) and (2):

[0033] (1) one or more base insertions, deletions or substitutions are made in the gene encoding the phosphoglycerate kinase and / or pyrimidine-specific carbamoyl phosphate synthase so that the expression and / or enzyme activity of the phosphoglycerate kinase and / or pyrimidine-specific carbamoyl phosphate synthase is reduced;

[0034] (2) the transcription or translation regulatory element of the gene encoding the phosphoglycerate kinase and / or pyrimidine-specific carbamoyl phosphate synthase is replaced with a regulatory element having lower activity so that the expression and / or enzyme activity of the phosphoglycerate kinase and / or pyrimidine-specific carbamoyl phosphate synthase is reduced.

[0035] Preferably, the recombinant microorganism expresses one or both of the phosphoglycerate kinase mutant and the pyrimidine-specific carbamoyl phosphate synthase mutant, and does not express one or both of the enzymes selected from the group consisting of phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase that the starting strain thereof has.

[0036] Specifically, as one embodiment of the present application, the present application provides a recombinant microorganism that expresses the phosphoglycerate kinase mutant and does not express the phosphoglycerate kinase that the starting strain thereof has.

[0037] As another embodiment of the present application, the present application provides a recombinant microorganism which expresses the pyrimidine-specific carbamoyl phosphate synthetase mutant and does not express the pyrimidine-specific carbamoyl phosphate synthetase that the starting strain thereof has.

[0038] As another embodiment of the present application, the present application provides a recombinant microorganism which expresses the pyrimidine-specific carbamoyl phosphate synthetase mutant and does not express the pyrimidine-specific carbamoyl phosphate synthetase that the starting strain thereof has.

[0039] Preferably, in the recombinant microorganism, the gene encoding the phosphoglycerate kinase and / or the pyrimidine-specific carbamoyl phosphate synthetase is replaced by the gene encoding the mutant of the protein.

[0040] In the present application, the recombinant microorganism is preferably a Bacillus bacterium, more preferably Bacillus subtilis, Bacillus amyloliquefaciens or Bacillus pumilus.

[0041] In the present application, the starting strain is preferably a strain capable of accumulating nucleosides.

[0042] Preferably, the starting strain contains any one of the following mutations:

[0043] (1) the proline at position 116 of the glutamine synthetase purD is mutated to leucine;

[0044] (2) the alanine at position 65 of the transcriptional regulator purR is mutated to aspartic acid;

[0045] (3) the glycine at position 279 of the inosine nucleotide dehydrogenase gene guaB is mutated to arginine.

[0046] The starting strain also includes the following mutation: the upp gene is inactivated.

[0047] As an embodiment of the present application, the starting strain is a strain obtained by knocking out the upp gene and mutating the proline at position 116 of the glutamine synthetase encoding gene purD on the chromosome to leucine in Bacillus subtilis 168.

[0048] The recombinant microorganism provided by the present application has significantly enhanced nucleoside synthesis ability and can efficiently produce nucleosides or derivatives thereof.

[0049] The present application also provides a method for constructing the recombinant microorganism, which comprises inserting, deleting or replacing one or more bases in the gene encoding the phosphoglycerate kinase and / or the pyrimidine-specific carbamoyl phosphate synthetase in the starting strain to reduce the enzyme activity of the phosphoglycerate kinase and / or the pyrimidine-specific carbamoyl phosphate synthetase.

[0050] Alternatively, the transcription and / or translation regulatory element of the gene encoding the phosphoglycerate kinase and / or pyrimidine-specific carbamoyl phosphate synthase in the starting strain is replaced with a regulatory element with lower activity, so that the expression amount of the phosphoglycerate kinase and / or pyrimidine-specific carbamoyl phosphate synthase is reduced.

[0051] Preferably, the method comprises: mutating the gene encoding the phosphoglycerate kinase and / or pyrimidine-specific carbamoyl phosphate synthase in the starting strain into the gene encoding the phosphoglycerate kinase mutant, pyrimidine-specific carbamoyl phosphate synthase mutant.

[0052] The present application also provides the use of the recombinant microorganism in any one of the following:

[0053] (1) in the fermentation production of nucleosides or derivatives thereof;

[0054] (2) in the construction of a nucleoside or derivative thereof production strain;

[0055] (3) in the improvement of the yield and / or conversion rate of nucleosides or derivatives thereof.

[0056] The present application provides a method for the fermentation production of nucleosides or derivatives thereof, which comprises the step of culturing the recombinant microorganism.

[0057] Specifically, the method for the fermentation production of nucleosides or derivatives thereof comprises: activating the recombinant microorganism, inoculating the activated microorganism into a seed culture medium for seed culture, then inoculating the seed liquid into a fermentation culture medium for fermentation, and separating the nucleosides or derivatives thereof in the fermentation product.

[0058] Preferably, the fermentation culture medium comprises the following components: glucose 50-70 g / L, yeast powder 2-5 g / L, potassium dihydrogen phosphate 2-4 g / L, ammonium sulfate 20-30 g / L, manganese sulfate 0.005-0.02 g / L, magnesium sulfate 4-6 g / L, monosodium glutamate 5-15 g / L, corn syrup dry powder 12-18 g / L, pH 7.0-7.2.

[0059] Preferably, the seed culture medium comprises the following components: glucose 15-25 g / L, yeast powder 3-7 g / L, corn syrup dry powder 3-7 g / L, potassium dihydrogen phosphate 2-4 g / L, magnesium sulfate 0.4-0.6 g / L, ferrous sulfate 0.01-0.03 g / L, manganese sulfate 0.005-0.02 g / L, pH 7.0-7.2.

[0060] The present application has the beneficial effect that the present application obtains phosphoglycerate kinase mutants and pyrimidine-specific carbamoyl phosphate synthase mutants by modifying phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase, and the above protein mutants can significantly improve the nucleoside synthesis capacity of microorganisms and effectively promote the accumulation of nucleosides or derivatives thereof. The present application further provides recombinant microorganisms expressing the above mutants, which can efficiently produce nucleosides or derivatives thereof, and experiments have verified that the yield and conversion rate of adenosine and inosine are significantly improved. DETAILED DESCRIPTION

[0061] The following examples are used to illustrate the present application, but are not used to limit the scope of the present application.

[0062] The primer names and sequences involved in the following examples are shown in Table 1.

[0063] Table 1 Primer Sequences

[0064] Primer name Primer sequence pgk V31I -UP-1F]]> gtcagcaaggccgaatttttc pgk V31I -UP-1R]]> aacgttccaatgaaagacggggaaAtaacagacgatacacgtatccgtgctg pgk V31I -DN-2F]]> cacggatacgtgtatcgtctgttaTttccccgtctttcattggaacgttaaagt pgk V31I -DN-2R]]> cgtttgcaaaagtacttaacga pgk V31L -UP-1R]]> aacgttccaatgaaagacggggaaCtaacagacgatacacgtatccgtgctg pgk V31L -DN-2F]]> cacggatacgtgtatcgtctgttaGttccccgtctttcattggaacgttaaagt pgk V31A -UP-1R]]> acgttccaatgaaagacggggaagCaacagacgatacacgtatccgtgctgc pgk V31A -DN-2F]]> gcacggatacgtgtatcgtctgttGcttccccgtctttcattggaacgttaaag pyrAB S160I -UP-1F]]> ctgaacaaacggaaatgtgac pyrAB S160I -UP-1R]]> acaatgacagggaatccaatttgaAtgacgaatttttctgcttcttcaaggg pyrAB S160I -DN-2F]]> ttgaagaagcagaaaaattcgtcaTtcaaattggattccctgtcattgtcc pyrAB S160I -DN-2R aactgtacgattccgaacagc pyrAB S160L -UP-1R]]> acaatgacagggaatccaatttgaAGgacgaatttttctgcttcttcaaggg pyrAB S160L -DN-2F]]> cttgaagaagcagaaaaattcgtcCTtcaaattggattccctgtcattgtcc pyrAB S160V -UP-1R]]> ggacaatgacagggaatccaatttgaACgacgaatttttctgcttcttcaag pyrAB S160V -DN-2F]]> cttgaagaagcagaaaaattcgtcGTtcaaattggattccctgtcattgtcc

[0065] The starting strain used in the following examples is B. subtilis A1 (hereinafter referred to as A1), which is a strain in which the upp gene is knocked out and the 116th proline of the purD gene encoding the glutamine nucleotide synthetase on the chromosome is mutated to leucine in B. subtilis 168. The strain can be constructed using conventional technical means in the art, and the specific construction method can be referred to in Chinese patent application CN201910599510.8.

[0066] Example 1: Construction of phosphoglycerate kinase mutant strain pgk V31I

[0067] The genomic DNA of strain B. subtilis A1 was used as a template, and two fragments were amplified using primers pgk V31I -UP-1F / pgk V31I -UP-1R and pgk V31I -DN-2F / pgk V31I -DN-2R, and Phusion ultra-fidelity polymerase (New England BioLabs) was used to amplify two fragments. The two fragments were fused using primers pgk V31I -UP-1F / pgk V31I -DN-2R, and the nucleotide sequence of the ORF region of the recombinant fragment is shown in SEQ ID NO. 4, and the amino acid sequence is shown in SEQ ID NO. 1. The pgk V31IThe fragment was assembled, transformed, and the like to obtain a recombinant plasmid pKSU-pgk after pKSU plasmid (pKSU plasmid was given by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production [J], Applied Microbiology and Biotechnology, 2014, 98(21): 8963-8973. Zhang W, Gao W, Feng J, et al DOI: 10.1007 / s00253-014-5824-2) was assembled, transformed, and the like. V31I The transformant was transformed into the B. subtilis A1 strain, and the transformant was screened on an LB plate containing 2.5 μg / mL chloramphenicol at 30°C. The obtained transformant was inoculated into 5 ml of LB liquid medium, cultured at 42°C and 200 rpm for 12 h, and subcultured once. The dilution was coated on an LB plate containing 5 μg / mL chloramphenicol to obtain a primary recombinant; the primary recombinant was inoculated into 5 ml of LB liquid medium, cultured at 42°C and 200 rpm for 12 h, and subcultured once. The dilution was coated on an LB plate containing 0.8 μM 5-FU to screen a secondary recombinant, and the pgk V31I point mutant strain was obtained, named B. subtilis A747, hereinafter referred to as V31I.

[0068] Example 2: Construction of phosphoglycerate kinase mutant strain pgk V31L and pgk V31A

[0069] The specific construction process is the same as that of Example 1, and the phosphoglycerate kinase mutant strain pgk V31L The primers used are pgk V31I -UP-1F / pgk V31L -UP-1R and pgk V31L -DN-2F / pgk V31I -DN-2R, and the nucleotide sequence of the obtained recombinant fragment ORF region is shown in SEQ ID NO. 5, and the amino acid sequence is shown in SEQ ID NO. 2. The obtained plasmid is pKSU-pgk V31L , and the obtained strain is named B. subtilis A748, hereinafter referred to as V31L.

