An oxidative endotoxin-free Escherichia coli genetically engineered strain and its construction and application

By knocking out the trxB and gorA genes in the Clearcoli BL21(DE3) strain and further knocking out the lpp gene, an oxidized endotoxin-free Escherichia coli genetically engineered strain, Clearcoli BL21(DE3)△trxB/gorA/lpp, was constructed. This solved the problem of misfolding of polydisulfide bond proteins in Clearcoli BL21(DE3) and achieved efficient extracellular secretory expression of polydisulfide bond proteins.

CN115725489BActive Publication Date: 2025-10-28CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211262595.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-14
Publication Date
2025-10-28
Estimated Expiration
2042-10-14

AI Technical Summary

Technical Problem

In the prior art, the Clearcoli BL21(DE3) Escherichia coli strain contains disulfide reductase in its cytoplasm, which is in a highly reduced state and is not suitable for the correct folding of polydisulfide bond proteins, resulting in misfolding and low expression efficiency.

Method used

By knocking out the trxB and gorA genes in the Clearcoli BL21(DE3) strain using λ-Red homologous recombination and CRISPR/Cas9 gene editing technology, the reducing environment of the cytoplasm was altered, and the lpp gene was further knocked out to construct an oxidized endotoxin-free Escherichia coli genetically engineered strain, Clearcoli BL21(DE3)△trxB/gorA/lpp, which promotes the correct folding and extracellular secretion of polydisulfide proteins.

Benefits of technology

It significantly improved the extracellular secretory expression level of polydisulfide bond proteins, promoted the correct folding and secretory expression of polydisulfide bond proteins such as the antifungal peptide MD, and is suitable for the exogenous expression of polydisulfide bond proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115725489B_ABST
    Figure CN115725489B_ABST
Patent Text Reader

Abstract

This invention relates to the field of microbial technology, and more particularly to a genetically engineered strain of oxidized, endotoxin-free *Escherichia coli*, its construction, and its application. The *E. coli* genetically engineered strain is a recombinant bacterium obtained by modifying the *ClearColi BL21(DE3)* *E. coli* strain, wherein the modification involves inactivating the *trxB* and *gorA* genes in the *ClearColi BL21(DE3)* *E. coli* strain. This invention alters the reducing environment of the cytoplasm, enabling proteins containing multiple disulfide bonds to fold efficiently and correctly in this strain. Furthermore, this invention knocks out the *lpp* gene in the *ClearColi BL21(DE3)* ΔtrxB / gorA strain, significantly increasing the extracellular secretory expression level of polydisulfide proteins, which is beneficial for the exogenous secretory expression of polydisulfide proteins.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to an oxidized, endotoxin-free Escherichia coli genetically engineered strain and its construction and application. Background Technology

[0002] Recombinant proteins produced by *E. coli* are widely used in the treatment of various diseases, including diabetes, cancer, and arthritis. However, the growth of *E. coli* produces large amounts of endotoxins (lipopolysaccharide, LPS), which can activate the immune response of human cells, leading to septic shock. Therefore, protein drugs produced by *E. coli* must undergo extremely rigorous purification procedures to reduce LPS content. This additional purification and quality control significantly increases the production cost of protein drugs. ClearcoliColi BL21(DE3) is an *E. coli* strain with modified endotoxins that do not trigger an endotoxin response in human immune cells. Clearcoli BL21(DE3) is derived from BL21(DE3) and further knocks out seven genes related to LPS synthesis: gutQ, kdsD, lpxL, lpxM, pagP, lpxP, and eptA, thereby transforming the six acyl chains of LPS into four and simultaneously deleting oligosaccharide chains. The deletion of these two acyl chains transforms LPS into lipid IVA, which does not induce the formation of the TLR4 / MD2 complex, cannot activate the downstream NF-κB pathway, and does not trigger an endotoxin response. Therefore, products (proteins, antibodies, vaccines, etc.) produced using ClearColi BL21(DE3) can be used without endotoxin removal. Currently, products produced using ClearColi BL21(DE3) include human leukocyte antigen G, HSP60, D-allulose, and Zika virus antibodies.

[0003] Furthermore, many drug proteins, especially those derived from eukaryotes such as antibodies and antimicrobial peptides, generally contain multiple disulfide bonds. These disulfide bonds can conformally fix the polypeptide chain backbone or increase the protein's thermodynamic stability, resisting damage from strong acids, strong alkalis, and high temperatures. However, disulfide bonds are formed by the oxidative dehydrogenation of thiol groups on two cysteine ​​residues, requiring an oxidative environment. The cytoplasm of Clearcoli Coli BL21(DE3) contains disulfide reductase, exhibiting a highly reduced state, making this strain unsuitable for the expression of multi-disulfide bond proteins and prone to misfolding. Therefore, reversing the reducing environment in the cytoplasm of Clearcoli Coli BL21(DE3) and constructing a strain that can promote the correct folding of multi-disulfide bond proteins is of great significance. However, currently, no similar oxidized, endotoxin-free Escherichia coli strain has been developed. Summary of the Invention

[0004] This invention constructs an oxidized, endotoxin-free Escherichia coli genetically engineered strain that can promote the correct folding of polydisulfide bond proteins. This addresses the shortcomings of existing technologies where Clearcoli Coli BL21(DE3) cytoplasm contains disulfide reductase, exhibiting a highly reduced state, making it unsuitable for the expression of polydisulfide bond proteins and prone to misfolding.

