Gene glw7.1 affecting grain shape of rice and application thereof

Abstract

The present application relates to application of Ghd7 gene in changing rice grain shape, and a Ghd7 gene allele GLW7.1 capable of changing rice grain shape, wherein the coding region sequence of the GLW7.1 gene is shown as SEQ ID NO:1, and specifically, the present application discloses for the first time that the allele GLW7.1 of the Ghd7 gene can increase grain shape, thereby increasing 1000-grain weight; meanwhile, the GLW7.1 reduces rice chalkiness and increases eating value. The present application also relates to a rice breeding method for increasing rice yield and improving rice quality, which comprises the step of introducing the GLW7.1 gene into rice seeds for producing the rice. The present application provides a new gene capable of increasing rice yield and improving rice quality, and provides a new method and path for rice breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of rice molecular breeding, and relates to the application of Ghd7 gene and its allele GLW7.1 gene in increasing rice yield and improving rice quality. BACKGROUND

[0002] Rice is one of the most important food crops in the world. For a long time, increasing rice yield to ensure food security has been the main goal of rice breeding. With the improvement of people's living standards, rice with excellent appearance quality and cooking taste quality is more and more favored by consumers. Rice grain shape traits including grain length, grain width and grain thickness can directly determine the grain weight and indirectly affect the rice yield. In addition, grain shape also belongs to rice quality traits, which can affect rice chalkiness and milled rice rate, and determine its circulation value as a commodity. Therefore, exploring new rice grain shape regulatory genes can provide a better theoretical basis and solution for breeding higher quality and higher yield rice. SUMMARY

[0003] The inventors of the present application investigated the grain length and width phenotypes of the Jin23B / CR071 BC3F1 population with Jin23B as the recurrent parent and CR071 as the donor parent, combined with the polymorphic markers covering the whole genome in the population, and detected 10 QTLs controlling rice grain shape using genetic linkage mapping, wherein the GL7 locus located on the 7th chromosome has the highest significance. The QTL effect verification results of the high generation near-isogenic line population showed that the GL7 locus can increase the grain length, grain width and 1000-grain weight of rice at the same time, so we formally renamed this locus as GLW7.1 (Grain Length, Width and Weight 7.1)

[0004] We fine-mapped the GLW7.1 locus controlling grain length and width traits by screening recombinant single plants and investigating the phenotypes of the recombinant single plants in the current and later generations to 68 kb segments. Comparative sequencing results showed that CR071 has a 53 kb large fragment insertion relative to Jin23B, and the candidate gene is located in the insertion fragment. We introduced the GLW7.1 gene into the near-isogenic line material without the GLW7.1 gene through transgenic complementation experiment, and the results showed that the grain length and width phenotypes of the complementation material were significantly increased; we knocked out the GLW7.1 gene through gene editing technology, and the results showed that the grain length and width phenotypes of the loss-of-function mutant were significantly reduced. In addition, the field agronomic trait investigation results of the near-isogenic line showed that the GLW7.1 gene can directly increase the 1000-grain weight of rice by increasing the grain length and width of rice, and then indirectly increase the yield of rice; the rice appearance quality and cooking taste quality investigation results showed that the GLW7.1 gene can reduce the rice chalkiness while improving the rice eating value.

[0005] Based on the above research, the application provides application of the Ghd7 gene in changing grain shape of rice.

[0006] In one specific embodiment, the grain shape of rice is grain length and / or grain width of rice grain.

[0007] The application also provides a Ghd7 gene allele capable of affecting grain shape of rice and increasing yield of rice, wherein the protein sequence encoded by the Ghd7 gene allele is SEQ ID NO: 2, or a variant of SEQ ID NO: 2 not affecting the CCT domain.

[0008] In one specific embodiment, the nucleic acid sequence of the Ghd7 gene allele is SEQ ID NO: 1, or a variant of SEQ ID NO: 1 not affecting the CCT domain.

[0009] The application also provides a breeding method for changing grain shape of rice, comprising the step of changing the Ghd7 gene allele in rice for producing the rice grain.

[0010] In one specific embodiment, the starting rice strain does not contain the Ghd7 gene with normal CCT domain or does not contain the Ghd7 gene, and a rice strain with the Ghd7 gene with normal CCT domain is crossed with the starting rice to introduce the Ghd7 gene with normal CCT domain into the starting rice strain; or,

[0011] The starting rice strain contains the Ghd7 gene with normal CCT domain, and a rice strain without the Ghd7 gene with normal CCT domain or without the Ghd7 gene is crossed with the starting rice, and a rice strain with the Ghd7 gene with normal CCT domain is crossed with the starting rice to make the starting rice strain without the Ghd7 gene with normal CCT domain or without the Ghd7 gene.