[0070] Phosphoglycerate kinase mutant strain pgk V31A The primers used are pgk V31I-UP-1F / pgk V31A -UP-1R and pgk V31A -DN-2F / pgk V31I -DN-2R, the nucleotide sequence of the obtained recombinant fragment ORF region is shown as SEQ ID NO. 6, and the amino acid sequence is shown as SEQ ID NO. 3. The obtained plasmid is pKSU-pgk V31A , and the obtained strain is named B. subtilis A749, hereinafter referred to as V31A.

[0071] Example 3: Construction of pyrAB mutant strain of pyrimidine-specific carbamoyl phosphate synthetase S160L

[0072] The specific construction process is the same as that in Example 1, and the pyrAB mutant strain of pyrimidine-specific carbamoyl phosphate synthetase S160L The primers used are pyrAB S160I -UP-1F / pyrAB S160L -UP-1R and pyrAB S160L -DN-2F / pyrAB S160I -DN-2R, the nucleotide sequence of the obtained recombinant fragment ORF region is shown as SEQ ID NO. 10, and the amino acid sequence is shown as SEQ ID NO. 7. The obtained plasmid is pKSU-pyrAB S160L , and the obtained strain is named B. subtilis A711, hereinafter referred to as S160L. Example 4: Construction of pyrAB mutant strain of pyrimidine-specific carbamoyl phosphate synthetase S160V and pyrAB S160I

[0073] pyrAB mutant strain of pyrimidine-specific carbamoyl phosphate synthetase S160V The primers used are pyrAB S160I -UP-1F / pyrAB S160V -UP-1R and pyrAB S160V -DN-2F / pyrAB S160I -DN-2R, the nucleotide sequence of the obtained recombinant fragment ORF region is shown as SEQ ID NO. 11, and the amino acid sequence is shown as SEQ ID NO. 8. The obtained plasmid is pKSU-pgk V31V , and the obtained strain is named B. subtilis A712, hereinafter referred to as S160V.

[0074] pyrAB mutant strain of pyrimidine-specific carbamoyl phosphate synthetase S160I The primers used are pyrAB S160I -UP-1F / pyrAB S160I-UP-1R and pyrAB S160I -DN-2F / pyrAB S160I -DN-2R, the nucleotide sequence of the obtained recombinant fragment ORF region is shown as SEQ ID NO. 12, and the amino acid sequence is shown as SEQ ID NO. 9. The obtained plasmid is named as pKSU-pgk V31I , and the obtained strain is named as B. subtilis A713, hereinafter referred to as S160I.

[0075] Example 5: Construction of phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase double mutant strain

[0076] On the phosphoglycerate kinase mutant strain B. subtilis A747 (pgk V31I mutant), the pyrimidine-specific carbamoyl phosphate synthase mutant pyrAB S160L , pyrAB S160V , pyrAB S160I .

[0077] With the strain B. subtilis A747 genome as a template, the specific construction process is the same as that in Examples 3-4, and the obtained strains are named as B. subtilis A751, B. subtilis A752, and B. subtilis A753, hereinafter referred to as V31I-S160L, V31I-S160V, and V31I-S160I, respectively.

[0078] Example 6: Detection of production capacity of the engineering strain

[0079] The engineering strains constructed in Examples 1-5 were subjected to fermentation experiments, and their production performance was detected, as follows:

[0080] 1. Culture medium:

[0081] (1) Seed culture medium formula (g / L): glucose 20, yeast powder 5, corn syrup dry powder 5, potassium dihydrogen phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0-7.2, sterilized at 121°C for 20 min.

[0082] (2) Fermentation medium formula (g / L): glucose 60, yeast powder 3.5, potassium dihydrogen phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, monosodium glutamate 10, corn syrup dry powder 15, calcium carbonate 25, pH 7.0-7.2, sterilized at 121°C for 20 min.

[0083] 2. Culture method

[0084] (1) The strain was streaked on LB plates and incubated at 37°C overnight.

[0085] (2) Pick a single colony and inoculate it into 30 mL of seed culture medium. Incubate at 110 rpm and 36 °C for 7–8 h.

[0086] (3) Transfer 10% of the inoculum to 30 ml of fermentation medium, shake at 120 rpm, and incubate at 36°C for 36 h.

[0087] 3. Detection and Results

[0088] Nucleosides in the fermentation broth were detected using high performance liquid chromatography (HPLC). The OD of the fermented cells at 562 nm was detected using a spectrophotometer. Substrate transformation was detected and enzyme activity was calculated using in vitro enzyme reaction combined with HPLC. The results are shown in Table 2.

[0089] Table 2. Evaluation results of the production capacity of engineered bacteria in shake-flask fermentation (mean of three replicates)

[0090]

[0091] In Table 2, * indicates a significant difference compared to the results of the starting strain A1.

[0092] The above results indicate that phosphoglycerate kinase mutation (pgk) V31I pgk V31L and pgk V31A ), pyrimidine-specific carbamoyl phosphate synthase mutation (pyrAB) S160L pyrAB S160V and pyrAB S160I It promotes the production of both adenosine and inosine, and the combined effect of mutations in the two enzymes is even more pronounced, increasing adenosine production from 1.2 g / L to 3.1 g / L and inosine production from 0.4 g / L to 1.3 g / L.

[0093] Phosphoglycerate kinase mutant strain pgk V31I Compared with the starting strain A1, adenosine production increased from 1.2 g / L to 2.1 g / L, and inosine production increased from 0.4 g / L to 0.8 g / L. Mutations of the 31st amino acid in phosphoglycerate kinase from valine (V) to isoleucine (I), leucine (L), or alanine (A) all increased adenosine and inosine production, with the most significant effect observed after valine was mutated to isoleucine.

[0094] pyrAB, a mutant strain of pyrimidine-specific carbamoyl phosphate synthase S160LCompared with the starting strain A1, the adenosine yield is increased from 1.2 g / L to 2.5 g / L, and the inosine yield is increased from 0.4 g / L to 0.9 g / L. When the 160th amino acid of the pyrimidine-specific carbamoyl phosphate synthase is mutated from serine (S) to isoleucine (I), leucine (L) or valine (V), the adenosine and inosine yields are both greatly improved, indicating that the mutation site is beneficial to the production of adenosine and inosine.

[0095] Phosphoglycerate kinase mutation pgk V31I Pyrimidine-specific carbamoyl phosphate synthase mutation (pyrAB S160L , pyrAB S160V or pyrAB S160I ) superimposed, the adenosine and inosine yield is more prominent, and the best production effect is that the adenosine yield is increased from 1.2 g / L to 3.1 g / L, and the inosine yield is increased from 0.4 g / L to 1.3 g / L.

[0096] The construction of the strain of the present application is not limited by the order of the steps, and those skilled in the art can achieve the purpose of the present application according to the content disclosed in the present application, which belongs to the protection scope of the present application.

[0097] The strain codes in the present application, such as V31I, S160L and V31I-S160L, are for convenient description, but should not be understood as a limitation of the present application. The use of the engineering bacteria containing Bacillus subtilis phosphoglycerate kinase mutations pgk V31I , pgk V31L and pgk V31A , pyrimidine-specific carbamoyl phosphate synthase mutations pyrAB S160L , pyrAB S160V and pyrAB S160I constructed by the above method includes but is not limited to adenosine, inosine.

