Uses of leukotrienes in promoting erythroid cell maturation
By adding leukotrienes during the differentiation and culture of pluripotent stem cells or hematopoietic stem/progenitor cells, the maturation problem in the preparation of erythrocytes from pluripotent stem cells was solved, the maturation efficiency and yield of erythrocytes were improved, and the clinical application of erythrocytes was promoted.
Patent Information
- Application Number
- CN202211412603.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-11
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2042-11-11
AI Technical Summary
In existing technologies, the induction of pluripotent stem cells to produce red blood cells suffers from problems such as low cell expansion levels, low cell enucleation rates, and cell expression primarily of fetal hemoglobin, which limits the clinical application of red blood cells.
Adding leukotrienes (such as LTB4, LTC4, LTD4, LTE4) during the differentiation culture of pluripotent stem cells or hematopoietic stem/progenitor cells can promote the maturation of erythroid cells. By adding these compounds to the culture medium at specific stages, the maturation efficiency of erythroid cells can be significantly improved.
It significantly improves the maturation efficiency of erythroid cells, and the obtained erythroid cells can effectively treat or prevent diseases related to abnormal reduction of erythroid cells, thus promoting the clinical application of erythroid cells.
Smart Images

Figure SMS_2 
Figure HDA0003938695180000011 
Figure HDA0003938695180000012
Abstract
Description
Technical Field
[0001] This invention relates to the field of cell engineering, and more specifically, to the use of leukotrienes in promoting the maturation of erythroid cells. Background Technology
[0002] Red blood cells (RBCs) are one of the main components of blood, and their primary physiological function is to facilitate gas exchange between the body and the environment, providing oxygen to cells and tissues. They have significant clinical value, and red blood cell transfusion is a widely used clinical treatment. Currently, blood supply still relies on volunteer donations, resulting in a global shortage of RBCs. Furthermore, problems arising from blood storage, transfusion-related infectious diseases, and transfusion-related complications continue to threaten patients' lives and health. Therefore, extracorporeal blood preparation for clinical use has become a current focus of attention.
[0003] Stem cells are the most primitive, undifferentiated cells, characterized by continuous self-renewal and proliferation. Under certain conditions, they can differentiate into various tissue cells, providing new cells for tissues. To date, hematopoietic stem / progenitor cells (HSPCs) derived from umbilical cord blood, peripheral blood, and bone marrow, as well as pluripotent stem cells (PSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), have been shown to have the ability to differentiate into blood cells. Among these, PSCs, due to their ability to be cultured and expanded in vitro for extended periods and maintain their multipotent differentiation capacity, have become highly promising seed cells for applications.
[0004] The preparation of erythrocytes from pluripotent stem cells typically involves several stages: mesoderm, hematopoietic endothelium, hematopoietic stem / progenitor cells, erythroid-megakaryocytic co-progenitor cells, erythroid progenitor cells, and mature erythrocytes. The induction process is usually a staged protocol. As early as 2008, two reports confirmed that erythrocytes could be prepared by inducing human pluripotent stem cells (hESCs). One study by Ma et al. showed that, with the assistance of stromal cells, approximately 98% of erythrocytes induced in vitro by hESCs expressed adult hemoglobin (HbA). However, further research suggests that RBCs induced by hESCs or iPSCs are similar to those produced during yolk sac or fetal liver hematopoiesis, exhibiting lower cell expansion levels, lower enucleation rates, larger cell sizes, and primarily expressing fetal hemoglobin (HbF). These issues limit the clinical application of erythrocytes prepared from human pluripotent stem cells. Therefore, identifying and utilizing regulatory factors that can effectively improve erythroid differentiation and erythrocyte maturation will increase the yield and maturation level of erythrocytes derived from pluripotent stem cells, and promote the clinical application of artificial erythrocytes. Summary of the Invention
[0005] This application is based on the inventors' discoveries and understanding of the following facts and problems: RBCs have been in short supply worldwide, and exploring methods to effectively improve the enucleation and maturation of erythrocytes will increase the yield of erythrocytes prepared in vitro. After extensive experimental research, the inventors discovered that adding leukotrienes at appropriate stages during the differentiation and culture of pluripotent stem cells or hematopoietic stem / progenitor cells can effectively promote the maturation of erythroid cells obtained through induction, significantly improving the maturation efficiency of erythroid cells.
[0006] Therefore, in a first aspect, the present invention proposes the use of leukotrienes in promoting erythroid cell maturation. According to embodiments of the present invention, the leukotrienes can effectively promote erythroid cell maturation, improve the efficiency of erythroid cell maturation, and the resulting erythrocytes can effectively treat or prevent diseases related to abnormal erythroid cell reduction.