[0005] This invention provides a genetically engineered strain of Escherichia coli, which is a recombinant strain obtained by modifying the ClearColi BL21(DE3) Escherichia coli strain. The modification involves inactivating trxB and gorA in the ClearColi BL21(DE3) Escherichia coli strain.

[0006] Preferably, the nucleotide sequence of trxB is any one of the following:

[0007] 1) As shown in SEQ ID NO.1;

[0008] 2) DNA molecules that hybridize with the DNA sequence defined in SEQ ID NO.1 and encode a protein with the same function;

[0009] 3) DNA molecules that have more than 90% homology with the DNA sequence in 1) or 2) and encode proteins with the same function.

[0010] Preferably, the nucleotide sequence of gorA is any one of the following:

[0011] 1) As shown in SEQ ID NO.2;

[0012] 2) A DNA molecule that hybridizes to the DNA sequence defined in SEQ ID NO.2 and encodes a protein with the same function;

[0013] 3) A DNA molecule that shares more than 90% homology with the DNA sequence in 1) or 2) and encodes a protein with the same function. This invention is the world's first to construct an oxidized, endotoxin-free Escherichia coli genetically engineered strain: ClearColiBL21(DE3)△trxB / gorA, which alters the reducing environment of the cytoplasm, enabling proteins containing multiple disulfide bonds to fold efficiently and correctly within this strain.

[0014] The genetically engineered Escherichia coli strain provided by the present invention also inactivates lpp in the ClearColi BL21(DE3) Escherichia coli strain.

[0015] Preferably, the nucleotide sequence of the lpp is any one of the following:

[0016] 1) As shown in SEQ ID NO.3;

[0017] 2) DNA molecules that hybridize with the DNA sequence defined in SEQ ID NO.3 and encode a protein with the same function;

[0018] 3) DNA molecules that have more than 90% homology with the DNA sequence in 1) or 2) and encode proteins with the same function.

[0019] According to the *E. coli* genetically engineered strain provided by this invention, inactivating trxB, gorA, or lpp in the *ClearColi BL21(DE3)* *E. coli* strain prevents the gene from expressing a product or renders the expressed product non-functional. This invention yields the *ClearColi BL21(DE3)* ΔtrxB / gorA / lpp strain, which significantly improves the extracellular secretory expression level of polydisulfide bond proteins, thus promoting the exogenous secretory expression of polydisulfide bond proteins.

[0020] In the Escherichia coli genetically engineered strain provided by the present invention, the inactivation is achieved by knocking out the relevant gene.

[0021] The present invention also provides a method for constructing the genetically engineered strain of Escherichia coli, which involves restoring the trxB protein and knocking out the gorA gene in the genome of the ClearColi BL21(DE3) Escherichia coli strain.

[0022] According to the method for constructing Escherichia coli genetically engineered strains provided by the present invention, Escherichia coli ClearColi BL21(DE3)△trxB strain is first obtained, and then a strain with double knockout of trxB and gorA genes is obtained.

[0023] In the case of knocking out the gorA gene in the Escherichia coli ClearColi BL21(DE3)△trxB strain, the trxB protein was reintroduced by plasmid, and a double knockout strain of trxB and gorA genes with mutations in the ahpC gene was obtained by screening.

[0024] In some embodiments of the present invention, λ-Red homologous recombination technology and CRISPR / Cas9 technology were used, and the trxB and gorA genes in the genome of ClearColi BL21(DE3) Escherichia coli strain were successfully knocked out by adding back the trxB protein.

[0025] In some embodiments of the present invention, the lpp gene in the genome of the ClearColi BL21(DE3)△trxB / gorA strain is also knocked out using CRISPR / Cas9 technology.

[0026] The method for constructing a genetically engineered strain of *Escherichia coli* according to the present invention includes the following steps:

[0027] (1) First, the trxB gene in the genome of Escherichia coli ClearColi BL21(DE3) was cloned into plasmid pBAD24 and named pBAD24-trxB.

[0028] Then, the gRNA of the gene gorA was selected and constructed into the plasmid pTargetF, named pTargetF-gorA;

[0029] The nucleotide sequence of the gRNA of the gene gorA is shown in SEQ ID NO.26;

[0030] (2) The genome of Escherichia coli ClearColi BL21(DE3) was used as a template, and 5'gorA-upstream / 3'gorA-upstream and 5'gorA-downstream / 3'gorA-downstream primers were used for the first round of PCR; the recovered products of the first round of PCR were used as templates, and 5'gorA-upstream / 3'gorA-downstream primers were used for the second round of overlap PCR, and the products of the second round of PCR were recovered.

[0031] The nucleotide sequence upstream of the 5'gorA- is shown in SEQ ID NO.16;

[0032] The nucleotide sequence upstream of the 3'gorA- is shown in SEQ ID NO.17;

[0033] The nucleotide sequence downstream of the 5'gorA- is shown in SEQ ID NO.18;

[0034] The nucleotide sequence downstream of the 3'gorA- is shown in SEQ ID NO.19;

[0035] (3) The plasmids pCas and pBAD24-trxB were electroporated into ClearColi BL21(DE3)△trxB competent cells. After culturing, single clones were picked and cultured in liquid 2×YT medium, and then transferred to liquid LB medium. After culturing, L-arabinose was added to induce expression. The bacterial culture after induction was prepared into electroporated competent cells.