[0098] Although the present application has been described in detail above with general description and specific embodiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application. SEQUENCE LISTING <110> Meihua (Shanghai) Biotech Co., Ltd. <120> Protein mutant, recombinant microorganism for producing nucleoside and application thereof <130> KHP211118909.2 <160> 28 <170> SIPOSequenceListing 1.0 <210> 1 <211> 394 <212> PRT <213> Artificial Sequence <400> 1 Met Asn Lys Lys Thr Leu Lys Asp lie Asp Val Lys Gly Lys Val Val 1 5 10 15 Phe Cys Arg Val Asp Phe Asn Val Pro Met Lys Asp Gly Glu lie Thr 20 25 30 Asp Asp Thr Arg lie Arg Ala Ala Leu Pro Thr lie Lys His Leu Ala 35 40 45 Asp Gin Gly Ala Lys Val Leu Leu Ala Ser His Leu Gly Arg Pro Lys 50 55 60 Gly Glu Val Val Glu Glu Leu Arg Leu Thr Pro Val Ala Ala Arg Leu 65 70 75 80 Gly Glu Leu Leu Gly Lys Glu Val Lys Lys Ala Asp Glu Ala Tyr Gly 85 90 95 Asp Ala Val Lys Ala Gin lie Ser Glu Met Lys Asp Gly Asp Val Leu 100 105 110 Val Leu Glu Asn Val Arg Phe Tyr Pro Gly Glu Glu Lys Asn Asp Pro 115 120 125 Glu Leu Ala Lys Ala Phe Ala Glu Leu Ala Asp Val Tyr Val Asn Asp 130 135 140 Ala Phe Gly Ala Ala His Arg Ala His Ala Ser Thr Ala Gly Ile Ala 145 150 155 160 Glu His Leu Pro Ala Val Ala Gly Phe Leu Met Glu Lys Glu Leu Asp 165 170 175 Val Leu Gly Lys Ala Val Ser Asn Pro Asp Arg Pro Phe Thr Ala Ile 180 185 190 Ile Gly Gly Ala Lys Val Lys Asp Lys Ile Gly Val Ile Glu Ser Leu 195 200 205 Leu Asp Lys Val Asp Asn Leu Ile Ile Gly Gly Gly Leu Ala Tyr Thr 210 215 220 Phe Val Lys Ala Leu Gly Tyr Glu Val Gly Lys Ser Leu Leu Glu Glu 225 230 235 240 Asp Lys Ile Glu Leu Ala Lys Ser Phe Met Asp Arg Ala Lys Glu Lys 245 250 255 Gly Val Asn Phe Tyr Met Pro Glu Asp Val Leu Val Ala Asp Asp Phe 260 265 270 Ser Asn Asp Ala Asn Val Lys Ile Val Pro Ile Ser Glu Ile Pro Ser 275 280 285 Asp Leu Glu Ala Ile Asp Ile Gly Thr Lys Thr Arg Glu Thr Tyr Ala 290 295 300 Asp Val Ile Lys Asn Ser Lys Leu Val Val Trp Asn Gly Pro Met Gly 305 310 315 320 Val Phe Glu Ile Asp Leu Phe Ala Gln Gly Thr Lys Ala Val Ala Glu 325 330 335 Ala Leu Ala Glu Ala Lys Asp Thr Tyr Ser Val Ile Gly Gly Gly Asp 340 345 350 Ser Ala Ala Ala Val Glu Lys Phe Gly Leu Ala Asp Lys Met Ser His 355 360 365 Ile Ser Thr Gly Gly Gly Ala Ser Leu Glu Phe Met Glu Gly Lys Glu 370 375 380 Leu Pro Gly Val Ala Ala Leu Asn Asp Lys 385 390 <210> 2 <211> 394 <212> PRT <213> Artificial Sequence <400> 2 Met Asn Lys Lys Thr Leu Lys Asp Ile Asp Val Lys Gly Lys Val Val 1 5 10 15 Phe Cys Arg Val Asp Phe Asn Val Pro Met Lys Asp Gly Glu Leu Thr 20 25 30 Asp Asp Thr Arg Ile Arg Ala Ala Leu Pro Thr Ile Lys His Leu Ala 35 40 45 Asp Gln Gly Ala Lys Val Leu Leu Ala Ser His Leu Gly Arg Pro Lys 50 55 60 Gly Glu Val Val Glu Glu Leu Arg Leu Thr Pro Val Ala Ala Arg Leu 65 70 75 80 Gly Glu Leu Leu Gly Lys Glu Val Lys Lys Ala Asp Glu Ala Tyr Gly 85 90 95 Asp Ala Val Lys Ala Gln Ile Ser Glu Met Lys Asp Gly Asp Val Leu 100 105 110 Val Leu Glu Asn Val Arg Phe Tyr Pro Gly Glu Glu Lys Asn Asp Pro 115 120 125 Glu Leu Ala Lys Ala Phe Ala Glu Leu Ala Asp Val Tyr Val Asn Asp 130 135 140 Ala Phe Gly Ala Ala His Arg Ala His Ala Ser Thr Ala Gly Ile Ala 145 150 155 160 Glu His Leu Pro Ala Val Ala Gly Phe Leu Met Glu Lys Glu Leu Asp 165 170 175 Val Leu Gly Lys Ala Val Ser Asn Pro Asp Arg Pro Phe Thr Ala Ile 180 185 190 Ile Gly Gly Ala Lys Val Lys Asp Lys Ile Gly Val Ile Glu Ser Leu 195 200 205 Leu Asp Lys Val Asp Asn Leu Ile Ile Gly Gly Gly Leu Ala Tyr Thr 210 215 220 Phe Val Lys Ala Leu Gly Tyr Glu Val Gly Lys Ser Leu Leu Glu Glu 225 230 235 240 Asp Lys Ile Glu Leu Ala Lys Ser Phe Met Asp Arg Ala Lys Glu Lys 245 250 255 Gly Val Asn Phe Tyr Met Pro Glu Asp Val Leu Val Ala Asp Asp Phe 260 265 270 Ser Asn Asp Ala Asn Val Lys Ile Val Pro Ile Ser Glu Ile Pro Ser 275 280 285 Asp Leu Glu Ala Ile Asp Ile Gly Thr Lys Thr Arg Glu Thr Tyr Ala 290 295 300 Asp Val Ile Lys Asn Ser Lys Leu Val Val Trp Asn Gly Pro Met Gly 305 310 315 320 Val Phe Glu Ile Asp Leu Phe Ala Gln Gly Thr Lys Ala Val Ala Glu 325 330 335 Ala Leu Ala Glu Ala Lys Asp Thr Tyr Ser Val Ile Gly Gly Gly Asp 340 345 350 Ser Ala Ala Ala Val Glu Lys Phe Gly Leu Ala Asp Lys Met Ser His 355 360 365 Ile Ser Thr Gly Gly Gly Ala Ser Leu Glu Phe Met Glu Gly Lys Glu 370 375 380 Leu Pro Gly Val Ala Ala Leu Asn Asp Lys 385 390 <210> 3 <211> 394 <212> PRT <213> Artificial Sequence <400> 3 Met Asn Lys Lys Thr Leu Lys Asp Ile Asp Val Lys Gly Lys Val Val 1 5 10 15 Phe Cys Arg Val Asp Phe Asn Val Pro Met Lys Asp Gly Glu Ala Thr 20 25 30 Asp Asp Thr Arg Ile Arg Ala Ala Leu Pro Thr Ile Lys His Leu Ala 35 40 45 Asp Gln Gly Ala Lys Val Leu Leu Ala Ser His Leu Gly Arg Pro Lys 50 55 60 Gly Glu Val Val Glu Glu Leu Arg Leu Thr Pro Val Ala Ala Arg Leu 65 70 75 80 Gly Glu Leu Leu Gly Lys Glu Val Lys Lys Ala Asp Glu Ala Tyr Gly 85 90 95 Asp Ala Val Lys Ala Gln Ile Ser Glu Met Lys Asp Gly Asp Val Leu 100 105 110 Val Leu Glu Asn Val Arg Phe Tyr Pro Gly Glu Glu Lys Asn Asp Pro 115 120 125 Glu Leu Ala Lys Ala Phe Ala Glu Leu Ala Asp Val Tyr Val Asn Asp 130 135 140 Ala Phe Gly Ala Ala His Arg Ala His Ala Ser Thr Ala Gly Ile Ala 145 150 155 160 Glu His Leu Pro Ala Val Ala Gly Phe Leu Met Glu Lys Glu Leu Asp 165 170 175 Val Leu Gly Lys Ala Val Ser Asn Pro Asp Arg Pro Phe Thr Ala Ile 180 185 190 Ile Gly Gly Ala Lys Val Lys Asp Lys Ile Gly Val Ile Glu Ser Leu 195 200 205 Leu Asp Lys Val Asp Asn Leu Ile Ile Gly Gly Gly Leu Ala Tyr Thr 210 215 220 Phe Val Lys Ala Leu Gly Tyr Glu Val Gly Lys Ser Leu Leu Glu Glu 225 230 235 240 Asp Lys Ile Glu Leu Ala Lys Ser Phe Met Asp Arg Ala Lys Glu Lys 245 250 255 Gly Val Asn Phe Tyr Met Pro Glu Asp Val Leu Val Ala Asp Asp Phe 260 265 270 Ser Asn Asp Ala Asn Val Lys Ile Val Pro Ile Ser Glu Ile Pro Ser 275 280 285 Asp Leu Glu Ala Ile Asp Ile Gly Thr Lys Thr Arg Glu Thr Tyr Ala 290 295 300 Asp Val Ile Lys Asn Ser Lys Leu Val Val Trp Asn Gly Pro Met Gly 305 310 315 320 Val Phe Glu Ile Asp Leu Phe Ala Gln Gly Thr Lys Ala Val Ala Glu 325 330 335 Ala Leu Ala Glu Ala Lys Asp Thr Tyr Ser Val Ile Gly Gly Gly Asp 340 345 350 Ser Ala Ala Ala Val Glu Lys Phe Gly Leu Ala Asp Lys Met Ser His 355 360 365 Ile Ser Thr Gly Gly Gly Ala Ser Leu Glu Phe Met Glu Gly Lys Glu 370 375 380 Leu Pro Gly Val Ala Ala Leu Asn Asp Lys 385 390 <210> 4 <211> 1185 <212> DNA <213> Artificial Sequence <400> 4 atgaataaaa aaactctcaa agacatcgac gtaaaaggca aagttgtatt ctgccgcgtt 60 gactttaacg ttccaatgaa agacggggaa ataacagacg atacacgtat ccgtgctgcg 120 cttccaacaa tcaaacacct tgcagaccaa ggcgcaaaag tccttcttgc gagccactta 180 ggccgcccga aaggcgaagt ggttgaggag cttcgtttaa ctcctgtcgc tgcacgtctc 240 ggcgaactgc ttggcaaaga agtgaaaaaa gcggatgaag catacggcga tgctgtaaaa 300 gcacaaattt ctgagatgaa ggacggagac gttcttgtat tggaaaacgt acgtttctat 360 cctggtgaag agaaaaatga tcctgagctt gcaaaagcat ttgctgagct tgcagatgta 420 tatgtaaatg acgcattcgg tgctgcccac cgtgctcacg catctacagc tggaattgcc 480 gagcatctgc cagcagttgc aggtttctta atggaaaaag agcttgatgt acttggaaaa 540 gcggtttcca atcctgaccg cccgttcaca gcgatcatcg gcggagcgaa agtaaaagac 600 aaaatcggtg taatcgaaag tcttcttgat aaagtagaca acctgatcat cggcggaggt 660 cttgcttata ctttcgtaaa agcgcttggc tatgaagtcg ggaaatctct tcttgaagag 720 gataaaatcg agcttgcgaa atcatttatg gaccgcgcta aagaaaaagg cgttaacttc 780 tacatgcctg aagatgtact cgttgcagat gatttctcta acgatgcaaa cgtgaaaatt 840 gtgccgatct ctgaaatccc tagtgattta gaagcaatcg acattggtac gaaaacacgc 900 gaaacgtatg ctgacgtcat caaaaacagc aaacttgtcg tgtggaacgg accaatgggc 960 gtattcgaaa tcgacttgtt cgctcaagga acaaaagcgg ttgcggaagc attggcagag 1020 gcgaaagata catactctgt catcggcgga ggagactctg cggcagcggt tgaaaaattc 1080 ggccttgctg acaaaatgag ccacatctca acaggcggcg gcgcatccct tgagtttatg 1140 gaaggcaaag agcttccagg ggtagctgca ctgaacgata aataa 1185 <210> 5 <211> 1185 <212> DNA <213> Artificial Sequence <400> 5 atgaataaaa aaactctcaa agacatcgac gtaaaaggca aagttgtatt ctgccgcgtt 60 gactttaacg ttccaatgaa agacggggaa ctaacagacg atacacgtat ccgtgctgcg 120 cttccaacaa tcaaacacct tgcagaccaa ggcgcaaaag tccttcttgc gagccactta 180 ggccgcccga