[0007] According to embodiments of the present invention, the above-described uses may further include at least one of the following additional technical features:
[0008] According to embodiments of the present invention, the leukotrienes include at least one of the following: LTB4, LTC4, LTD4, and LTE4.
[0009] According to an embodiment of the present invention, the erythroid cells include nucleated erythrocytes.
[0010] According to an embodiment of the present invention, the erythroid cells are nucleated erythrocytes obtained from stem cell differentiation.
[0011] According to an embodiment of the present invention, the erythroid cells include at least one of BFU-E, CFU-E, proerythrocytes, early erythroblasts, intermediate erythroblasts, late erythroblasts, and reticulocytes.
[0012] According to embodiments of the present invention, the stem cells include at least one of pluripotent stem cells and hematopoietic stem / progenitor cells.
[0013] According to embodiments of the present invention, the stem cells include at least one of human pluripotent stem cells and human hematopoietic stem / progenitor cells.
[0014] According to an embodiment of the present invention, the human pluripotent stem cells include human embryonic stem cells and / or human induced pluripotent stem cells.
[0015] According to an embodiment of the present invention, the human pluripotent stem cells are human embryonic stem cell line-H1.
[0016] According to an embodiment of the present invention, the human hematopoietic stem / progenitor cells are human umbilical cord blood hematopoietic stem / progenitor cells.
[0017] In a second aspect, the present invention provides the use of leukotrienes in the preparation of reagents. According to embodiments of the present invention, the reagent is used to promote the maturation of erythroid cells. As previously mentioned, leukotrienes can effectively promote the maturation of erythroid cells and improve the efficiency of erythroid cell maturation; therefore, the preparation containing leukotrienes also has the effect of promoting the maturation of erythroid cells and improving the efficiency of erythroid cell maturation.
[0018] According to embodiments of the present invention, the above-described uses may further include at least one of the following additional technical features:
[0019] According to embodiments of the present invention, the leukotrienes include at least one of the following: LTB4, LTC4, LTD4, and LTE4;
[0020] According to an embodiment of the present invention, the erythroid cells include nucleated erythrocytes.
[0021] According to an embodiment of the present invention, the erythroid cells are nucleated erythrocytes obtained from stem cell differentiation.
[0022] According to an embodiment of the present invention, the erythroid cells include at least one of BFU-E, CFU-E, proerythrocytes, early erythroblasts, intermediate erythroblasts, late erythroblasts, and reticulocytes.
[0023] According to embodiments of the present invention, the stem cells include at least one of pluripotent stem cells and hematopoietic stem / progenitor cells.
[0024] According to embodiments of the present invention, the stem cells include at least one of human pluripotent stem cells and human hematopoietic stem / progenitor cells.
[0025] According to an embodiment of the present invention, the human pluripotent stem cells include human embryonic stem cells and / or human induced pluripotent stem cells.
[0026] According to an embodiment of the present invention, the human pluripotent stem cells are human embryonic stem cell line-H1.
[0027] According to an embodiment of the present invention, the human hematopoietic stem / progenitor cells are human umbilical cord blood hematopoietic stem / progenitor cells.
[0028] In a third aspect, the present invention provides a culture medium system. According to embodiments of the present invention, the culture medium system includes an erythroid cell maturation medium and / or an induction differentiation medium, wherein the erythroid cell maturation medium and / or the induction differentiation medium contains leukotrienes. As mentioned above, leukotrienes can effectively promote the maturation of erythroid cells and improve the efficiency of erythroid cell maturation; therefore, the culture medium containing leukotrienes can effectively promote the maturation of erythroid cells.
[0029] According to embodiments of the present invention, the above-described culture medium system may further include at least one of the following additional technical features:
[0030] According to embodiments of the present invention, the leukotrienes include at least one of the following: LTB4, LTC4, LTD4, and LTE4.
[0031] According to an embodiment of the present invention, the leukotriene is LTB4.
[0032] According to embodiments of the present invention, the final concentration of the leukotrienes in the erythroid cell maturation medium and / or induction differentiation medium is 1-320 nM. According to some specific embodiments of the present invention, when the final concentration of leukotrienes in the erythroid cell maturation medium and / or induction differentiation medium is 1-320 nM, the efficiency of erythroid cell maturation is significantly improved.
[0033] According to an embodiment of the present invention, the erythroid cell maturation culture medium further comprises EPO and heparin.