[0036] (4) Electroporate the PCR product and plasmid pTargetF-gorA from (2) into the electroporation competent cells prepared in (3). After electroporation, add liquid 2×YT medium and culture. Then, spread the culture on LB solid medium containing kanamycin and spectinomycin and culture.

[0037] The method for constructing Escherichia coli genetically engineered strains according to the present invention further includes the following steps:

[0038] Identify single colonies that have undergone homologous recombination;

[0039] And / or, identify whether the ahpC gene in the genome of ClearColi BL21(DE3)△trxB / gorA strain has been mutated.

[0040] The present invention also provides the application of the genetically engineered Escherichia coli strain in promoting the correct folding of polydisulfide proteins.

[0041] The present invention also provides the application of the genetically engineered Escherichia coli strain in increasing the extracellular secretory expression of polydisulfide recombinant proteins.

[0042] The beneficial effects of this invention are:

[0043] (1) The oxidized endotoxin-free Escherichia coli genetically engineered strain constructed in this invention has broad application potential in the exogenous expression of polydisulfide bond proteins such as active proteins, polypeptides, cytokines and antimicrobial peptides, which is conducive to promoting cost reduction and efficiency improvement in related industries.

[0044] (2) The method of constructing oxidized endotoxin-free Escherichia coli genetically engineered strains of the present invention is convenient, fast and efficient. Attached Figure Description

[0045] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0046] Figure 1 This invention relates to the effect of trxB or gorA gene knockout on the expression of the polydisulfide bond antifungal peptide MD in *Escherichia coli* BL21(DE3). A and B show the PCR identification results of trxB and gorA gene knockout colonies, respectively; 1 and 2 are single colonies of the two strains. C is a comparison of the growth curves of *Clearcoli* BL21(DE3)WT, ΔtrxB, and ΔgorA strains. D (extracellular supernatant) and E (intracellular) show the expression of the antifungal peptide MD in different *E. coli* strains: 1: Origami(DE3), 2: *Clearcoli* BL21(DE3)WT, 3: *Clearcoli* BL21(DE3)ΔtrxB, 4: *Clearcoli* BL21(DE3)ΔgorA.

[0047] Figure 2 This invention relates to the effect of double knockout of the trxB and gorA genes on the expression of the polydisulfide bond antifungal peptide MD in Clearcoli BL21(DE3) strain. A and B are the PCR identification results of trxB and gorA gene knockout colonies, respectively; 1 and 2 are two single colonies. C is a comparison of the amino acid sequence of the ahpC protein in the genomes of the wild-type strain and the ΔtrxB / gorA strain. D is a comparison of the growth curves of Clearcoli BL21(DE3)WT, ΔtrxB, ΔgorA, and ΔtrxB / gorA strains. E (extracellular supernatant) and F (intracellular) show the expression of the antifungal peptide MD in different Escherichia coli strains: 1: Origami(DE3), 2: Clearcoli BL21(DE3)WT, 3: Clearcoli BL21(DE3)ΔtrxB, 4: Clearcoli BL21(DE3)ΔgorA, 5: Clearcoli BL21(DE3)ΔtrxB / gorA.

[0048] Figure 3 This invention relates to the effect of lpp gene knockout on the secretion and expression of the polydisulfide bond antifungal peptide MD in the Clearcoli BL21(DE3)△trxB / gorA strain. A shows the PCR identification results of the lpp gene knockout colonies; B is a comparison of the growth curves of Clearcoli BL21(DE3)△trxB / gorA and △trxB / gorA / lpp strains; C (extracellular supernatant) and D (intracellular) show the expression of the antifungal peptide MD in different Escherichia coli strains, 1: Origami(DE3), 2: Clearcoli BL21(DE3)△trxB / gorA, 3: Clearcoli BL21(DE3)△trxB / gorA / lpp. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0050] The purpose of this invention is to provide an oxidized, endotoxin-free engineered strain of *Escherichia coli* that promotes the correct folding of disulfide-bonded proteins. This invention utilizes λ-Red homologous recombination technology and Crispr / Cas9 gene editing technology to knock out two key enzymes in the reduction pathway of ClearColi BL21(DE3) cytoplasm: glutathione reductase (gorA) and thioredoxin reductase (trxB), thus constructing, for the first time in the world, an oxidized, endotoxin-free engineered strain of *Escherichia coli* that can promote the correct folding of multiple disulfide-bonded proteins.

[0051] Simultaneously, to enhance the secretory expression level of the polydisulfide bond antifungal peptide MD in this strain, the lpp (Braun's lipoprotein) gene was further knocked out. Knocking out this gene loosens the outer membrane of *E. coli*, facilitating the leakage of proteins from the periplasmic space into the extracellular environment, which is particularly effective for small-molecule recombinant proteins and has minimal impact on cell growth. Therefore, this invention further utilizes CRISPR / Cas9 gene editing technology to knock out the lpp gene, significantly increasing the extracellular secretory expression of the polydisulfide bond recombinant protein.

[0052] Example 1

[0053] Constructing an *E. coli* strain with single deletions of the *trxB* and *gorA* genes, including the following steps:

[0054] The ClearColi BL21(DE3) gene knockout in Escherichia coli was performed using λ-Red homologous recombination technology, with the plasmids pKD3, pKD46, and pCP20 used.