aaggcgaagt ggttgaggag cttcgtttaa ctcctgtcgc tgcacgtctc 240 ggcgaactgc ttggcaaaga agtgaaaaaa gcggatgaag catacggcga tgctgtaaaa 300 gcacaaattt ctgagatgaa ggacggagac gttcttgtat tggaaaacgt acgtttctat 360 cctggtgaag agaaaaatga tcctgagctt gcaaaagcat ttgctgagct tgcagatgta 420 tatgtaaatg acgcattcgg tgctgcccac cgtgctcacg catctacagc tggaattgcc 480 gagcatctgc cagcagttgc aggtttctta atggaaaaag agcttgatgt acttggaaaa 540 gcggtttcca atcctgaccg cccgttcaca gcgatcatcg gcggagcgaa agtaaaagac 600 aaaatcggtg taatcgaaag tcttcttgat aaagtagaca acctgatcat cggcggaggt 660 cttgcttata ctttcgtaaa agcgcttggc tatgaagtcg ggaaatctct tcttgaagag 720 gataaaatcg agcttgcgaa atcatttatg gaccgcgcta aagaaaaagg cgttaacttc 780 tacatgcctg aagatgtact cgttgcagat gatttctcta acgatgcaaa cgtgaaaatt 840 gtgccgatct ctgaaatccc tagtgattta gaagcaatcg acattggtac gaaaacacgc 900 gaaacgtatg ctgacgtcat caaaaacagc aaacttgtcg tgtggaacgg accaatgggc 960 gtattcgaaa tcgacttgtt cgctcaagga acaaaagcgg ttgcggaagc attggcagag 1020 gcgaaagata catactctgt catcggcgga ggagactctg cggcagcggt tgaaaaattc 1080 ggccttgctg acaaaatgag ccacatctca acaggcggcg gcgcatccct tgagtttatg 1140 gaaggcaaag agcttccagg ggtagctgca ctgaacgata aataa 1185 <210> 6 <211> 1185 <212> DNA <213> Artificial Sequence <400> 6 atgaataaaa aaactctcaa agacatcgac gtaaaaggca aagttgtatt ctgccgcgtt 60 gactttaacg ttccaatgaa agacggggaa gcaacagacg atacacgtat ccgtgctgcg 120 cttccaacaa tcaaacacct tgcagaccaa ggcgcaaaag tccttcttgc gagccactta 180 ggccgcccga aaggcgaagt ggttgaggag cttcgtttaa ctcctgtcgc tgcacgtctc 240 ggcgaactgc ttggcaaaga agtgaaaaaa gcggatgaag catacggcga tgctgtaaaa 300 gcacaaattt ctgagatgaa ggacggagac gttcttgtat tggaaaacgt acgtttctat 360 cctggtgaag agaaaaatga tcctgagctt gcaaaagcat ttgctgagct tgcagatgta 420 tatgtaaatg acgcattcgg tgctgcccac cgtgctcacg catctacagc tggaattgcc 480 gagcatctgc cagcagttgc aggtttctta atggaaaaag agcttgatgt acttggaaaa 540 gcggtttcca atcctgaccg cccgttcaca gcgatcatcg gcggagcgaa agtaaaagac 600 aaaatcggtg taatcgaaag tcttcttgat aaagtagaca acctgatcat cggcggaggt 660 cttgcttata ctttcgtaaa agcgcttggc tatgaagtcg ggaaatctct tcttgaagag 720 gataaaatcg agcttgcgaa atcatttatg gaccgcgcta aagaaaaagg cgttaacttc 780 tacatgcctg aagatgtact cgttgcagat gatttctcta acgatgcaaa cgtgaaaatt 840 gtgccgatct ctgaaatccc tagtgattta gaagcaatcg acattggtac gaaaacacgc 900 gaaacgtatg ctgacgtcat caaaaacagc aaacttgtcg tgtggaacgg accaatgggc 960 gtattcgaaa tcgacttgtt cgctcaagga acaaaagcgg ttgcggaagc attggcagag 1020 gcgaaagata catactctgt catcggcgga ggagactctg cggcagcggt tgaaaaattc 1080 ggccttgctg acaaaatgag ccacatctca acaggcggcg gcgcatccct tgagtttatg 1140 gaaggcaaag agcttccagg ggtagctgca ctgaacgata aataa 1185 <210> 7 <211> 1071 <212> PRT <213> Artificial Sequence <400> 7 Met Pro Lys Arg Val Asp Ile Asn Lys Ile Leu Val Ile Gly Ser Gly 1 5 10 15 Pro Ile Ile Ile Gly Gln Ala Ala Glu Phe Asp Tyr Ala Gly Thr Gln 20 25 30 Ala Cys Leu Ala Leu Lys Glu Glu Gly Tyr Glu Val Ile Leu Val Asn 35 40 45 Ser Asn Pro Ala Thr Ile Met Thr Asp Thr Glu Met Ala Asp Arg Val 50 55 60 Tyr Ile Glu Pro Leu Thr Pro Glu Phe Leu Thr Arg Ile Ile Arg Lys 65 70 75 80 Glu Arg Pro Asp Ala Ile Leu Pro Thr Leu Gly Gly Gln Thr Gly Leu 85 90 95 Asn Leu Ala Val Glu Leu Ser Glu Arg Gly Val Leu Ala Glu Cys Gly 100 105 110 Val Glu Val Leu Gly Thr Lys Leu Ser Ala Ile Gln Gln Ala Glu Asp 115 120 125 Arg Asp Leu Phe Arg Thr Leu Met Asn Glu Leu Asn Glu Pro Val Pro 130 135 140 Glu Ser Glu Ile Ile His Ser Leu Glu Glu Ala Glu Lys Phe Val Leu 145 150 155 160 Gln Ile Gly Phe Pro Val Ile Val Arg Pro Ala Tyr Thr Leu Gly Gly 165 170 175 Thr Gly Gly Gly Ile Cys Ser Asn Glu Thr Glu Leu Lys Glu Ile Val 180 185 190 Glu Asn Gly Leu Lys Leu Ser Pro Val His Gln Cys Leu Leu Glu Lys 195 200 205 Ser Ile Ala Gly Tyr Lys Glu Ile Glu Tyr Glu Val Met Arg Asp Ser 210 215 220 Gln Asp His Ala Ile Val Val Cys Asn Met Glu Asn Ile Asp Pro Val 225 230 235 240 Gly lie His Thr Gly Asp Ser lie Val Val Ala Pro Ser Gin Thr Leu 245 250 255 Ser Asp Arg Glu Tyr Gin Leu Leu Arg Asn Val Ser Leu Lys Leu lie 260 265 270 Arg Ala Leu Gly lie Glu Gly Gly Cys Asn Val Gin Leu Ala Leu Asp 275 280 285 Pro Asp Ser Phe Gin Tyr Tyr lie lie Glu Val Asn Pro Arg Val Ser 290 295 300 Arg Ser Ser Ala Leu Ala Ser Lys Ala Thr Gly Tyr Pro lie Ala Lys 305 310 315 320 Leu Ala Ala Lys lie Ala Val Gly Leu Ser Leu Asp Glu Met Met Asn 325 330 335 Pro Val Thr Gly Lys Thr Tyr Ala Ala Phe Glu Pro Ala Leu Asp Tyr 340 345 350 Val Val Ser Lys lie Pro Arg Trp Pro Phe Asp Lys Phe Glu Ser Ala 355 360 365 Asn Arg Lys Leu Gly Thr Gin Met Lys Ala Thr Gly Glu Val Met Ala 370 375 380 lie Gly Arg Thr Leu Glu Glu Ser Leu Leu Lys Ala Val Arg Ser Leu 385 390 395 400 Glu Ala Asp Val Tyr His Leu Glu Leu Lys Asp Ala Ala Asp Ile Ser 405 410 415 Asp Glu Leu Leu Glu Lys Arg Ile Lys Lys Ala Gly Asp Glu Arg Leu 420 425 430 Phe Tyr Leu Ala Glu Ala Tyr Arg Arg Gly Tyr Thr Val Glu Asp Leu 435 440 445 His Glu Phe Ser Ala Ile Asp Val Phe Phe Leu His Lys Leu Phe Gly 450 455 460 Ile Val Gln Phe Glu Lys Glu Leu Lys Ala Asn Ala Gly Asp Thr Asp 465 470 475 480 Val Leu Arg Arg Ala Lys Glu Leu Gly Phe Ser Asp Gln Tyr Ile Ser 485 490 495 Arg Glu Trp Lys Met Lys Glu Ser Glu Leu Tyr Ser Leu Arg Lys Gln 500 505 510 Ala Gly Ile Ala Pro Val Phe Lys Met Val Asp Thr Cys Ala Ala Glu 515 520 525 Phe Glu Ser Glu Thr Pro Tyr Phe Tyr Ser Thr Tyr Glu Glu Glu Asn 530 535 540 Glu Ser Val Val Thr Asp Lys Lys Ser Val Met Val Leu Gly Ser Gly 545 550 555 560 Pro Ile Arg Ile Gly Gin Gly Val Glu Phe Asp Tyr Ala Thr Val His 565 570 575 Ser Val Trp Ala Ile Lys Gin Ala Gly Tyr Glu Ala Ile Ile Val Asn 580 585 590 Asn Asn Pro Glu Thr Val Ser Thr Asp Phe Ser Ile Ser Asp Lys Leu 595 600 605 Tyr Phe Glu Pro Leu Thr Ile Glu Asp Val Met His Ile Ile Asp Leu 610 615 620 Glu Gin Pro Met Gly Val Val Val Gin Phe Gly Gly Gin Thr Ala Ile 625 630 635 640 Asn Leu Ala Asp Glu Leu Ser Ala Arg Gly Val Lys Ile Leu Gly Thr 645 650 655 Ser Leu Glu Asp Leu Asp Arg Ala Glu Asp Arg Asp Lys Phe Glu Gin 660 665 670 Ala Leu Gly Glu Leu Gly Val Pro Gin Pro Leu Gly Lys Thr Ala Thr 675 680 685 Ser Val Asn Gin Ala Val Ser Ile Ala Ser Asp Ile Gly Tyr Pro Val 690 695 700 Leu Val Arg Pro Ser Tyr Val Leu Gly Gly Arg Ala Met Glu Ile Val 705 710 715 720 Tyr His Glu Glu Glu Leu Leu His Tyr Met Lys Asn Ala Val Lys Ile 725 730 735 Asn Pro Gln His Pro Val Leu Ile Asp Arg Tyr Leu Thr Gly Lys Glu 740 745 750 Ile Glu Val Asp Ala Val Ser Asp Gly Glu Thr Val Val Ile Pro Gly 755 760 765 Ile Met Glu His Ile Glu Arg Ala Gly Val His Ser Gly Asp Ser Ile 770 775 780 Ala Val Tyr Pro Pro Gln Ser Leu Thr Glu Asp Ile Lys Lys Lys Ile 785 790 795 800 Glu Gln Tyr Thr Ile Ala Leu Ala Lys Gly Leu Asn Ile Val Gly Leu 805 810 815 Leu Asn Ile Gln Phe Val Leu Ser Gln Gly Glu Val Tyr Val Leu Glu 820 825 830 Val Asn Pro Arg Ser Ser Arg Thr Val Pro Phe Leu Ser Lys Ile Thr 835 840 845 Gly Ile Pro Met Ala Asn Leu Ala Thr Lys Ile Ile Leu Gly Gln Lys 850 855 860 Leu Ala Ala Phe Gly Tyr Thr Glu Gly Leu Gin Pro Glu Gin Gin Gly 865 870 875 880 Val Phe Val Lys Ala Pro Val Phe Ser Phe Ala Lys Leu Arg Arg Val 885 890 895 Asp He Thr Leu Gly Pro Glu Met Lys Ser Thr Gly Glu Val Met Gly 900 905 910 Lys Asp Ser Thr Leu Glu Lys Ala Leu Tyr Lys Ala Leu He Ala Ser 915 920 925 Gly He Gin He Pro Asn Tyr Gly Ser Val Leu Leu Thr Val Ala Asp 930 935 940 Lys Asp Lys Glu Glu Gly Leu Ala He Ala Lys Arg Phe His Ala He 945 950 955 960 Gly Tyr Asn He Leu Ala Thr Glu Gly Thr Ala Gly Tyr Leu Lys Glu 965 970 975 Ala Ser He Pro Ala Lys Val Val Gly Lys He Gly Gin Asp Gly Pro 980 985 990 Asn Leu Leu Asp Val He Arg Asn Gly Glu Ala Gin Phe Val He Asn 995 1000 1005 Thr Leu Thr Lys Gly Lys Gin Pro Ala Arg Asp Gly Phe Arg He Arg 1010 1015 1020 Arg Glu Ser Val Glu Asn Gly Val Ala Cys Leu Thr Ser Leu Asp Thr 1025 1030 1035 1040 Ala Glu Ala Ile Leu Arg Val Leu Glu Ser Met Thr Phe Arg Ala Asp 1045 1050 1055 Gln Met Pro Ala Val Asn Thr Asn Gln Glu Ala Ala Val Thr Ile 1060 1065 1070 <210> 8 <211> 1071 <212> PRT <213> Artificial Sequence <400> 8 Met Pro Lys Arg Val Asp Ile Asn Lys Ile Leu Val Ile