[0034] According to an embodiment of the present invention, the final concentration of EPO in the erythroid cell maturation culture medium is 3-8 u / mL.
[0035] According to an embodiment of the present invention, the final concentration of heparin in the erythroid cell maturation culture medium is 1-6 u / mL.
[0036] According to an embodiment of the present invention, the erythroid cell maturation culture medium further includes a basic medium.
[0037] According to an embodiment of the present invention, the induction differentiation medium further comprises SCF, TPO, Flt3L, IL-3, VEGF, SB431542, EPO, and transferrin.
[0038] According to an embodiment of the present invention, the final concentration of SCF in the induced differentiation medium is 40-60 ng / mL.
[0039] According to an embodiment of the present invention, the final concentration of TPO in the induction differentiation medium is 10-30 ng / mL.
[0040] According to an embodiment of the present invention, the final concentration of Flt3L in the induced differentiation medium is 10-30 ng / mL.
[0041] According to an embodiment of the present invention, the final concentration of IL-3 in the induced differentiation medium is 10-30 ng / mL.
[0042] According to an embodiment of the present invention, the final concentration of VEGF in the induced differentiation medium is 10-30 ng / mL.
[0043] According to an embodiment of the present invention, the final concentration of SB431542 in the induction differentiation medium is 5-15 μM.
[0044] According to an embodiment of the present invention, the final concentration of EPO in the induced differentiation medium is 3-6 u / mL.
[0045] According to an embodiment of the present invention, the final concentration of transferrin in the induction differentiation medium is 80–110 μg / mL.
[0046] According to an embodiment of the present invention, the differentiation-inducing medium further comprises BEL basal medium.
[0047] In a fourth aspect, the present invention provides a method for inducing the maturation of erythroid cells. According to an embodiment of the invention, the method includes: 1) culturing the erythroid cells in an induction differentiation medium within the culture medium system described in the third aspect to obtain differentiated cells; 2) culturing the differentiated cells in an erythroid cell maturation medium within the culture medium system described in the third aspect to obtain matured erythroid cells. As mentioned above, leukotrienes can effectively promote the maturation of stem cell-derived erythroid cells, improving the maturation efficiency of stem cell-derived erythroid cells. Therefore, the method according to the embodiments of the present invention can effectively promote the maturation of stem cell-derived erythroid cells and improve the maturation efficiency of stem cell-derived erythroid cells.
[0048] According to embodiments of the present invention, the above method may further include at least one of the following additional technical features:
[0049] According to an embodiment of the present invention, the erythroid cells are nucleated erythrocytes obtained from stem cell differentiation.
[0050] According to an embodiment of the present invention, the erythroid cells include at least one of BFU-E, CFU-E, proerythrocytes, early erythroblasts, intermediate erythroblasts, late erythroblasts, and reticulocytes.
[0051] According to embodiments of the present invention, the stem cells include at least one of pluripotent stem cells and hematopoietic stem / progenitor cells.
[0052] According to embodiments of the present invention, the stem cells include at least one of human pluripotent stem cells and human hematopoietic stem / progenitor cells.
[0053] According to an embodiment of the present invention, the human pluripotent stem cells include human embryonic stem cells and / or human induced pluripotent stem cells.
[0054] According to an embodiment of the present invention, the human pluripotent stem cells are human embryonic stem cell line-H1.
[0055] According to an embodiment of the present invention, the human hematopoietic stem / progenitor cells are human umbilical cord blood hematopoietic stem / progenitor cells.
[0056] In a fifth aspect, the present invention provides the use of leukotrienes in the preparation of a medicament for treating or preventing diseases related to abnormal erythropoiesis. As previously stated, leukotrienes can effectively promote the maturation of erythroid cells and improve the efficiency of erythroid cell maturation. Therefore, a medicament containing said leukotrienes can effectively promote the maturation of erythroid cells, improve the efficiency of erythroid cell maturation, and effectively treat or prevent diseases related to abnormal erythropoiesis.
[0057] According to embodiments of the present invention, the above-mentioned pharmaceutical use may further include at least one of the following additional technical features:
[0058] According to an embodiment of the present invention, the erythroid cell-related diseases include at least one of leukemia, lymphoma, myelodysplastic syndrome, multiple myeloma, thalassemia, combined immunodeficiency disease, connective tissue disease, aplastic anemia, hemoglobinuria, lower limb ischemia, and erythropoiesis.
[0059] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description
[0060] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:
[0061] Figure 1 The present invention describes the differentiation process of pluripotent stem cells into erythroid cells, including a first stage (Stage 1) to a fourth stage (Stage 4), starting from Day 1 and culturing for 18 days (Day 18).