[0055] Step 1: Construction of Escherichia coli ClearColi BL21(DE3) ΔtrxB:Cm and ΔgorA:Cm strains

[0056] (1) Based on the upstream and downstream sequences of the trxB and gorA genes in the genome of Escherichia coli ClearColi BL21(DE3), two pairs of primers were designed using plasmid pKD3 as a template: 5'trxB-FRT-1 / 3'trxB-FRT-1 and 5'trxB-FRT-2 / 3'trxB-FRT-2; 5'gorA-FRT-1 / 3'gorA-FRT-1 and 5'gorA-FRT-2 / 3'gorA-FRT-2.

[0057] (2) Using pKD3 as a template, and 5'trxB-FRT-1 / 3'trxB-FRT-1 or 5'gorA-FRT-1 / 3'gorA-FRT-1 as primers, a first round of PCR was performed. Using the recovered product from the first round of PCR as a template, and 5'trxB-FRT-2 / 3'trxB-FRT-2 or 5'gorA-FRT-2 / 3'gorA-FRT-2 as primers, a second round of PCR was performed. The recovered product from the second round of PCR yielded a PCR product with 72bp trxB or gorA homologous arms at both ends and the chloramphenicol resistance gene sequence in the middle.

[0058] (3) The second round of PCR products were treated with Dpn I restriction endonuclease at 37°C for 1 h to eliminate the template plasmid pKD3 contained in the products and recover the target fragment with a concentration greater than 200 ng / μL.

[0059] (4) Plasmid pKD46 was electroporated into ClearColi BL21(DE3) competent cells (electroporation conditions: 1.8 kV, 10 μF, 600 Ω). After overnight culture at 30°C for approximately 20 h, single colonies were picked and cultured overnight at 30°C in 5 mL of 2×YT medium. The next day, the cells were transferred to 50 mL of LB medium at a transfer ratio of 1:100 and cultured until OD600. 600 When the concentration was approximately 0.2, L-arabinose was added to a final concentration of 100 mM to induce expression for 1.5 h. After induction, the bacterial culture was incubated on ice for 30 min to prepare electrocompetent cells.

[0060] (5) Electroporate 10-15 μL of the target fragment treated in (3) into the electroporation competent cells prepared in (4). The electroporation conditions are: 1.8 kV, 10 μF, 600 Ω. After electroporation, add 1 mL of liquid 2×YT medium and culture at 30℃ and 220 rpm for 1.5 h. Then, spread the mixture evenly on LB solid medium containing chloramphenicol (final concentration of 10 mg / L) and culture overnight at 30℃.

[0061] (6) After the colonies on the solid culture medium have grown to a certain size, single colonies that have undergone homologous recombination are identified by colony PCR reaction. A pair of knockout identification primers were designed based on the upstream and downstream sequences of the trxB and gorA genes: trxB-test-F / trxB-test-R and groA-test-F / gorA-test-R.

[0062] (7) Pick a single colony from chloramphenicol solid culture medium and perform colony PCR using trxB-test-F / trxB-test-R and groA-test-F / gorA-test-R as primers. The reaction results are as follows: Figure 1The results of the first recombination of A and B are shown. The PCR product size of the selected single-clone colony is about 1500 bp, which is consistent with the theoretical value. Sequencing further confirmed that the trxB or gorA gene was replaced, indicating that the trxB or gorA gene was successfully replaced by the chloramphenicol resistance gene. The strains were named ClearColi BL21(DE3)△trxB:Cm and △gorA:Cm, respectively.

[0063] (8) Elimination of pKD46 plasmid: pKD46 plasmid is a temperature-sensitive plasmid and will be lost when cultured at 42℃. Therefore, single colonies of ClearColi BL21(DE3)△trxB:Cm and △gorA:Cm strains were selected and cultured at 42℃ for 12h to obtain strains without plasmid residue.

[0064] Table 1

[0065] Primer Name Sequence SEQ ID NO.4 5'trxB-FRT-1 tggtgtcgccttctttacttttgttactgatttgtaaaagggaattagccatggtccat SEQ ID NO.5 5'trxB-FRT-2 acggggaaaaaataaaggcgacccatagtcgcatggtgtcgccttctttactt SEQ ID NO.6 3'trxB-FRT-1 caatcctgcccattgtctgccaacaactatggggatctcgtgtaggctggagctgcttc SEQ ID NO.7 3'trxB-FRT-2 tcatactctttttttacgtctgtaaattccctacaatcctgcccattgtctgc SEQ ID NO.8 5'gorA-FRT-1 cgctacaatcgcggtaatcaacgataaggacactttgtcgggaattagccatggtccat SEQ ID NO.9 5'gorA-FRT-2 attgcagccattgctggcacctattacgtctcgcgctacaatcgcggtaatca SEQ ID NO.10 3'gorA-FRT-1 ttaagggctaagagcacactactcttagccctttaacatgtgtaggctggagctgcttc SEQ ID NO.11 3'gorA-FRT-2 gcttcagcttctgaactgatagcggaaacgtaattaagggctaagagcacactact SEQ ID NO.12 trxB-test-F gccaacgttgggagatgac SEQ ID NO.13 trxB-test-R aatcggcttataaagcggg SEQ ID NO.14 gorA-test-F gtgattaacccgccgtgga SEQ ID NO.15 gorA-test-R caggcagtggatgagtaagc

[0066] Step 2: Construction of Escherichia coli ClearColi BL21(DE3) ΔtrxB and ΔgorA strains

[0067] (1) Plasmid pCP20 was electroporated into ClearColi BL21(DE3)△trxB:Cm and △gorA:Cm competent cells to eliminate the chloramphenicol resistance gene. ClearColi BL21(DE3)△trxB:Cm and △gorA:Cm strains containing plasmid pCP20 were picked and cloned into 5 mL of antibiotic-free 2×YT liquid medium and cultured overnight at 42℃ and 220 rpm. Then, the culture was streaked onto antibiotic-free solid medium.