Gly Ser Gly 1 5 10 15 Pro Ile Ile Ile Gly Gln Ala Ala Glu Phe Asp Tyr Ala Gly Thr Gln 20 25 30 Ala Cys Leu Ala Leu Lys Glu Glu Gly Tyr Glu Val Ile Leu Val Asn 35 40 45 Ser Asn Pro Ala Thr Ile Met Thr Asp Thr Glu Met Ala Asp Arg Val 50 55 60 Tyr Ile Glu Pro Leu Thr Pro Glu Phe Leu Thr Arg Ile Ile Arg Lys 65 70 75 80 Glu Arg Pro Asp Ala Ile Leu Pro Thr Leu Gly Gly Gln Thr Gly Leu 85 90 95 Asn Leu Ala Val Glu Leu Ser Glu Arg Gly Val Leu Ala Glu Cys Gly 100 105 110 Val Glu Val Leu Gly Thr Lys Leu Ser Ala Ile Gln Gln Ala Glu Asp 115 120 125 Arg Asp Leu Phe Arg Thr Leu Met Asn Glu Leu Asn Glu Pro Val Pro 130 135 140 Glu Ser Glu Ile Ile His Ser Leu Glu Glu Ala Glu Lys Phe Val Ile 145 150 155 160 Gln Ile Gly Phe Pro Val Ile Val Arg Pro Ala Tyr Thr Leu Gly Gly 165 170 175 Thr Gly Gly Gly Ile Cys Ser Asn Glu Thr Glu Leu Lys Glu Ile Val 180 185 190 Glu Asn Gly Leu Lys Leu Ser Pro Val His Gln Cys Leu Leu Glu Lys 195 200 205 Ser Ile Ala Gly Tyr Lys Glu Ile Glu Tyr Glu Val Met Arg Asp Ser 210 215 220 Gln Asp His Ala Ile Val Val Cys Asn Met Glu Asn Ile Asp Pro Val 225 230 235 240 Gly lie His Thr Gly Asp Ser lie Val Val Ala Pro Ser Gin Thr Leu 245 250 255 Ser Asp Arg Glu Tyr Gin Leu Leu Arg Asn Val Ser Leu Lys Leu lie 260 265 270 Arg Ala Leu Gly lie Glu Gly Gly Cys Asn Val Gin Leu Ala Leu Asp 275 280 285 Pro Asp Ser Phe Gin Tyr Tyr lie lie Glu Val Asn Pro Arg Val Ser 290 295 300 Arg Ser Ser Ala Leu Ala Ser Lys Ala Thr Gly Tyr Pro lie Ala Lys 305 310 315 320 Leu Ala Ala Lys lie Ala Val Gly Leu Ser Leu Asp Glu Met Met Asn 325 330 335 Pro Val Thr Gly Lys Thr Tyr Ala Ala Phe Glu Pro Ala Leu Asp Tyr 340 345 350 Val Val Ser Lys lie Pro Arg Trp Pro Phe Asp Lys Phe Glu Ser Ala 355 360 365 Asn Arg Lys Leu Gly Thr Gin Met Lys Ala Thr Gly Glu Val Met Ala 370 375 380 Ile Gly Arg Thr Leu Glu Glu Ser Leu Leu Lys Ala Val Arg Ser Leu 385 390 395 400 Glu Ala Asp Val Tyr His Leu Glu Leu Lys Asp Ala Ala Asp Ile Ser 405 410 415 Asp Glu Leu Leu Glu Lys Arg Ile Lys Lys Ala Gly Asp Glu Arg Leu 420 425 430 Phe Tyr Leu Ala Glu Ala Tyr Arg Arg Gly Tyr Thr Val Glu Asp Leu 435 440 445 His Glu Phe Ser Ala Ile Asp Val Phe Phe Leu His Lys Leu Phe Gly 450 455 460 Ile Val Gln Phe Glu Lys Glu Leu Lys Ala Asn Ala Gly Asp Thr Asp 465 470 475 480 Val Leu Arg Arg Ala Lys Glu Leu Gly Phe Ser Asp Gln Tyr Ile Ser 485 490 495 Arg Glu Trp Lys Met Lys Glu Ser Glu Leu Tyr Ser Leu Arg Lys Gln 500 505 510 Ala Gly Ile Ala Pro Val Phe Lys Met Val Asp Thr Cys Ala Ala Glu 515 520 525 Phe Glu Ser Glu Thr Pro Tyr Phe Tyr Ser Thr Tyr Glu Glu Glu Asn 530 535 540 Glu Ser Val Val Thr Asp Lys Lys Ser Val Met Val Leu Gly Ser Gly 545 550 555 560 Pro Ile Arg Ile Gly Gin Gly Val Glu Phe Asp Tyr Ala Thr Val His 565 570 575 Ser Val Trp Ala Ile Lys Gin Ala Gly Tyr Glu Ala Ile Ile Val Asn 580 585 590 Asn Asn Pro Glu Thr Val Ser Thr Asp Phe Ser Ile Ser Asp Lys Leu 595 600 605 Tyr Phe Glu Pro Leu Thr Ile Glu Asp Val Met His Ile Ile Asp Leu 610 615 620 Glu Gin Pro Met Gly Val Val Val Gin Phe Gly Gly Gin Thr Ala Ile 625 630 635 640 Asn Leu Ala Asp Glu Leu Ser Ala Arg Gly Val Lys Ile Leu Gly Thr 645 650 655 Ser Leu Glu Asp Leu Asp Arg Ala Glu Asp Arg Asp Lys Phe Glu Gin 660 665 670 Ala Leu Gly Glu Leu Gly Val Pro Gin Pro Leu Gly Lys Thr Ala Thr 675 680 685 Ser Val Asn Gin Ala Val Ser Ile Ala Ser Asp Ile Gly Tyr Pro Val 690 695 700 Leu Val Arg Pro Ser Tyr Val Leu Gly Gly Arg Ala Met Glu Ile Val 705 710 715 720 Tyr His Glu Glu Glu Leu Leu His Tyr Met Lys Asn Ala Val Lys Ile 725 730 735 Asn Pro Gln His Pro Val Leu Ile Asp Arg Tyr Leu Thr Gly Lys Glu 740 745 750 Ile Glu Val Asp Ala Val Ser Asp Gly Glu Thr Val Val Ile Pro Gly 755 760 765 Ile Met Glu His Ile Glu Arg Ala Gly Val His Ser Gly Asp Ser Ile 770 775 780 Ala Val Tyr Pro Pro Gln Ser Leu Thr Glu Asp Ile Lys Lys Lys Ile 785 790 795 800 Glu Gln Tyr Thr Ile Ala Leu Ala Lys Gly Leu Asn Ile Val Gly Leu 805 810 815 Leu Asn Ile Gln Phe Val Leu Ser Gln Gly Glu Val Tyr Val Leu Glu 820 825 830 Val Asn Pro Arg Ser Ser Arg Thr Val Pro Phe Leu Ser Lys Ile Thr 835 840 845 Gly Ile Pro Met Ala Asn Leu Ala Thr Lys Ile Ile Leu Gly Gln Lys 850 855 860 Leu Ala Ala Phe Gly Tyr Thr Glu Gly Leu Gin Pro Glu Gin Gin Gly 865 870 875 880 Val Phe Val Lys Ala Pro Val Phe Ser Phe Ala Lys Leu Arg Arg Val 885 890 895 Asp He Thr Leu Gly Pro Glu Met Lys Ser Thr Gly Glu Val Met Gly 900 905 910 Lys Asp Ser Thr Leu Glu Lys Ala Leu Tyr Lys Ala Leu He Ala Ser 915 920 925 Gly He Gin He Pro Asn Tyr Gly Ser Val Leu Leu Thr Val Ala Asp 930 935 940 Lys Asp Lys Glu Glu Gly Leu Ala He Ala Lys Arg Phe His Ala He 945 950 955 960 Gly Tyr Asn He Leu Ala Thr Glu Gly Thr Ala Gly Tyr Leu Lys Glu 965 970 975 Ala Ser He Pro Ala Lys Val Val Gly Lys He Gly Gin Asp Gly Pro 980 985 990 Asn Leu Leu Asp Val He Arg Asn Gly Glu Ala Gin Phe Val He Asn 995 1000 1005 Thr Leu Thr Lys Gly Lys Gin Pro Ala Arg Asp Gly Phe Arg He Arg 1010 1015 1020 Arg Glu Ser Val Glu Asn Gly Val Ala Cys Leu Thr Ser Leu Asp Thr 1025 1030 1035 1040 Ala Glu Ala Ile Leu Arg Val Leu Glu Ser Met Thr Phe Arg Ala Asp 1045 1050 1055 Gln Met Pro Ala Val Asn Thr Asn Gln Glu Ala Ala Val Thr Ile 1060 1065 1070 <210> 9 <211> 1071 <212> PRT <213> Artificial Sequence <400> 9 Met Pro Lys Arg Val Asp Ile Asn Lys Ile Leu Val Ile Gly Ser Gly 1 5 10 15 Pro Ile Ile Ile Gly Gln Ala Ala Glu Phe Asp Tyr Ala Gly Thr Gln 20 25 30 Ala Cys Leu Ala Leu Lys Glu Glu Gly Tyr Glu Val Ile Leu Val Asn 35 40 45 Ser Asn Pro Ala Thr Ile Met Thr Asp Thr Glu Met Ala Asp Arg Val 50 55 60 Tyr Ile Glu Pro Leu Thr Pro Glu Phe Leu Thr Arg Ile Ile Arg Lys 65 70 75 80 Glu Arg Pro Asp Ala Ile Leu Pro Thr Leu Gly Gly Gln Thr Gly Leu 85 90 95 Asn Leu Ala Val Glu Leu Ser Glu Arg Gly Val Leu Ala Glu Cys Gly 100 105 110 Val Glu Val Leu Gly Thr Lys Leu Ser Ala Ile Gln Gln Ala Glu Asp 115 120 125 Arg Asp Leu Phe Arg Thr Leu Met Asn Glu Leu Asn Glu Pro Val Pro 130 135 140 Glu Ser Glu Ile Ile His Ser Leu Glu Glu Ala Glu Lys Phe Val Val 145 150 155 160 Gln Ile Gly Phe Pro Val Ile Val Arg Pro Ala Tyr Thr Leu Gly Gly 165 170 175 Thr Gly Gly Gly Ile Cys Ser Asn Glu Thr Glu Leu Lys Glu Ile Val 180 185 190 Glu Asn Gly Leu Lys Leu Ser Pro Val His Gln Cys Leu Leu Glu Lys 195 200 205 Ser Ile Ala Gly Tyr Lys Glu Ile Glu Tyr Glu Val Met Arg Asp Ser 210 215 220 Gln Asp His Ala Ile Val Val Cys Asn Met Glu Asn Ile Asp Pro Val 225 230 235 240 Gly Ile His Thr Gly Asp Ser Ile Val Val Ala Pro Ser Gin Thr Leu 245 250 255 Ser Asp Arg Glu Tyr Gin Leu Leu Arg Asn Val Ser Leu Lys Leu Ile 260 265 270 Arg Ala Leu Gly Ile Glu Gly Gly Cys Asn Val Gin Leu Ala Leu Asp 275 280 285 Pro Asp Ser Phe Gin Tyr Tyr Ile Ile Glu Val Asn Pro Arg Val Ser 290 295 300 Arg Ser Ser Ala Leu Ala Ser Lys Ala Thr Gly Tyr Pro Ile Ala Lys 305 310 315 320 Leu Ala Ala Lys Ile Ala Val Gly Leu Ser Leu Asp Glu Met Met Asn 325 330 335 Pro Val Thr Gly Lys Thr Tyr Ala Ala Phe Glu Pro Ala Leu Asp Tyr 340 345 350 Val Val Ser Lys Ile Pro Arg Trp Pro Phe Asp Lys Phe Glu Ser Ala 355 360 365 Asn Arg Lys Leu Gly Thr Gin Met Lys Ala Thr Gly Glu Val Met Ala 370 375 380 Ile Gly Arg Thr Leu Glu Glu Ser Leu Leu Lys Ala Val Arg Ser Leu 385 390 395 400 Glu Ala Asp Val Tyr His Leu Glu Leu Lys Asp Ala Ala Asp Ile Ser 405 410 415 Asp Glu Leu Leu Glu Lys Arg Ile Lys Lys Ala Gly Asp Glu Arg Leu 420 425 430 Phe Tyr Leu Ala Glu Ala Tyr Arg Arg Gly Tyr Thr Val Glu Asp Leu 435 440 445 His Glu Phe Ser Ala Ile Asp Val Phe Phe Leu His Lys Leu Phe Gly 450 455 460 Ile Val Gln Phe Glu Lys Glu Leu Lys Ala Asn Ala Gly Asp Thr Asp 465 470 475 480 Val Leu Arg Arg Ala Lys Glu Leu Gly Phe Ser Asp Gln Tyr Ile Ser 485 490 495 Arg Glu Trp Lys Met Lys Glu Ser Glu Leu Tyr Ser Leu Arg Lys Gln 500 505 510 Ala Gly Ile Ala Pro Val Phe Lys Met Val Asp Thr Cys Ala Ala Glu 515 520 525 Phe Glu Ser Glu Thr Pro Tyr Phe Tyr Ser Thr Tyr Glu Glu Glu Asn 530 535 540 Glu Ser Val Val Thr Asp Lys Lys Ser Val Met Val Leu Gly Ser Gly 545 550 555 560 Pro Ile Arg Ile Gly Gin Gly Val Glu Phe Asp Tyr Ala Thr Val His 565 570 575 Ser Val Trp Ala Ile Lys Gin Ala Gly Tyr Glu