[0062] Figure 2 This is a flow cytometry analysis result of the level of erythrocyte enucleation at Day 18 of pluripotent stem cell culture induced according to an embodiment of the present invention.
[0063] Figure 3 This is a graph showing the results of cell staining analysis of erythrocyte enucleation level at Day 18 of pluripotent stem cell culture induced according to an embodiment of the present invention.
[0064] Figure 4 This is a graph showing the results of real-time quantitative PCR analysis of adult beta-globin expression in erythrocytes when pluripotent stem cells were cultured and induced to Day 18 with the addition of LTB4 according to an embodiment of the present invention. In this graph, D18 represents the result on day 18 of the group without LTB4 and D18+LTB4 represents the result on day 18 of the group with LTB4.
[0065] Figure 5 The present invention describes the differentiation process of human umbilical cord blood hematopoietic stem / progenitor cells into erythroid cells, including the first stage (Stage 1) to the third stage (Stage 3), starting from Day 1 and culturing for 21 days (Day 18+3).
[0066] Figure 6 This is a flow cytometry analysis result of surface markers and erythrocyte enucleation level of erythrocytes obtained after 21 days of human umbilical cord blood hematopoietic stem / progenitor cell induction according to an embodiment of the present invention.
[0067] Figure 7 This is a diagram showing the staining analysis results of red blood cells obtained after 21 days of induction with human umbilical cord blood hematopoietic stem / progenitor cells according to an embodiment of the present invention.
[0068] Figure 8 This is a graph showing the results of real-time quantitative PCR analysis of human alpha (α) and beta (β) globin expressed in erythrocytes obtained after 21 days of induction of human umbilical cord blood hematopoietic stem / progenitor cells according to an embodiment of the present invention. In this graph, relative expression represents the relative expression level. Detailed Implementation
[0069] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.
[0070] In this application, the term "leukotrienes" refers to a group of substances produced by the metabolism of arachidonic acid via the 5-lipoxygenase pathway. Leukotrienes are produced by leukocytes and possess a conjugated triene structure, including leukotriene A4 (LTA4), leukotriene B4 (LTB4), leukotriene C4 (LTC4), leukotriene D4 (LTD4), and leukotriene E4 (LTE4). The molecular formula of LTA4 is C0. 20 H 30 O3 has a molar mass of 318.45; LTB4 has the molecular formula C 20 H 32 O4 has a molar mass of 336.46; LTC4 has the molecular formula C 30 H 47 N3O9S has a molar mass of 625.775; LTD4 has the molecular formula C 25 H 40 N2O6S has a molar mass of 496.66.
[0071] In this application, the "first stage of pluripotent stem cell differentiation into erythroid cells" refers to the stage of pluripotent stem cells differentiating into mesodermal cells; the "second stage of pluripotent stem cell differentiation into erythroid cells" refers to the stage of mesodermal cells differentiating into hematopoietic endothelial cells; the "third stage of pluripotent stem cell differentiation into erythroid cells" refers to the stage of hematopoietic endothelial cells differentiating into erythroblasts; and the "fourth stage of pluripotent stem cell differentiation into erythroid cells" refers to the stage of erythroblasts differentiating into erythrocytes.
[0072] The following is a detailed description of the embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0073] Example 1: Effect of LTB4 on the maturation of hESC-H1 derived erythroid cells
[0074] In this embodiment, the inventors simulated the process of erythrocyte development in the human body by adding small molecules or cytokines at different stages, thereby promoting the differentiation of hESC-H1 into erythrocytes through hematopoietic endothelial cells, hematopoietic stem / progenitor cells, erythroid progenitor cells, and erythroblasts, inducing the system as follows: Figure 1As shown, LTB4 was added in the fourth stage of the induction system to detect the effect of LTB4 on the maturation of erythroid cells derived from hESC-H1. Flow cytometry and cell staining were used to observe and analyze erythrocyte enucleation, and real-time quantitative PCR was used to analyze the expression of adult-type beta-globin in erythrocytes. The experimental groups (those inducing LTB4 in the fourth stage, and those in the H1-LTB4 group) were compared. + The function of LTB4 was analyzed by comparing the maturation levels of erythrocytes in the control group (without LTB4, H1-CON).
[0075] The specific experimental procedure is as follows:
[0076] 1.1hESC-H1 induction culture
[0077] 1) Resuscitate hESC-H1 (purchased from WiCell, USA) in 6-well plates and culture in mTeSR Plus medium. After passage 2-3 times, when the cells grow to a suitable density, subsequent in vitro induction can be performed.