[0068] (2) After the colonies have grown to a certain size, colony PCR was performed using trxB-test-F / trxB-test-R and groA-test-F / gorA-test-R as primers to identify whether the chloramphenicol resistance gene on the genome has been eliminated. The results are as follows: Figure 1 The results of the second recombination of A and B are shown. The PCR product size of the selected single-clone colony is about 500 bp, which is consistent with the theoretical value. Further testing of its sensitivity to chloramphenicol showed that if it was sensitive to chloramphenicol, it meant that the chloramphenicol resistance gene was successfully eliminated, and the ClearColi BL21(DE3)△trxB and △gorA strains with trxB and gorA gene knockout were successfully obtained.

[0069] Step 3: Plotting growth curves of *E. coli* ClearColi BL21(DE3) ΔtrxB and ΔgorA strains. Single colonies of wild-type ClearColi BL21(DE3), ΔtrxB, and ΔgorA were picked and placed in 5 mL of liquid culture medium. Three replicates were set up and cultured at 37℃ and 220 rpm for 12 h. OD was measured every 2 h. 600 For each value, a growth curve is plotted. The growth curves are shown below. Figure 1 As shown in C, knockout of the trxB or gorA gene in the genome of Escherichia coli ClearColi BL21(DE3) can improve the growth rate of Escherichia coli ClearColi BL21(DE3) strain to some extent, and knockout of the trxB gene is more beneficial to improving the growth rate of the strain.

[0070] Step 4: Detection of expression of polydisulfide antifungal peptide MD in Escherichia coli ClearColi BL21(DE3) ΔtrxB and ΔgorA strains

[0071] Antifungal peptide MD is a tandem antifungal peptide constructed in the patent (application number: CN202210157023.8). It contains four disulfide bonds. When expressed in reduced *E. coli* BL21(DE3) and ClearColi BL21(DE3), misfolding occurs, affecting its secretory expression level. However, this does not occur in oxidized *E. coli* Origami(DE3). Therefore, using the multi-disulfide bond antifungal peptide MD as an example, the secretory expression plasmid pET22b-SX-SUMO-MD constructed in the patent (application number: CN202210157023.8) was used to express the antifungal peptide MD in *E. coli* ClearColi BL21(DE3) ΔtrxB and ΔgorA strains to verify whether trxB or gorA gene knockout promotes the correct folding of multi-disulfide bond proteins.

[0072] (1) The plasmid pET22b-SX-SUMO-MD was transformed into Escherichia coli ClearColi BL21(DE3)△trxB and △gorA strains and cultured overnight at 37°C.

[0073] (2) Pick single clones and culture them overnight in 5 mL of 2×YT medium, then transfer them 1:100 to 100 mL Erlenmeyer flasks and incubate at 37°C and 220 rpm until 0D. 600When the concentration of the antifungal peptide MD reached approximately 0.6, IPTG was added to a final concentration of 0.5 mM for induction of expression. Simultaneously, the plasmid pET22b-SX-SUMO-MD was transformed into wild-type strains of *Escherichia coli* Origami (DE3) and *ClearColi BL21 (DE3)* for induction of expression using the same method. After 24 h of expression, the extracellular supernatant and intracellular samples were subjected to SDS-PAGE electrophoresis to detect the expression of the antifungal peptide MD in different strains.

[0074] (3) The results are as follows Figure 1 As shown in Figures D and E, compared to the oxidized Escherichia coli Origami (DE3) strain, knockout of the trxB or gorA gene did not promote the correct folding of the antifungal peptide MD in the ClearColi BL21 (DE3) strain; numerous misfolded bands remained. This indicates that knockout of the trxB or gorA gene alone cannot completely reverse the reducing environment within E. coli cells and will still affect the correct folding of polydisulfide proteins.

[0075] Example 2

[0076] Constructing an *E. coli* strain with double deletions of the *trxB* and *gorA* genes, including the following steps:

[0077] To further reverse the reducing environment within E. coli, the ClearColi BL21(DE3)△trxB strain was used as the starting strain. The gorA gene was knocked out using CRISPR / Cas9 gene editing technology to construct a double knockout strain of trxB and gorA. The plasmids used were pCas, pTargetF, and pBAD24.

[0078] Step 1: Construction of *E. coli* ClearColi BL21(DE3)△trxB / gorA Double Knockout Strains Double knockout of the *E. coli* trxB and gorA genes has been reported to be lethal, with normal viability only restored by mutation of the ahpC gene. Previous experiments also showed that direct double knockout of the trxB and gorA genes failed to successfully screen for double knockout strains. Therefore, when knocking out the gorA gene in the *E. coli* ClearColi BL21(DE3)△trxB strain, an attempt was made to reintroduce the trxB protein using a plasmid to screen for double knockout strains with mutations in the ahpC gene.