[0012] In one specific embodiment, the starting rice strain does not contain the Ghd7 gene with normal CCT domain or does not contain the Ghd7 gene, and a Ghd7 gene expression frame with normal CCT domain is inserted into the starting rice strain; or,

[0013] The starting rice strain contains the Ghd7 gene with normal CCT domain, and a mutation or knockout method is used to make the starting rice strain without the Ghd7 gene with normal CCT domain or without the Ghd7 gene.

[0014] The application provides a new grain shape gene capable of simultaneously increasing yield of rice and improving rice quality traits, and provides a new method and path for rice breeding. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1Figure 1. Initial QTL mapping results for grain shape in BC3F1 population.

[0016] Figure 2 Figure 2. Statistical graphs of grain length (A and D), grain width (B and E) and 1000-grain weight (C and F) in GLW7.1 near-isogenic lines population in two-year replicated field experiments.

[0017] Figure 3 Figure 3. Photographs of grain length (A), grain width (B) and plant type (C) in GLW7.1 near-isogenic lines and their parents.

[0018] Figure 4 Figure 4. Map-based cloning of GLW7.1 gene, in which A is fine mapping; B is recombination single plant progeny test.

[0019] Figure 5 Figure 5. Comparative sequencing analysis of GLW7.1 gene candidate segment, in which A is predicted gene of parents in the candidate segment; B is candidate gene structure diagram; C is protein sequence corresponding to candidate gene alleles.

[0020] Figure 6 Figure 6. Transgenic functional verification of GLW7.1 gene, in which A is mutant genotype after gene editing; B is C-terminal amino acid sequence of mutant protein after gene editing; C is grain length photograph of transgenic family and control family; D is grain length statistical graph of transgenic family and control family; E is grain width photograph of transgenic family and control family; F is grain width statistical graph of transgenic family and control family.

[0021] Figure 7 Figure 7. Statistical graphs of grain length (A), grain width (B), length-width ratio (C), 1000-grain weight (D), plant height (E), effective tiller number (F), filled grain number per panicle (G) and yield per plant (H) among GLW7.1 near-isogenic lines.

[0022] Figure 8 Figure 8. Photograph of rice appearance quality (A), chalky grain percentage (B), amylose content (C), gel consistency (D) and eating quality value (E) among GLW7.1 near-isogenic lines. DETAILED DESCRIPTION

[0023] The principles and features of the present application are described below in conjunction with the accompanying drawings, in which the examples are used to explain the present application and are not intended to limit the scope of the present application.

[0024] 1. Sample source

[0025] The genetic population used in this study was derived from two parental materials, Jin 23B and CR071. Jin 23B (Jin 23B, J23B) is a maintainer line of sterile line Jin 23A, and is a slender long-grain indica rice variety used as a recurrent parent for late population construction. CR071 was provided by Enshi Academy of Agricultural Sciences in Hubei Province, and is also a slender long-grain indica rice variety used as a donor parent for GLW7.1 gene. The early BC3F1 population was normally grown in the experimental field of Xianfeng County, Enshi City, Hubei Province in summer.

[0026] The random population for two-year grain shape effect genetic analysis of GLW7.1 was separated from BC4F1 and BC5F2 generations of heterozygous genotype GLW7.1 / glw7.1 material, which was also used for recombinant single plant screening. The material used for progeny test was in the BC5F4 generation. The near-isogenic line materials involved in most experiments in this study (NIL-J containing glw7.1 allele and NIL-C containing GLW7.1 allele) were separated from BC5F n (n≥6) generation of heterozygous genotype plants. The complementary line NIL-J-Com line was obtained through transgenic complementation experiments with NIL-J as the recipient. The mutant line NIL-C-A was obtained by gene editing of NIL-C material through the CRISPR-Cas9 system. Transgenic phenotypes were collected in the T1 generation. All materials were normally grown in the experimental field of Wuhan Huazhong Agricultural University in summer, with a planting density of 16 cm x 26 cm.

[0027] After mature harvest, the rice was dried and stored at room temperature for at least three months before use in experiments.

[0028] 2. Linkage analysis of grain shape traits and fine mapping of GLW7.1

[0029] Genotype identification of the BC3F1 population was performed using 157 polymorphic SSR markers covering the whole genome. After examining the grain length and width phenotypes of the population, a genetic linkage map was constructed using the Kosambi function in Mapmaker / Exp3.0; linkage analysis was performed using the composite interval mapping method in WinQTLCart 2.5; and the output results of WinQTLCart were analyzed for linkage mapping using the R / qtl software package. Figure 1 ) A total of 10 quantitative genetic loci (QTL) controlling rice grain shape were detected in the genetic linkage mapping, of which the GL7 locus on chromosome 7 had the highest significance.