[0078] 2) When the undifferentiated wild-type H1 cells of hESC-H1, which are routinely cultured in 6-well plates, grow to 70%-80% confluence, discard the old culture medium and wash the cells once with 1 mL PBS.
[0079] 4) Add 500 μL of Accutase to each well of the 6-well plate containing cells obtained in step 2) and digest in an incubator at 37°C for 3 min;
[0080] 5) After digestion, gently tap the edge of the 6-well culture plate to encourage cells to detach from the bottom of the plate;
[0081] 6) Add the cells obtained in step 5) to 3 mL of mTeSR Plus medium to terminate digestion;
[0082] 7) Transfer the mixture containing cells obtained in step 6) to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 min at room temperature to obtain cells;
[0083] 8) Simultaneously prepare mTeSR Plus medium containing 10 μM Y27632;
[0084] 9) Resuspend the cells obtained in step 7) in 1 mL of mTeSR Plus containing 10 μM Y27632, and count them;
[0085] 10) Using 2x10 5The cells obtained in step 9) were seeded at a density of / mL and added to each well of a low-adsorption 6-well plate. 3mL of mTesR Plus containing 10μM Y27632 was added, which was recorded as Day-1. The plate was then placed in a constant temperature incubator at 37℃ and 5% CO2 for 24h.
[0086] 11) After the culture in step 10) is completed, centrifuge at 1000 rpm for 5 min at room temperature to obtain cells;
[0087] 12) Record the time when the cells obtained in step 11) are replaced with the first-stage induction medium as Day 0;
[0088] 13) After culturing the above cells for two days in the first-stage induction medium, centrifuge them at 1200 rpm for 5 minutes at room temperature to obtain cells, which is recorded as Day 2.
[0089] 14) Replace the cells obtained in step 13) with the second-stage induction medium and change the medium daily. After four days of culture, centrifuge at 1400 rpm for 5 minutes at room temperature to obtain the cells. This is recorded as Day 6.
[0090] 15) Replace the cells obtained in step 14) with the third stage culture medium and change the medium every other day. On the second day after changing the medium, add 2 mL of medium. After culturing for nine days, filter the cells through a 100 μm sieve, discard the remaining EB beads, and centrifuge at 1600 rpm for 5 min at room temperature to obtain the cells. This is recorded as Day 15.
[0091] 16) Using 2x10 5 The cells obtained in step 15) were seeded at a density of / mL into a standard 6-well plate. 3mL of stage IV culture medium was added to each well. The medium was replenished as needed. After three days of culture, it was recorded as Day 18.
[0092] The culture media used in each culture stage of the experimental group are as follows:
[0093] Stage 1 induction medium: Advanced D / F12 basal medium, AA2P (50 μg / mL), bFGF (25 ng / mL), BMP4 (25 ng / mL), Activin A (25 ng / mL), Glutamax (1X), P / S (1X).
[0094] Stage 2 induction medium: Advanced D / F12 basal medium, AA2P (50 μg / mL), bFGF (25 ng / mL), VEGF (50 ng / mL), SB431542 (5 μM), Glutamax (1X), P / S (1X).
[0095] Stage 3 induction medium: BEL basal medium (200 mL), SCF (50 ng / mL), TPO (20 ng / mL), Flt3L (20 ng / mL), IL-3 (20 ng / mL), VEGF (20 ng / mL), SB431542 (10 μM), EPO (Pepro Tech) (5 u / mL), transferrin (100 μg / mL); wherein, the BEL basal medium includes: IMDM (91 mL), F12 (91 mL), 10% Deionized BSA (5 mL), Lindeic acid (20 μL), Linolenic acid (20 μL), AA2P (2 mL), Synthetic chol (400 μL), α-MTG (7.8 μL), GlutaMax (2 mL), P / S (1 mL), Protein-free hybHdonta mix (PFHM) (10 mL), Insulin-transferrin selenium (ITS) (2 mL).
[0096] Stage 4 maturation medium: Basic medium (200 mL), EPO (pepro Tech) (5 u / mL), heparin (3 u / mL); wherein, the Basic medium includes: IMDM (91 mL), F12 (91 mL), AB serum (5 mL), Linoleic acid (20 μL), linolenic acid (20 μL), AA2P (2 mL), Synthechol (400 μL), α-MTG (7.8 μL), GlutaMAX (2 mL), P / S (1 mL), PFHM (10 mL), ITS (2 mL), and LTB4 (300 nM).