Ala Ile Ile Val Asn 580 585 590 Asn Asn Pro Glu Thr Val Ser Thr Asp Phe Ser Ile Ser Asp Lys Leu 595 600 605 Tyr Phe Glu Pro Leu Thr Ile Glu Asp Val Met His Ile Ile Asp Leu 610 615 620 Glu Gin Pro Met Gly Val Val Val Gin Phe Gly Gly Gin Thr Ala Ile 625 630 635 640 Asn Leu Ala Asp Glu Leu Ser Ala Arg Gly Val Lys Ile Leu Gly Thr 645 650 655 Ser Leu Glu Asp Leu Asp Arg Ala Glu Asp Arg Asp Lys Phe Glu Gin 660 665 670 Ala Leu Gly Glu Leu Gly Val Pro Gin Pro Leu Gly Lys Thr Ala Thr 675 680 685 Ser Val Asn Gin Ala Val Ser Ile Ala Ser Asp Ile Gly Tyr Pro Val 690 695 700 Leu Val Arg Pro Ser Tyr Val Leu Gly Gly Arg Ala Met Glu Ile Val 705 710 715 720 Tyr His Glu Glu Glu Leu Leu His Tyr Met Lys Asn Ala Val Lys Ile 725 730 735 Asn Pro Gln His Pro Val Leu Ile Asp Arg Tyr Leu Thr Gly Lys Glu 740 745 750 Ile Glu Val Asp Ala Val Ser Asp Gly Glu Thr Val Val Ile Pro Gly 755 760 765 Ile Met Glu His Ile Glu Arg Ala Gly Val His Ser Gly Asp Ser Ile 770 775 780 Ala Val Tyr Pro Pro Gln Ser Leu Thr Glu Asp Ile Lys Lys Lys Ile 785 790 795 800 Glu Gln Tyr Thr Ile Ala Leu Ala Lys Gly Leu Asn Ile Val Gly Leu 805 810 815 Leu Asn Ile Gln Phe Val Leu Ser Gln Gly Glu Val Tyr Val Leu Glu 820 825 830 Val Asn Pro Arg Ser Ser Arg Thr Val Pro Phe Leu Ser Lys Ile Thr 835 840 845 Gly Ile Pro Met Ala Asn Leu Ala Thr Lys Ile Ile Leu Gly Gln Lys 850 855 860 Leu Ala Ala Phe Gly Tyr Thr Glu Gly Leu Gin Pro Glu Gin Gin Gly 865 870 875 880 Val Phe Val Lys Ala Pro Val Phe Ser Phe Ala Lys Leu Arg Arg Val 885 890 895 Asp He Thr Leu Gly Pro Glu Met Lys Ser Thr Gly Glu Val Met Gly 900 905 910 Lys Asp Ser Thr Leu Glu Lys Ala Leu Tyr Lys Ala Leu He Ala Ser 915 920 925 Gly He Gin He Pro Asn Tyr Gly Ser Val Leu Leu Thr Val Ala Asp 930 935 940 Lys Asp Lys Glu Glu Gly Leu Ala He Ala Lys Arg Phe His Ala He 945 950 955 960 Gly Tyr Asn He Leu Ala Thr Glu Gly Thr Ala Gly Tyr Leu Lys Glu 965 970 975 Ala Ser He Pro Ala Lys Val Val Gly Lys He Gly Gin Asp Gly Pro 980 985 990 Asn Leu Leu Asp Val He Arg Asn Gly Glu Ala Gin Phe Val He Asn 995 1000 1005 Thr Leu Thr Lys Gly Lys Gin Pro Ala Arg Asp Gly Phe Arg He Arg 1010 1015 1020 Arg Glu Ser Val Glu Asn Gly Val Ala Cys Leu Thr Ser Leu Asp Thr 1025 1030 1035 1040 Ala Glu Ala Ile Leu Arg Val Leu Glu Ser Met Thr Phe Arg Ala Asp 1045 1050 1055 Gln Met Pro Ala Val Asn Thr Asn Gln Glu Ala Ala Val Thr Ile 1060 1065 1070 <210> 10 <211> 3216 <212> DNA <213> Artificial Sequence <400> 10 atgccaaaac gcgtagacat taacaaaatt ttagtaatcg gatctggacc gatcatcatc 60 ggccaagcag cagaatttga ctatgcggga acacaagcct gtcttgcttt gaaagaagaa 120 ggctatgaag tcatccttgt caactcaaac cctgcaacga tcatgacaga tacagaaatg 180 gctgaccggg tttacatcga accgctcaca cctgaattcc tgacacgaat catcagaaaa 240 gagcgcccgg atgccattct tcctacactc ggaggccaaa ccggtttgaa tcttgcggtt 300 gagctttctg aaagaggcgt tttggcagaa tgcggcgtcg aagtgcttgg cacgaaactg 360 gagctttctg aaagaggcgt tttggcagaa tgcggcgtcg aagtgcttgg cacgaaactg 360tctgcgattc agcaagctga agaccgtgac ttgttcagaa cattaatgaa tgaactgaat 420 gaaccggtgc ctgaaagtga gattatccac tcccttgaag aagcagaaaa attcgtcctt 480 caaattggat tccctgtcat tgtccgcccg gcatatacat taggcggaac aggcggaggc 540 atctgctcga atgaaacaga gctaaaagaa atcgttgaga acggcttgaa attaagcccg 600 gtacaccaat gtctgcttga aaaaagcatc gccggctata aagaaatcga gtatgaagtc 660 atgagagaca gccaggatca cgccattgtc gtttgtaaca tggaaaacat tgatccagtt 720 ggaatccata ctggagacag tattgttgtc gcgccgagcc aaacgctcag cgatcgcgaa 780 tatcagctct tgcggaatgt atcgttaaaa ctgattcgcg cgcttgggat cgaaggcgga 840 tgtaatgtcc agctcgcctt agatccagac agcttccaat attacattat tgaagtaaat 900 ccgcgtgtca gccgttcatc tgcccttgca tcaaaagcaa cggggtaccc gattgcaaag 960 ctcgctgcta aaattgcagt cggactttca ttagatgaaa tgatgaaccc ggtgacagga 1020 aaaacatatg cagcatttga acctgctctt gactatgtcg tatccaaaat tccgcgctgg 1080 ccgtttgata agtttgaatc agcaaacaga aagcttggca cgcaaatgaa agcgacaggt 1140 gaggtcatgg caatcggccg cacgcttgaa gagtcattgc tgaaggcagt gcgatcactg 1200 gaagcggatg tgtatcatct tgaattgaag gacgccgctg acatttcaga tgagcttctt 1260 gaaaagcgaa ttaaaaaggc cggtgatgaa cgcttattct acttagctga agcgtacaga 1320 agaggctaca cggtagaaga cctccatgaa ttttccgcta tcgatgtctt cttcttgcat 1380 aagctgttcg gaatcgtaca gtttgaaaaa gaattgaagg ccaatgcggg cgatacagat 1440 gtgctgagac gggcaaaaga actcggcttc tctgatcagt acatcagccg tgaatggaaa 1500 atgaaagaat ctgagcttta cagcttgaga aaacaagcgg ggattgcgcc ggtattcaaa 1560 atggtagata catgcgcggc ggaatttgag tcagaaacgc catacttcta tagcacatat 1620 gaagaagaaa atgaatctgt cgttacagat aagaaaagtg tgatggtgct tggttcgggt 1680 ccgattcgaa tcggtcaggg tgtcgagttc gactatgcga cggttcactc tgtatgggca 1740 attaaacaag caggctatga agccattatt gtcaacaaca acccggaaac cgtttcaaca 1800 gacttcagca tctcagacaa gctgtatttt gaaccgctta cgattgaaga tgtcatgcac 1860 atcattgacc tcgaacagcc aatgggcgtt gtcgtacaat ttggcggaca aactgcgatt 1920 aaccttgctg acgagctttc tgcacgcgga gtgaaaatcc ttggaacttc attagaagat 1980 ttagaccgtg ccgaagaccg ggataaattt gaacaagcgc ttggagaact tggtgttcct 2040 cagccgcttg gcaaaacagc gacatcagtt aatcaggcgg taagcatcgc aagtgatatc 2100 ggttatccgg tactggtacg cccttcctat gtacttggcg gccgggcgat ggagattgtt 2160 taccatgaag aggaactgct tcattacatg aaaaatgcag tcaaaatcaa tccacagcac 2220 cctgtattaa ttgatagata cttgaccgga aaagaaattg aagtcgatgc agtatccgac 2280 ggtgaaacag tcgtcattcc gggaattatg gagcacattg aacgtgcggg cgttcactcc 2340 ggagactcaa tcgctgttta tccgcctcag tctctcacag aggacattaa gaaaaaaatt 2400 gaacaataca cgatcgcatt ggctaaaggg ctgaatattg tcggtttgct caatattcaa 2460 ttcgtcttgt cgcaaggcga ggtgtacgtg ctagaagtga atccgagatc aagcagaacc 2520 gtaccgtttt taagcaaaat tacgggtatc ccaatggcga atctcgcaac aaaaatcatt 2580 cttggtcaaa agctggctgc gtttggctat acagagggcc ttcagcctga acagcaaggt 2640 gtatttgtaa aagcgccggt cttctccttt gccaagctga gaagagtgga tattacgtta 2700 gggcctgaaa tgaaatcaac aggtgaagtc atggggaaag attcgacact tgaaaaggcg 2760 ctctacaaag ccttgatcgc ttcaggtatt caaatcccga actacggttc cgtgctttta 2820 acagtagctg ataaggacaa agaagaaggg cttgccattg ctaagcggtt ccacgcgatc 2880 ggctacaaca ttttagcgac ggaaggaacg gcaggctacc tgaaagaagc ttccattcca 2940 gcgaaggtcg tcggaaaaat cggtcaggat ggcccgaact tgcttgatgt catcagaaac 3000 ggagaagcgc agtttgtcat caatacgctg acaaaaggaa agcagccggc aagagacggt 3060 tttagaatca gacgtgaatc agtagaaaat ggtgttgcct gcctaacatc tttagatacg 3120 gcagaggcga tattgcgagt gctggaaagc atgacattcc gtgctgatca aatgccggca 3180 gtcaacacaa atcaggaggc ggcagtcact atatga 3216 <210> 11 <211> 3216 <212> DNA <213> Artificial Sequence <400> 11 atgccaaaac gcgtagacat taacaaaatt ttagtaatcg gatctggacc gatcatcatc 60 ggccaagcag cagaatttga ctatgcggga acacaagcct gtcttgcttt gaaagaagaa 120 ggctatgaag tcatccttgt caactcaaac cctgcaacga tcatgacaga tacagaaatg 180 gctgaccggg tttacatcga accgctcaca cctgaattcc tgacacgaat catcagaaaa 240 gagcgcccgg atgccattct tcctacactc ggaggccaaa ccggtttgaa tcttgcggtt 300 gagctttctg aaagaggcgt tttggcagaa tgcggcgtcg aagtgcttgg cacgaaactg 360 tctgcgattc agcaagctga agaccgtgac ttgttcagaa cattaatgaa tgaactgaat 420 gaaccggtgc ctgaaagtga gattatccac tcccttgaag aagcagaaaa attcgtcatt 480 caaattggat tccctgtcat tgtccgcccg gcatatacat taggcggaac aggcggaggc 540 atctgctcga atgaaacaga gctaaaagaa atcgttgaga acggcttgaa attaagcccg 600 gtacaccaat gtctgcttga aaaaagcatc gccggctata aagaaatcga gtatgaagtc 660 atgagagaca gccaggatca cgccattgtc gtttgtaaca tggaaaacat tgatccagtt 720 ggaatccata ctggagacag tattgttgtc gcgccgagcc aaacgctcag cgatcgcgaa 780 tatcagctct tgcggaatgt atcgttaaaa ctgattcgcg cgcttgggat cgaaggcgga 840 tgtaatgtcc agctcgcctt agatccagac agcttccaat attacattat tgaagtaaat 900 ccgcgtgtca gccgttcatc tgcccttgca tcaaaagcaa cggggtaccc gattgcaaag 960 ctcgctgcta aaattgcagt cggactttca ttagatgaaa tgatgaaccc ggtgacagga 1020 aaaacatatg cagcatttga acctgctctt gactatgtcg tatccaaaat tccgcgctgg 1080 ccgtttgata agtttgaatc agcaaacaga aagcttggca cgcaaatgaa agcgacaggt 1140 gaggtcatgg caatcggccg cacgcttgaa gagtcattgc tgaaggcagt gcgatcactg 1200 gaagcggatg tgtatcatct tgaattgaag gacgccgctg acatttcaga tgagcttctt 1260 gaaaagcgaa ttaaaaaggc cggtgatgaa cgcttattct acttagctga agcgtacaga 1320 agaggctaca cggtagaaga cctccatgaa ttttccgcta tcgatgtctt