[0079] (1) First, the trxB gene from the genome of *Escherichia coli* ClearColi BL21(DE3) was cloned into plasmid pBAD24 and named pBAD24-trxB. Then... http: / / crispor.tefor.net / The gRNA of gene gorA was selected from the website: tatgattacatcgccatcgg (SEQ ID NO.26), and it was constructed into plasmid pTargetF, named pTargetF-gorA.

[0080] (2) Using the genome of *E. coli* ClearColi BL21(DE3) as a template, a first round of PCR was performed using primers 5'gorA-upstream / 3'gorA-upstream and 5'gorA-downstream / 3'gorA-downstream. A second round of overlap PCR was performed using the recovered product from the first round of PCR as a template, using primers 5'gorA-upstream / 3'gorA-downstream. The recovered second-round PCR product yielded a PCR product (concentration greater than 100 ng / μL) with 500 bp homologous gorA arms at both ends.

[0081] (3) Plasmids pCas and pBAD24-trxB were electroporated into ClearColi BL21(DE3)ΔtrxB competent cells (electroporation conditions: 1.8 kV, 10 μF, 600 Ω). After overnight culture at 30°C for approximately 15 h, single colonies were picked and cultured overnight at 30°C in 5 mL of 2×YT medium. The next day, the cells were transferred to 50 mL of LB medium at a transfer ratio of 1:50 and cultured until OD500. 600 When the concentration was approximately 0.2, L-arabinose was added to a final concentration of 100 mM to induce expression for 1.5 h. After induction, the bacterial culture was incubated on ice for 30 min to prepare electrocompetent cells.

[0082] (4) Electroporate 10-15 μL of the PCR product and 100 ng of plasmid pTargetF-gorA from (2) into the electroporation competent cells prepared in (3). The electroporation conditions are: 1.8 kV, 10 μF, 600 Ω. Immediately after electroporation, add 1 mL of liquid 2×YT medium and incubate at 30℃ and 220 rpm for 1.5 h. Then, spread the mixture evenly on LB solid medium containing kanamycin (final concentration 50 mg / L) and spectinomycin (final concentration 100 mg / L) and incubate at 30℃.

[0083] (5) After about 7 days, the colonies on the solid culture medium have grown to a certain size (if the growth time is too long, plasmids pCas and pTargetF-gorA will be lost, and they do not need to be removed). Single colonies that have undergone homologous recombination are identified by colony PCR using primers groA-test-F / gorA-test-R. The results of the colony PCR reaction are as follows: Figure 2As shown in B. The PCR product size of the selected single-clone colony was about 400 bp, which is consistent with the theoretical value. Sequencing further confirmed that the gorA gene was knocked out, and a double knockout strain of trxB and gorA was obtained, which was named ClearColi BL21(DE3)△trxB / gorA strain.

[0084] (6) Further sequencing was used to identify whether the ahpC gene in the ClearColi BL21(DE3)△trxB / gorA strain genome was mutated. PCR amplification was performed using the 5'ahpC-test and 3'ahpC-test as primers, with the ClearColi BL21(DE3)△trxB / gorA strain genome as a template. The obtained PCR products were then sequenced using the 5'ahpC-test and 3'ahpC-test as primers. The results are as follows: Figure 2 As shown in Figure C, a comparison of the genome sequence with that of the wild-type ClearColi BL21(DE3) strain revealed a deletion of amino acid F38 in the ahpC gene of the ClearColi BL21(DE3)△trxB / gorA genome. This deletion restored the normal viability of the ClearColi BL21(DE3)△trxB / gorA strain.

[0085] Table 2

[0086]

[0087]

[0088] Step 2: Plotting the growth curve of Escherichia coli ClearColi BL21(DE3) ΔtrxB / gorA strain

[0089] Wild-type ClearColi BL21(DE3), single colonies of ΔtrxB, ΔgorA, and ΔtrxB / gorA were picked and placed in 5 mL of liquid culture medium. Three replicates were set up and incubated at 37℃ and 220 rpm for 12 h. OD was measured every 2 h. 600 Values ​​are used to plot growth curves. The growth curve is shown below. Figure 2 As shown in D, the growth rate of the Escherichia coli ClearColi BL21(DE3)△trxB / gorA strain and the wild-type strain were similar, and the double knockout of the trxB and gorA genes did not affect the growth rate.

[0090] Step 3: Detection of expression of polydisulfide antifungal peptide MD in Escherichia coli ClearColi BL21(DE3)△trxB / gorA strain

[0091] Similarly, taking the polydisulfide bond antifungal peptide MD as an example, the secretory expression plasmid pET22b-SX-SUMO-MD constructed in the patent (application number: CN202210157023.8) was used to express the antifungal peptide MD in the Escherichia coli ClearColi BL21(DE3)△trxB / gorA strain to verify whether the double knockout of trxB and gorA genes has the effect of promoting the correct folding of polydisulfide bond proteins.

[0092] (1) The plasmid pET22b-SX-SUMO-MD was transformed into Escherichia coli ClearColi BL21(DE3)△trxB / gorA strain and cultured overnight at 37°C.