[0097] In this embodiment, the control group did not have LTB4 added to the fourth-stage induction medium. In addition, the components and concentrations of the first, second, and third-stage induction mediums, as well as other components and concentrations in the fourth-stage induction medium, were the same as those of the experimental group.
[0098] 1.2 Flow cytometry detection
[0099] Cells collected on day 18 during the induction process in step 1.1 (experimental group, H1-LTB4) were selected. + Cells and cells without LTB4 added during induction (control group, H1-CON) were analyzed by flow cytometry. The specific experimental procedures are as follows:
[0100] 1) After blowing the cell clumps collected on Day 18 evenly, take 1 mL of culture medium containing cells, centrifuge at 1000 rpm for 5 min at room temperature, and discard the supernatant;
[0101] 2) Add the cell clusters obtained in step 2) to 500 μL of Accutase digestion solution, mix well by pounding, and digest in an incubator at 37°C for 3 min;
[0102] 3) After the above digestion process is completed, the cells are blown around again to promote the digestion of cell clumps into single cells;
[0103] 4) Add 1 mL of culture medium to a single cell to stop digestion, and transfer the cells to a 15 mL centrifuge tube containing 8 mL of PBS. Centrifuge at 1000 rpm for 5 min at room temperature.
[0104] 5) After centrifuging the product obtained in step 4), discard the supernatant and resuspend the cells in 100 μl PBS in a 1.5 ml EP tube;
[0105] 6) Label the cells with the corresponding flow cytometry antibody and incubate them at 4°C for 30 min. After incubation, wash the cells twice with 1 mL PBS and resuspend the cells in 300 μl PBS.
[0106] 8) After resuspending the cells in step 7), pass them through a sieve and place them in a flow cytometer for testing.
[0107] 1.3 Wright-Gymsa staining
[0108] 1) Use a cell smear machine ( After assembling the Cytocentrifuge Rotor (a special centrifuge cup), glass slides, and absorbent paper together, place them into the cell smear machine;
[0109] 2) Take 5 x 10 5 Cells obtained in Experiment 1.1 were resuspended in 500 μL PBS;
[0110] 3) Add 50 μL of the resuspended cell suspension to a centrifuge cup;
[0111] 4) Centrifuge at 800 rpm for 3 minutes at room temperature;
[0112] 5) Remove the slide and observe under a microscope whether the cell density is suitable;
[0113] 6) Draw a closed circle around the cell using an immunohistochemistry pen;
[0114] 7) Add dye solution A (Wright's dye, Giemsa dye) and time for 1 minute;
[0115] 8) Add B staining solution (phosphate), mix well, and time for 9 minutes;
[0116] 9) Rinse off the stain with clean water, being careful not to rinse the cells directly;
[0117] 10) Dry the slide, observe and photograph it under a microscope to analyze the enucleation of red blood cells.
[0118] 1.4 RNA extraction
[0119] 1) Add 1 mL of Trizol to each 1.5 mL EP tube of cells and repeatedly pipette until the cells detach. Let stand at room temperature for 5-10 min.
[0120] 2) Add 0.2 mL of CHCl4 to each ml of Trizol, shake vigorously for 15 seconds, and let stand at room temperature for 10 minutes;
[0121] 3) Centrifuge the product from step 2) at 4℃ and 12000 rpm for 15 min, and collect the supernatant;
[0122] 4) Add 0.5 mL of isopropanol (pre-cooled) to the supernatant above, manually invert, let stand at 4℃ for 10 min, centrifuge at 12000 rpm at 4℃ for 10 min to discard the supernatant, and wash the precipitate once with 1 mL of 75% ethanol.
[0123] 5) After aspirating the supernatant, place the precipitate in a clean bench and dry it until it is translucent. Then dissolve the RNA in 100 μl of DEPC water.
[0124] 6) Store the product obtained in step 5) at -80℃ for later use.
[0125] 1.5 Reverse Transcription Reaction
[0126] The RNA obtained in Experiment 1.4 was subjected to a reverse osmosis reaction. The specific experimental procedures and reaction conditions are as follows:
[0127] 1) The reaction system for reverse transcription is shown in Table 1, where RNA concentration: A (ng / μL); RNA volume: B (μL) = (800ng / A).