[0030] To validate the genetic effect of GL7, we examined the phenotypes of grain length, grain width and 1000-grain weight in BC4F2 and BC5F3 near-isogenic line (NIL) populations in 2015 and 2017, respectively. The results of two-year genetic effect examination showed that the NIL-C with GLW7.1 allele had longer, wider and heavier grains than the NIL-J with glw7.1 allele Figure 2 and Figure 3 ). Therefore, we renamed this locus as GLW7.1 (Grain Length, Width and Weight 7.1) for subsequent studies. Meanwhile, we also found that the NIL-H with GLW7.1 / glw7.1 heterozygous allele showed similar phenotypes to the NIL-C, indicating that GLW7.1 is a dominant locus that increases grain length, width and 1000-grain weight simultaneously.

[0031] During the fine mapping of GLW7.1, we developed a BC5F3 random population containing 30,000 single plants from the NIL-H with GLW7.1 / glw7.1 heterozygous allele for screening recombinant single plants. We then performed linkage analysis using the phenotypes of recombinant single plant progeny to locate GLW7.1 between markers LG18 and K5 Figure 4 A). We selected recombinant single plant progeny from the NIL-H with GLW7.1 / glw7.1 heterozygous allele within the candidate interval of LG18 and K5 for field planting in Wuhan (48 plants per family), identified the genotypes of family progeny, harvested the homozygous progeny seeds and examined the grain shape traits for Progeny test. Through the Progeny test of 8 important recombinant single plant families, we located the candidate genes for grain length and width of GLW7.1 between markers K17 and K19 Figure 4 B). Thus far, we fine mapped GLW7.1 that controls grain length and width simultaneously to a 68 kb segment between K17 and K19.

[0032] 3. Comparative sequencing analysis of the GLW7.1 candidate segment

[0033] Comparative genome sequencing showed that there was a 53 kb large fragment deletion in the candidate interval between K17 and K19 in J23B relative to CR071 (68 kb in J23B and 121 kb in CR071), in which there were 3 predicted ORFs (ORF1, ORF2 and ORF4) in the 68 kb candidate segment of J23B, while there were 4 predicted ORFs (ORF1, ORF2, ORF3 and ORF4) in the corresponding 121 kb candidate segment of CR071 Figure 5A). To further confirm the candidate gene of GLW7.1, we compared the genomic sequences of the three ORFs (ORF1, ORF2 and ORF4) shared by both parents, including the promoter region and protein-coding region sequence, but no variation was detected. Therefore, we believe that ORF3 (LOC_Os07g15770) (encoding a CCT motif family protein GHD7, the protein amino acid sequence is shown as SEQ ID NO: 2) in the approximately 53 kb deletion fragment of J23B is most likely the candidate gene of GLW7.1 Figure 5 B). We then compared the genomic sequences of the Ghd7 segment in Minghui 63, Nipponbare and CR071. Unlike the Ghd7-1 allele reported to be carried by Minghui 63, the allele carried by CR071 is classified as Ghd7-3 because the encoded protein contains 3 amino acid substitutions, and the allele carried by Nipponbare is classified as Ghd7-2 because the encoded protein contains 4 amino acid substitutions. J23B and Zhen 97 are classified as Ghd7-0 because the segment where the gene is located is completely deleted Figure 5 C).

[0034] 4. Genetic transformation and functional verification of GLW7.1

[0035] To determine whether the Ghd7-3 allele Ghd7 is the candidate gene of GLW7.1, we used the CRISPR-Cas9 system to edit the Ghd7-3 allele in the NIL-C genetic background to construct GLW7.1 knockout materials. We designed the sequence in the 2nd exon of the Ghd7 gene (c.512 TGGCCAATGTTGGGGAGAGC) as the target site of sgRNA, in order to obtain amino acid mutations near the CCT domain Figure 6 A). The knockout experiment obtained 3 mutant alleles, named A1, A4 and A8, respectively. The mutant allele A4 containing a 3 bp deletion contains an amino acid variation (AN→D) but still retains the CCT domain. In contrast, the mutant allele A1 containing a 1 bp insertion and the mutant allele A8 containing a 20 bp deletion both result in a frameshift mutation with the loss of the CCT domain Figure 6 B). Consistent with the expected results, the mutant alleles A1 and A8 produced smaller seeds than A4 in the NIL-C background Figure 6 C-F). We also used the GLW7.1 itself promoter to drive its own cDNA to construct GLW7.1 complementation materials (NIL-J-Com family) in the NIL-J background. As Figure 6As shown in Table C-F, the complementary materials Coml, Com2 and Com3 produced seeds with larger grain shape relative to the transgene negative material NIL-J-Neg. These results indicate that Ghd7-3 is the functional gene of GLW7.1.