[0093] (2) Pick a single colony and culture it overnight in 5 mL of 2×YT medium. Then, transfer it 1:100 to an Erlenmeyer flask containing 100 mL of liquid LB medium and incubate at 37°C and 220 rpm until 0D. 600 When the concentration of antifungal peptide MD was approximately 0.6, IPTG was added to a final concentration of 0.5 mM for induction of expression. Simultaneously, plasmid pET22b-SX-SUMO-MD was transformed into *E. coli* Origami (DE3), *ClearColi* BL21 (DE3) wild-type, ΔtrxB, and ΔgorA strains using the same method for induction of expression. After 24 h of expression, the extracellular supernatant and intracellular samples were subjected to SDS-PAGE electrophoresis to detect the expression of the antifungal peptide MD in different strains.

[0094] (3) The results are as follows Figure 2 As shown in E and F, compared with wild-type *E. coli* strain ClearColi BL21(DE3), double knockout of the trxB and gorA genes significantly promoted the correct folding of the polydisulfide bond antifungal peptide MD and reduced the expression level of misfolded peptides. Moreover, both in the extracellular supernatant and intracellularly, the expression level of the antifungal peptide MD was higher in the ClearColi BL21(DE3)ΔtrxB / gorA strain than in oxidized *E. coli* Origami(DE3), indicating that the ClearColi BL21(DE3)ΔtrxB / gorA strain is more suitable for expressing polydisulfide bond proteins than Origami(DE3).

[0095] Example 3

[0096] Constructing an *E. coli* strain with triple deletion of the trxB, gorA, and lpp genes includes the following steps:

[0097] The ClearColi BL21(DE3)△trxB / gorA strain showed a significant effect in promoting the correct folding of the antifungal peptide MD, but a large amount of antifungal peptide MD remained intracellularly even 24 hours after expression. Therefore, to further promote the secretion of intracellularly expressed antifungal peptide MD into the extracellular supernatant of the ClearColi BL21(DE3)△trxB / gorA strain, the lpp gene in its genome was knocked out using CRISPR / Cas9 gene editing technology, with pCas and pTargetF plasmids used.

[0098] Step 1: Construction of the Escherichia coli ClearColi BL21(DE3)△trxB / gorA / lpp triple knockout strain

[0099] (1) First in http: / / crispor.tefor.net / The gRNA of the gene lpp was selected from the website: gaaagctactaaactggtac (SEQ ID NO.27), and it was constructed into the plasmid pTargetF, named pTargetF-lpp.

[0100] (2) Using the genome of *E. coli* ClearColi BL21(DE3) as a template, a first round of PCR was performed using 5'lpp-upstream / 3'lpp-upstream and 5'lpp-downstream / 3'lpp-downstream primers. A second round of overlap PCR was performed using the recovered product from the first round of PCR as a template, using 5'lpp-upstream / 3'lpp-downstream primers. The recovered second-round PCR product yielded a PCR product with 500bp lpp homologous arms at both ends (concentration greater than 100 ng / μL).

[0101] (3) The pCas plasmid was electroporated into ClearColi BL21(DE3)ΔtrxB / gorA competent cells (electroporation conditions: 1.8kV, 10μF, 600Ω). After overnight culture at 30℃ for about 15h, single colonies were picked and cultured overnight at 30℃ in 5mL of 2×YT medium. The next day, the cells were transferred to 50mL of LB medium at a transfer ratio of 1:100 and cultured until OD. 600 When the concentration was approximately 0.2, L-arabinose was added to a final concentration of 100 mM to induce expression for 1.5 h. After induction, the bacterial culture was incubated on ice for 30 min to prepare electrocompetent cells.

[0102] (4) Electroporate 10-15 μL of the PCR product from (2) and 100 ng of plasmid pTargetF-lpp into the electroporation competent cells prepared in (3). The electroporation conditions are: 1.8 kV, 10 μF, 600 Ω. Immediately after electroporation, add 1 mL of liquid 2×YT medium and incubate at 30℃ and 220 rpm for 1.5 h. Then, spread the mixture evenly on LB solid medium containing kanamycin (final concentration 50 mg / L) and spectinomycin (final concentration 100 mg / L) and incubate overnight at 30℃.

[0103] (5) After the colonies on the solid culture medium have grown to a certain size, single colonies that have undergone homologous recombination are identified by colony PCR using primers 5' lpp-upstream / 3' lpp-downstream. The results of the colony PCR reaction are as follows: Figure 3 As shown in A. The PCR product size of the selected single-clone colony was about 1000 bp, which is consistent with the theoretical value. Sequencing further confirmed that the lpp gene was knocked out, and a successful triple knockout strain of trxB, gorA and lpp was obtained, which was named ClearColi BL21(DE3)△trxB / gorA / lpp strain.

[0104] (6) Select a single clone of ClearColi BL21(DE3)△trxB / gorA / lpp strain and add it to 5 mL of liquid medium containing kanamycin. Incubate at 30°C until the logarithmic growth phase, then add IPTG to a final concentration of 0.5 mM and induce overnight (14-16 h). After induction, streak the mixture onto antibiotic-free solid plates and incubate overnight at 42°C. Once colony growth is obvious, test its sensitivity to kanamycin and spectinomycin to obtain the ClearColi BL21(DE3)△trxB / gorA / lpp strain without plasmid residue.