[0128] Table 1
[0129]
[0130] 2) RNA + DEPC water pre-denaturation, specifically: take it out and place it on ice, add MIX and mix well, centrifuge, put it in a PCR instrument for reverse transcription, and perform it at 65℃ for 5 min;
[0131] 3) Set the PCR instrument program to 37℃ for 15 min, 50℃ for 5 min, 98℃ for 5 min, and 4℃ hold;
[0132] 4) Store the product obtained in step 3) at -20℃ for later use.
[0133] 1.6 Real-time quantitative PCR
[0134] The product obtained in Experiment 1.5 was subjected to PCR amplification. The specific operation and reaction conditions are as follows:
[0135] 1) The reaction system for qRT-PCR is shown in Table 2.
[0136] Table 2
[0137] reagents Volume μL THUNDERBIRD SYBR qPCR Mix 10 DEPC water 8 upstream primer 0.5 Downstream primer 0.5 cDNA 1 total 20
[0138] 2) Set the PCR instrument program to 95℃ for 3 min, 94℃ for 20 s, 58℃ for 20 s, 72℃ for 30 s, and repeat for 40 cycles.
[0139] 3) The primer sequences required for real-time quantitative PCR detection are shown in Table 3.
[0140] Table 3
[0141] α-globin F CAACTTCAAGCTAAGCCACTGC(SEQ ID NO:1) α-globin R CGGTGCTCACAGAAGCCAG(SEQ ID NO:2) β-globin F AGGAGAAGTCTGCCGTTACTG(SEQ ID NO:3) β-globin R CCGAGCACTTTCTTGCCATGA(SEQ ID NO:4)
[0142] 1.7 Analysis of Experimental Results
[0143] Specific experimental results are as follows Figure 2-4 As shown, in the experimental group, LTB4 was added during the fourth stage of inducing erythroid differentiation of human embryonic stem cells H1, while a control group without LTB4 was set up. On day 18 of induction, flow cytometry and cell staining were used to analyze erythrocyte enucleation, and PCR was used to detect the expression of beta-globin in the obtained erythrocytes. Among these, [the following text appears to be incomplete and requires further context: "from..."] Figure 2 It can be seen that by day 18 of culture, the proportion of Syto16-negative red blood cells, which represent cell enucleation, in the experimental group was significantly higher than that in the control group, and the enucleation rate was 160 times that of the control group. Figure 3 The experimental results showed that, after inducing human embryonic stem cells H1 to day 18, obvious anucleated red blood cells appeared in the experimental group, while almost no anucleated red blood cells were detected in the control group. Figure 4 The experimental results showed that, after staged induction of erythroid differentiation in human embryonic stem cells H1, the expression of human-type globin—beta(β) globin—was significantly increased in the experimental group compared to the control group by day 18. In conclusion, adding 300 nM LTB4 to the fourth stage of the existing pluripotent stem cell erythroid induction culture system can significantly promote the maturation of erythrocytes derived from pluripotent stem cells.
[0144] Example 2: Effect of LTB4 on the maturation of erythroid cells derived from human umbilical cord blood hematopoietic stem / progenitor cells
[0145] In this embodiment, the inventors simulated the development process of red blood cells in the human body by adding small molecules or cytokines at different stages, thereby inducing human umbilical cord blood hematopoietic stem / progenitor cells to differentiate into erythrocytes through erythroid progenitor cells and erythroblasts, and the induction system was as follows: Figure 5 As shown, LTB4 or the LTB4 receptor inhibitor LY255283 was added in the third stage of the induction system to detect the effect of LTB4 on the maturation of erythroid cells derived from human umbilical cord blood hematopoietic stem / progenitor cells. The enucleation of erythrocytes was observed and analyzed by flow cytometry and cell staining. The expression of adult beta-globin in erythrocytes was analyzed by real-time quantitative PCR. The experimental group (with LTB4 added in the third stage of induction) was compared with the control group. + The function of LTB4 was analyzed by comparing the maturation levels of erythrocytes in the control group (without LTB4, CON) and the inhibitor group (with the LTB4 receptor inhibitor LY255283). The specific experimental procedure is as follows:
[0146] 2.1 CB-MNCs induce differentiation into erythrocytes
[0147] 1) The purchased cord blood mononuclear cells (purchased from the Beijing Cord Blood Bank) were processed at a ratio of 2 x 10-1 6 / wells were seeded in a low-adsorption 6-well plate and cultured in Stage 1 amplification medium, denoted as D0;
[0148] 2) Depending on the specific situation, replace half the liquid or centrifuge at 2000 rpm for 5 minutes at room temperature and then replace the liquid;
[0149] 3) Culture the above cells for 7 days, centrifuge at 2000 rpm for 5 minutes, then replace with Stage 2 induction medium, using 2x10 6 / wells were seeded in a low-adsorption 6-well plate and denoted as D7;
[0150] 4) Depending on the specific situation, replace half the liquid or centrifuge at 2000 rpm for 5 minutes at room temperature and then replace the liquid;
[0151] 5) Continue cell culture as described in step 3) for 7 days, centrifuge at 2000 rpm for 5 minutes, then replace with dexamethasone-free Stage 2 induction medium, using 2 x 10⁻⁶ cells / mL. 6 / wells are seeded in a low-adsorption 6-well plate and denoted as D14.