cttcttgcat 1380 aagctgttcg gaatcgtaca gtttgaaaaa gaattgaagg ccaatgcggg cgatacagat 1440 gtgctgagac gggcaaaaga actcggcttc tctgatcagt acatcagccg tgaatggaaa 1500 atgaaagaat ctgagcttta cagcttgaga aaacaagcgg ggattgcgcc ggtattcaaa 1560 atggtagata catgcgcggc ggaatttgag tcagaaacgc catacttcta tagcacatat 1620 gaagaagaaa atgaatctgt cgttacagat aagaaaagtg tgatggtgct tggttcgggt 1680 ccgattcgaa tcggtcaggg tgtcgagttc gactatgcga cggttcactc tgtatgggca 1740 attaaacaag caggctatga agccattatt gtcaacaaca acccggaaac cgtttcaaca 1800 gacttcagca tctcagacaa gctgtatttt gaaccgctta cgattgaaga tgtcatgcac 1860 atcattgacc tcgaacagcc aatgggcgtt gtcgtacaat ttggcggaca aactgcgatt 1920 aaccttgctg acgagctttc tgcacgcgga gtgaaaatcc ttggaacttc attagaagat 1980 ttagaccgtg ccgaagaccg ggataaattt gaacaagcgc ttggagaact tggtgttcct 2040 cagccgcttg gcaaaacagc gacatcagtt aatcaggcgg taagcatcgc aagtgatatc 2100 ggttatccgg tactggtacg cccttcctat gtacttggcg gccgggcgat ggagattgtt 2160 taccatgaag aggaactgct tcattacatg aaaaatgcag tcaaaatcaa tccacagcac 2220 cctgtattaa ttgatagata cttgaccgga aaagaaattg aagtcgatgc agtatccgac 2280 ggtgaaacag tcgtcattcc gggaattatg gagcacattg aacgtgcggg cgttcactcc 2340 ggagactcaa tcgctgttta tccgcctcag tctctcacag aggacattaa gaaaaaaatt 2400 gaacaataca cgatcgcatt ggctaaaggg ctgaatattg tcggtttgct caatattcaa 2460 ttcgtcttgt cgcaaggcga ggtgtacgtg ctagaagtga atccgagatc aagcagaacc 2520 gtaccgtttt taagcaaaat tacgggtatc ccaatggcga atctcgcaac aaaaatcatt 2580 cttggtcaaa agctggctgc gtttggctat acagagggcc ttcagcctga acagcaaggt 2640 gtatttgtaa aagcgccggt cttctccttt gccaagctga gaagagtgga tattacgtta 2700 gggcctgaaa tgaaatcaac aggtgaagtc atggggaaag attcgacact tgaaaaggcg 2760 ctctacaaag ccttgatcgc ttcaggtatt caaatcccga actacggttc cgtgctttta 2820 GCTGGAGTGG ATTTGGCTTA TGGTTGGGTA TATGTTGGAA TATGTTGGAA TATGTTGG 180 GGCTACAACATTTTAGCGACGGAAGGAACGGCAGGCTACCTGAAAGAAGCTTCCAT TCCA 2940 GCGAAGGTCGTCGGAAAAATCGGTCAGGATGGCCC GAAC TTGCTTGATGTCATCAGAAAC 3000 GGAGAAGCGCAGTTTGTGTATCAATACGCTGACAAAAGGAAGCAGCCGGCAAGAGACGGT 3060 TTTAGAATCAGACGTGAA TCAGTAGAAAATG GTGTTGCCTGCCTAACATCTT TAGATA CG 3120 GCAGAGGCGATATTGCGAGTGCTGGAAGCATGACATTCCTGCTGATCAAATGCCGGCA 3180 GTCAACACAAATCAGGAGGCGGCAGTCAC TATATGA 3216 <210> 12 <211> 3216 <212> DNA <213> Artificial Sequence <400> 12 ATGCCAAAACGCGTAGACATTAACAAAATTTTAGTAATCGGATCTGGACCGATCATCATC 60 GGCCAAGCAGCAGAATTTGACTATGCGGGAACACAAGCCTGTCTTGCTTTGAAAGAAGAA 120 GGCTATGAAGT CATCCTTGTC AACTCAAACCCTGCAACGATCATGACAGATACAGAAATG 180 GCTGACCGGGTTACATCGAA CC GCTCACA CCTGAATT CCTGACACGAATCATCAGAAAA 240 GAGCGCCCgg ATGCCATTC TCTCTACACT Cgg AGGcc AAAcc GGTtt GAA TCTTGCgg T 300 GAGCTTTCTG AAAGAGGCtt TGGCAGAAT GCgg Cgt Cg AAGTGCtt GGCACGAAAC 360 TCTGCGATTC AGCAAGCTGA AGACCgt GAC TGTTCAGAAC TATTAATGA TGAACt GAAT 420 GAACCGGTGC CTGAAAGTGA GATTATCCAC TCCCTTGAAG AAGCAGAAAA ATCgt Cgt T 480 CAAATTTGAT TCCCTGTCA TTTGTCCGCC CGGcat ATACAT TATGGCgg AACAGGCgg AGG 540 ATCTGCTCGA ATGAAACAGA GCTAAAAGAA ATCgt TGA GAACGGCTT GAA ATTAAGCCCG 600 GTACACC AAT GTCTGCTTGA AAAAGCATC GCCGGCTATA AAGAAATCg AGTATGAAGTC 660 ATGAGAGACAGCCAGGATCACGCCATTTGTCTTTGTAACATGGAAAACATTGATCCAGTT 720 GGAA TCC ATACTGGAGACAGTATTGTTGT CGCGCCGAGCC AAACGCTCAG CGATCg Cg AA 780 TATCAGCTCTTGCgGAATGTATCgt TAAACTGATTCg Cg CTTGGGATCg AAGGCg GA 840 TGTAATGTCCAGCTCgCCTT AGATCCAGAC AGCTTCCAA TATTACATTA TTGAAGTAAAT 900 CCGCgt GTCA GCCGTT CATCTGCCCTTGC ATCAAAGCAA Cgg GGTACCC GATTGCAAAG 960 ctcgctgcta aaattgcagt cggactttca ttagatgaaa tgatgaaccc ggtgacagga 1020 aaaacatatg cagcatttga acctgctctt gactatgtcg tatccaaaat tccgcgctgg 1080 ccgtttgata agtttgaatc agcaaacaga aagcttggca cgcaaatgaa agcgacaggt 1140 gaggtcatgg caatcggccg cacgcttgaa gagtcattgc tgaaggcagt gcgatcactg 1200 gaagcggatg tgtatcatct tgaattgaag gacgccgctg acatttcaga tgagcttctt 1260 gaaaagcgaa ttaaaaaggc cggtgatgaa cgcttattct acttagctga agcgtacaga 1320 agaggctaca cggtagaaga cctccatgaa ttttccgcta tcgatgtctt cttcttgcat 1380 aagctgttcg gaatcgtaca gtttgaaaaa gaattgaagg ccaatgcggg cgatacagat 1440 gtgctgagac gggcaaaaga actcggcttc tctgatcagt acatcagccg tgaatggaaa 1500 atgaaagaat ctgagcttta cagcttgaga aaacaagcgg ggattgcgcc ggtattcaaa 1560 atggtagata catgcgcggc ggaatttgag tcagaaacgc catacttcta tagcacatat 1620 gaagaagaaa atgaatctgt cgttacagat aagaaaagtg tgatggtgct tggttcgggt 1680 CCGATTCGAA TCGGTCAGGG TGT CGAGTT CG ACT AT GCGA CG GTTC ACTC GT ATGGGCA 1740 ATTAACAAGC AGGCTATGAA GCCATTATGT CAACAACAAC CCGGAAACCG TTTC AACA 1800 GACTTCAGCA TCTCAGACAA GCTGTATTTT GAACC GCTTACGT TTGAAGATGC ATGCAC 1860 ATCATTGACC TC GAAC AGCC AATGGGC GTT GT CGT ACAATT TGGCGGACAA ACTGC GATT 1920 AACCTTGCTG ACGAGCTTTCT GCACGCGGAG T GAAAATCCTT GGAAC TTC ATTAGAAGAT 1980 TTAGACC GTGCCGAAGACC GGGATAAATTT GAACAAGCGC TTGGAGAECTT GGTGTT CCT 2040 CAGCCGCTTGG CAAAACAGCG ACATCAGTTA ATCAGGCGGT AAGCATCGCA AGTGATATC 2100 GGTTATCCGG TACTGGTACG CCCTTCCTAT GTACTTGGCG GCCGGGC GAT GGAGATT GTT 2160 TACCATGAAG AGGAAC T GC TTC ATT ACATG AAAAATGCAG TCAAAATCAA TCCACAGCAC 2220 CCTGTATTAA TTGATAGATA CTTGACC G GAAA GAAATTG AAGTC GATGC AGT ATCCGAC 2280 GGTGAAACAG TCGTCATCCC GGGAATTATG GAGCACATTG AACGTGC GGC GTTC ACTCC 2340 GGAGACTCAATCGCTGTTATCCGCCTCAGTCTCTCACAGAGGACATTAAGAAAAAAATT 2400 GAACAATACA CGATCGATTT GGCTAAAGGG CTGAA TATTG TCG GTTTGCT CAATATTC AA 2460 TTCTTCTTTG TCGCAAGGCG AGGTGTACGTGCTAGAAGTGAATCCGAGATCAAGCAGAAC 2520 GTACC GTTTT TAAGCAA AAT TACGGGTATC CCAATGGCGA TCTCGCAAC AAAAATCAT 2580 CTTGGTCAA AAGCTGGCTGC GTTTGGCTAT ACAGAGGGCCTTCAGCCTGAACAGCAAGGT 2640 GTATTTGTA A AAGCGCCGGTCTTCTCCTTTGCCAAGCTGAGAAGAGTGGATATTACGT 2700 GGGCCTGAAA TGAAATCAAC AGGTGAAGTC ATGGGGAAAG ATTCGACACTTGAAAAGG 2760 CTCTACAAAG CCTTGATCGC TTCAGGTATT CAAATCCC GAAC TACGGTTC CGTGCTTTTA 2820 ACAGTAGCTG ATAAGGA C AAAGAAGAAGGGCTTGCCAT TGCTAAGCGGTTCCACGC GA 2880 GGCTACAAC ATTTTAGCGAC GGAAGGAACGGCAGGCTACCTGAAAGAAGCTTCCATTC 2940 GC GAAGGT CGTGG AAAAAT CGGTCAGGAT GGCCC GAAC TTGCTTGATGTCATCAGAAAC 3000 GGAGAAGCGC AGTTTGT CAT CAATACGCTG ACAAAAGGA AAGCAGCCGGC AAGAGACGG 3060 TTTAGAATC AGACGTGAA TCAGTAGAAAAT GGTGTTGCCT GCCTAACATC TT TAGATACG 3120 GCTGGAGTGG ATTTGGAGCC ATGATCGTGT GCTGATCAAA TGGCGGCTGA 3180 GCTGGAGTGG ATTTGGAGCC ATGATCGTGT GCTGATCAAA TGGCGGCTGA 3180 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <400> 13 GCTGGAGTGG ATTTGGAGCC ATGATCGTGT GCTGATCAAA TGGCGGCTGA 3180 <210> 14 <211> 52 <212> DNA <213> Artificial Sequence <400> 14 GCTGGAGTGG ATTTGGAGCC ATGATCGTGT GCTGATCAAA TGGCGGCTGA 3180 <210> 15 <211> 54 <212> DNA <213> Artificial Sequence <400> 15 GCTGGAGTGG ATTTGGAGCC ATGATCGTGT GCTGATCAAA TGGCGGCTGA 3180 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <400> 16 GCTGGAGTGG ATTTGGAGCC ATGATCGTGT GCTGATCAAA TGGCGGCTGA 3180 <210> 17 <211> 52 <212> DNA <213> Artificial Sequence <400> 17 aacgttccaa tgaaagacgg ggaactaaca gacgatacac gtatccgtgc tg 52 <210> 18 <211> 54 <212> DNA <213> Artificial Sequence <400> 18 cacggatacg tgtatcgtct gttagttccc cgtctttcat tggaacgtta aagt 54 <210> 19 <211> 52 <212> DNA <213> Artificial Sequence <400> 19 acgttccaat gaaagacggg gaagcaacag acgatacacg tatccgtgct gc 52 <210> 20 <211> 54 <212> DNA <213> Artificial Sequence <400> 20 gcacggatac gtgtatcgtc tgttgcttcc ccgtctttca ttggaacgtt aaag 54 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <400> 21 ctgaacaaac ggaaatgtga c 21 <210> 22 <211> 52 <212> DNA <213> Artificial Sequence <400> 22 acaatgacag ggaatccaat ttgaatgacg aatttttctg cttcttcaag gg 52 <210> 23 <211> 51 <212> DNA <213> Artificial Sequence <400> 23 ttgaagaagc agaaaaattc gtcattcaaa ttggattccc tgtcattgtc c 51 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <400> 24 aactgtacga ttccgaacag c 21 <210> 25 <211> 52 <212> DNA <213> Artificial Sequence <400> 25 acaatgacag ggaatccaat ttgaaggacg aatttttctg cttcttcaag gg 52 <210> 26 <211> 52 <212> DNA <213> Artificial Sequence <400> 26 cttgaagaag cagaaaaatt cgtccttcaa attggattcc ctgtcattgt cc 52 <210> 27 <211> 52 <212> DNA <213> Artificial Sequence <400> 27 ggacaatgac agggaatcca atttgaacga cgaatttttc tgcttcttca ag 52 <210> 28 <211> 52 <212> DNA <213> Artificial Sequence <400> 28 cttgaagaag cagaaaaatt cgtcgttcaa attggattcc ctgtcattgt cc 52