[0105] Step 2: Plotting the growth curve of *Escherichia coli* ClearColi BL21(DE3) ΔtrxB / gorA strain. Single colonies of ClearColi BL21(DE3) ΔtrxB / gorA and ΔtrxB / gorA / lpp were picked and placed in 5 mL of liquid culture medium. Three replicates were set up and cultured at 37℃ and 220 rpm for 12 h. OD was measured every 2 h. 600 Values ​​are used to plot growth curves. The growth curve is shown below. Figure 3 As shown in Figure B, the growth rates of the Escherichia coli ClearColi BL21(DE3) △trxB / gorA / lpp strain and the △trxB / gorA strain were similar, and the knockout of the lpp gene did not affect the growth rate of the △trxB / gorA strain.

[0106] Step 3: Detection of expression of antifungal peptide MD in Escherichia coli ClearColi BL21(DE3)△trxB / gorA strain

[0107] (1) The plasmid pET22b-SX-SUMO-MD was transformed into Escherichia coli ClearColi BL21(DE3)△trxB / gorA / lpp strain and cultured overnight at 37°C.

[0108] (2) Pick a single colony and culture it overnight in 5 mL of 2×YT medium. Then, transfer it 1:100 to an Erlenmeyer flask containing 100 mL of liquid LB medium and incubate at 37°C and 220 rpm until 0D. 600 When the pH reached approximately 0.6, IPTG was added to a final concentration of 0.5 mM for induction of expression. Simultaneously, plasmid pET22b-SX-SUMO-MD was transformed into *E. coli* Origami(DE3) and ΔtrxB / gorA strains using the same method for induction of expression. After 24 h of expression, the extracellular supernatant and intracellular samples were subjected to SDS-PAGE electrophoresis to detect the expression of the antifungal peptide MD in different strains.

[0109] (3) The results are as follows Figure 3 As shown in C and D, compared with the ClearColi BL21(DE3)△trxB / gorA strain, knockout of the lpp gene significantly promoted the extracellular secretion of the polydisulfide bond antifungal peptide MD, which was almost completely secreted into the extracellular supernatant 24 hours after expression. The expression level of the extracellular secreted antifungal peptide MD of the ClearColi BL21(DE3)△trxB / gorA / lpp strain was 2.7 and 1.8 times that of the Origami(DE3) and △trxB / gorA strains, respectively. In summary, this invention successfully knocked out the trxB and gorA genes in the genome of Escherichia coli ClearColi BL21(DE3) using Red homologous recombination technology and Crispr / Cas9 gene editing technology, and for the first time in the world, obtained an oxidized, endotoxin-free Escherichia coli ClearColi BL21(DE3)△trxB / gorA strain suitable for expressing polydisulfide bond proteins. Furthermore, the lpp gene in the genome of *E. coli* ClearColi BL21(DE3)△trxB / gorA strain was knocked out using CRISPR / Cas9 gene editing technology, resulting in an oxidized, endotoxin-free *E. coli* strain ClearColi BL21(DE3)△trxB / gorA / lpp suitable for secreting and expressing polydisulfide bond proteins. This strain, capable of efficiently and correctly folding polydisulfide bond proteins, has a clear genetic background, is endotoxin-free, and is simple to operate, low in cost, and suitable for widespread use.

[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A genetically engineered strain of *Escherichia coli*, characterized in that, This is a recombinant bacterium obtained by modifying the ClearColi BL21(DE3) Escherichia coli strain, wherein the modification is to inactivate the ClearColi BL21(DE3) Escherichia coli strain. trxB and gorA The gene is obtained as ClearColi BL21(DE3) △trxB / gorA, which lacks the F38 amino acid of the ahpC gene in the ClearColi BL21(DE3) △trxB / gorA genome; The trxB The nucleotide sequence is shown in SEQ ID NO.1; The gorA The nucleotide sequence is shown in SEQ ID NO.

2.

2. The genetically engineered Escherichia coli strain according to claim 1, characterized in that, Inactivation of the ClearColi BL21(DE3) Escherichia coli strain trxB and gorA This is to prevent the gene from expressing a product or to ensure that the expressed product has no function.

3. The genetically engineered Escherichia coli strain according to any one of claims 1-2, characterized in that, The inactivation refers to knockout. trxB and gorA Gene.

4. The genetically engineered Escherichia coli strain according to any one of claims 1-2, characterized in that, The modification also inactivated the ClearColi BL21(DE3) Escherichia coli strain. lpp Gene; The lpp The nucleotide sequence is shown in SEQ ID NO.

3.

5. The genetically engineered Escherichia coli strain according to claim 4, characterized in that, Inactivation of the ClearColi BL21(DE3) Escherichia coli strain trxB, gorA and lpp Genes are used to prevent the expression of their products or to prevent the expression of their products from having any function.

6. The genetically engineered Escherichia coli strain according to claim 4, characterized in that, The inactivation refers to knockout. trxB、 gorA and lpp Gene.

7. The use of the genetically engineered Escherichia coli strain according to any one of claims 1-6 in promoting the correct folding of polydisulfide proteins.

8. The use of the genetically engineered Escherichia coli strain according to any one of claims 1-6 in increasing the extracellular secretory expression of polydisulfide recombinant proteins.

Citation Information

Patent Citations

  • Antifungal peptide and preparation method thereof

    CN114560911A