[0036] 5. Phenotype investigation

[0037] The determination method is as follows:

[0038] 1) Determination of grain shape:

[0039] Determination of grain length: 10 full grains were randomly selected from the seeds of a single progeny, and were placed in a row according to the first and last connection, without overlapping or leaving gaps, and the value was measured with a vernier caliper. The average value obtained by repeating 3 times was the grain length.

[0040] Determination of grain width: 10 full grains were randomly selected from the seeds of a single progeny, and were placed in a row according to the shoulder-to-shoulder, without overlapping or leaving gaps, and the value was measured with a vernier caliper. The average value obtained by repeating 3 times was the grain width.

[0041] 2) Determination of yield-related traits:

[0042] Determination of plant height: after the seeds matured, the distance from the ground to the top of the main ear was measured with a measuring rod, which was the single plant height.

[0043] Determination of single plant tiller number: after the seeds matured, the number of effective ears with more than 10 grains was manually recorded, which was the single plant effective tiller number.

[0044] Determination of grains per ear: after the seeds matured, all effective ears were harvested, and the total grain number per plant was obtained by using a digital seed testing machine after threshing. The grains per ear was the total grain number per plant divided by the effective ear number.

[0045] Determination of single plant yield: after the seeds matured, all effective ears were harvested, and the grain weight per plant was obtained by using a digital seed testing machine after threshing, which was the single plant yield.

[0046] 3) Determination of quality-related traits:

[0047] Determination of chalky grain rate: 200 brown rice grains were randomly selected and placed on a glass plate with normal lighting at the bottom. Normal rice grains were transparent, while chalky rice grains had shadows. The number of chalky rice grains was recorded for 3 times. The percentage of chalky rice grains in the total 200 grains was the brown rice chalky grain rate.

[0048] Determination of amylose content: The determination of amylose content of milled rice powder refers to the national standard NY / T2639-2014 with simple adjustments. The specific steps are as follows: first, add 10 ± 0.5 mg of milled rice powder, 0.1 ml of 95% ethanol and 0.9 ml of 1M sodium hydroxide into a dry 15 ml glass tube in turn, mix them in turn, screw on the lid, cool to room temperature after boiling in a water bath for 10 min, and dilute with 9 ml of single distilled water; then, add 0.5 ml of the diluted solution into a new 15 ml glass tube, add 9.25 ml of single distilled water, 0.2 ml of 1M acetic acid and 0.15 ml of 0.2% iodine-potassium iodide solution in turn, screw on the lid, mix well by inverting up and down, and stand for 20 min; finally, add 0.2 ml of the above mixture and the same treated mixture of four standard samples of amylose content (0.4%, 10.6%, 16.2% and 26.5%) into a transparent ELISA plate, determine the absorbance at 620 nm wavelength by using a Tecan InfiniteM200 multifunctional enzyme labeler, and calculate the amylose content of each sample according to the linear equation of the absorbance and the amylose content of the standard samples. Each single sample is measured repeatedly for three times, and the average value is the final amylose content.

[0049] Determination of gel consistency: Take 4 portions of 100 mg (based on water content of 12%) of milled rice powder passing through a 200 mesh sieve in a test tube. Add 0.2 mL of 0.025% thymol blue solution (0.125 g dissolved in 95% ethanol) and gently shake the test tube to fully disperse the rice powder. Then add 2.0 mL of 0.2M KOH solution and shake the test tube. Place the test tube in a vortex shaker to mix the rice powder evenly. Immediately place the test tube in a boiling water bath (preferably with a glass marble to cover the test tube opening). Heat for 8 min, controlling the rice gel solution in the test tube to maintain at one-third to one-half of the test tube height during heating. Use an electric hair dryer to blow cold air on the test tube in the pot to cool it down and prevent the rice gel solution from overflowing. Remove the test tube, remove the glass marble, and let it cool at room temperature for 5 min. Then place the test tube in an ice water bath at about 0°C for 20 min (control the time). Immediately place it horizontally on a coordinate paper (preferably covered with a large piece of transparent glass) on a horizontal operation table. Adjust the horizontal position and let it stand at room temperature for 1 h. Measure the length of the rice gel flowing in the test tube (mm) immediately. The difference between two test results should not exceed 7 mm. Take the average value as the test result.