Claims

1. A phosphoglycerate kinase mutant, characterized in that, The amino acid sequence of the phosphoglycerate kinase mutant is shown in any of SEQ ID NO.1-3.

2. The gene encoding the phosphoglycerate kinase mutant of claim 1.

3. A biomaterial containing the gene of claim 2, characterized in that, The biological material is recombinant DNA, a vector, or a host cell.

4. Any of the following applications of the phosphoglycerate kinase mutant of claim 1, the gene of claim 2, or the biomaterial of claim 3: (1) Application in the fermentation production of nucleosides or their derivatives; (2) Application in the construction of production strains for nucleosides or their derivatives; (3) Application in increasing the yield and / or conversion rate of nucleosides or their derivatives; in, The nucleoside is a purine nucleoside.

5. A recombinant microorganism, characterized in that, The recombinant microorganism expresses the phosphoglycerate kinase mutant of claim 1, but does not express the phosphoglycerate kinase present in its originating strain.

6. The recombinant microorganism according to claim 5, characterized in that, In the recombinant microorganism, the gene encoding phosphoglycerate kinase is replaced by the gene described in claim 2.

7. The recombinant microorganism according to claim 5 or 6, characterized in that, The recombinant microorganism is a Bacillus species.

8. The method for constructing recombinant microorganisms according to any one of claims 5 to 7, characterized in that, include: The gene encoding phosphoglycerate kinase in the starting strain is mutated to the gene described in claim 2.

9. Any of the following applications of the recombinant microorganisms according to any one of claims 5 to 7: (1) Application in the fermentation production of nucleosides or their derivatives; (2) Application in the construction of production strains for nucleosides or their derivatives; (3) Application in increasing the yield and / or conversion rate of nucleosides or their derivatives; in, The nucleoside is a purine nucleoside.

10. A method for producing nucleosides or their derivatives by fermentation, characterized in that, Includes the step of culturing the recombinant microorganisms as described in any one of claims 5 to 7; The nucleoside in question is a purine nucleoside.

Citation Information

Patent Citations

  • Bacillus subtilis and construction method and application thereof

    CN110257315A