[0050] Determination of eating value: Prepare 150 g or more of milled rice and use a rice grain eating meter to determine the eating quality of the grain state. Set 10 biological replicates for each sample.

[0051] 6、GLW7.1 affects rice yield and rice quality

[0052] We investigated yield-related traits of NIL materials (NIL-J and NIL-C) in the field in Wuhan in 2021. Compared with NIL-J material, NIL-C material increased about 8% (A) in grain length, about 5% (B) in grain width, resulting in 2% (C) in length-width ratio, 22% (D) in 1000-grain weight. In addition, NIL-C material showed higher plant height phenotype (about 33 cm higher) (C and E), more grains per panicle (about 80% more) (G) than NIL-J material, but no significant difference in effective tiller number (F). Finally, the increase in 1000-grain weight and grain number resulted in higher single plant yield of NIL-C material (about 114% increase) (H) relative to NIL-J material. Figure 7 Figure 7 Figure 7 Figure 7 Figure 3 C and Figure 7 E), more grains per panicle (about 80% more) (G) than NIL-J material, but no significant difference in effective tiller number (F). Finally, the increase in 1000-grain weight and grain number resulted in higher single plant yield of NIL-C material (about 114% increase) (H) relative to NIL-J material. Figure 7 Figure 7 Figure 7

[0053] We also investigated some rice quality traits between NILs. The results showed that NIL-C material had lower chalky grain rate and higher eating value, accompanied by higher amylose content and gel consistency (I) than NIL-J material. These results indicated that GLW7.1 gene derived from CR071 could simultaneously improve rice yield and rice quality. Figure 8 In the present invention, we isolated and identified a novel QTL GLW7.1 regulating rice grain shape traits by map-based cloning, and verified that it is a strong allele Ghd7-3 of Ghd7 encoding CCT motif family protein. Previous reports showed that Ghd7 mainly acts as a major regulator of rice heading date, and can increase rice yield by increasing panicle number. The present invention found that GLW7.1 or Ghd7-3 not only increased rice grain number, but also increased rice grain weight, specifically in the form of increased grain length and grain width (I). On the other hand, GLW7.1 not only reduced rice chalkiness, but also improved rice cooking and eating quality (I). Therefore, we believe that GLW7.1 or Ghd7-3, which can simultaneously increase rice yield and improve rice quality traits, has great application value in the breeding and improvement of high-quality and high-yield rice varieties.

[0054] Figure 7 Figure 8

[0055] ​​​​​​​​​​Based on the above experiment, we can introduce GLW7.1 gene into the rice strain without GLW7.1 gene by traditional hybridization or transgenic method to improve the yield, appearance quality and cooking taste quality of the rice strain.

[0056] The above description is merely preferred embodiments of the present application, and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. Use of a Ghd7 gene in changing grain shape of rice, wherein the nucleic acid sequence of the Ghd7 gene is SEQ ID NO: 1, and the grain shape of rice is grain length and / or grain width of rice grain.

2. A breeding method for changing the grain shape of rice, characterized by, Including altering the rice used to produce the rice grains. Ghd7 The steps of gene alleles, making it Ghd7 The gene is replaced from the Ghd7 gene allele without the normal CCT domain to the Ghd7 gene allele with the nucleic acid sequence as shown in SEQ ID NO:1; or the Ghd7 gene allele with the nucleic acid sequence as shown in SEQ ID NO:1 is replaced to the Ghd7 gene allele without the normal CCT domain.

3. The method of claim 2, wherein, The starting rice strain does not contain a Ghd7 gene with a normal CCT domain or a Ghd7 gene, and a rice strain with an allele of the Ghd7 gene with the nucleic acid sequence of SEQ ID NO: 1 is crossed with the starting rice to introduce the allele of the Ghd7 gene with the nucleic acid sequence of SEQ ID NO: 1 into the starting rice strain; or, The Ghd7 gene of the starting rice strain is an allele of the Ghd7 gene with the nucleic acid sequence of SEQ ID NO: 1, and a rice without a Ghd7 gene or a Ghd7 gene with a normal CCT domain is crossed to make the starting rice strain without a Ghd7 gene with a normal CCT domain or a Ghd7 gene.

4. The method of claim 2, wherein, The starting rice strain does not contain a Ghd7 gene with a normal CCT domain or a Ghd7 gene, and an expression frame of the Ghd7 gene with the nucleic acid sequence of SEQ ID NO: 1 is inserted into the starting rice strain; or, The starting rice strain contains an allele of the Ghd7 gene with the nucleic acid sequence of SEQ ID NO: 1, and a method of mutation or knockout is used to make the starting rice strain without a Ghd7 gene with a normal CCT domain or a Ghd7 gene.

Images