[0152] 6) Depending on the specific situation, replace half the liquid or centrifuge at 2000 rpm for 5 minutes at room temperature and then replace the liquid;
[0153] 7) On day 18 of culture, centrifuge the cells at 2000 rpm for 5 minutes and replace with Stage 3 enucleation medium, using 5 x 10⁻⁶ cells / mL. 6 / wells were inoculated into a standard 6-well plate and cultured for 3 days, denoted as D21.
[0154] The reagents used in each culture stage are as follows:
[0155] Stage 1 amplification medium: Add 100 ng / mL SCF, 10 ng / mL TPO, 20 ng / mL IL-3, 10 ng / mL IL-6, 100 ng / mL Flt3-L, 1 μM SR1, and 1X P / S to StemSpan basal medium.
[0156] Stage 2 induction medium: Add 100 ng / mL SCF, 40 ng / mL LIGF-1, 5 U / mL LEPO, 2 mM Glutamax, 40 μg / mL lipids, 100 μg / mL transferrin, 1×P / S, and 1 μM dexamethasone to Stem Span II basal medium.
[0157] Stage 3 nucleus removal medium: 95% IMDM basal medium, 3 U / mL heparin, 1×ITS, 5 U / mLEPO, 5% AB serum.
[0158] 2.2 Detection of erythrocytes derived from human umbilical cord blood hematopoietic stem / progenitor cells
[0159] In this experiment, flow cytometry, cell staining, and real-time quantitative PCR were used to analyze the enucleation status and hemoglobin expression of erythrocytes derived from human umbilical cord blood hematopoietic stem / progenitor cells obtained in section 2.1. For specific operating methods, please refer to Example 1.
[0160] 2.3 Analysis of Experimental Results
[0161] Specific experimental results are as follows Figure 6-8 As shown, LTB4 was added to the experimental group during the third stage of inducing erythroid differentiation of umbilical cord blood hematopoietic stem / progenitor cells. A control group without LTB4 and an inhibitor group with the LTB4 receptor inhibitor LY255283 were also included. On day 21 of induction, erythrocyte enucleation was analyzed by flow cytometry and cell staining, and PCR was used for detection. Among them, [the following data is missing from the original text]. Figure 6 It can be seen that by day 21 of culture, the proportion of Syto16-negative red blood cells, which represent cell enucleation, was higher in the experimental group than in the control group, while the proportion of enucleated cells in the inhibitor group decreased significantly. Figure 7The experimental results showed that, after inducing umbilical cord blood hematopoietic stem / progenitor cells to day 21, the proportion of anucleated red blood cells in the experimental group was higher than that in the control group, while the proportion of anucleated red blood cells in the control group was higher than that in the inhibitor group. Figure 8 The experimental results showed that, after staged induction of erythroid differentiation in human umbilical cord blood hematopoietic stem / progenitor cells, by day 21 of culture, the expression of human-type globin—beta-globin—was significantly increased in the experimental group compared to the control group, while there was no significant difference in beta-globin expression in the inhibitor group. In conclusion, adding 300 nM LTB4 to the third stage of the existing human umbilical cord blood hematopoietic stem / progenitor cell erythroid induction culture system can significantly promote the maturation of pluripotent stem cell-derived erythrocytes, and the maturation effect is significantly better than that of the LTB4 receptor inhibitor LY255283.
[0162] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.
[0163] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.
Claims
1. Use of leukotrienes in promoting erythroid cell maturation in vitro; wherein the leukotriene is LTB4; The erythroid cells are nucleated erythrocytes obtained by differentiation of stem cells, and the stem cells are selected from at least one of human pluripotent stem cells and human hematopoietic stem / progenitor cells. The human pluripotent stem cells are human embryonic stem cell line-H1, and the human hematopoietic stem / progenitor cells are human umbilical cord blood hematopoietic stem / progenitor cells. The final concentration of the leukotrienes in the erythroid cell maturation medium is 1-320 nM.
2. Use of leukotrienes in the preparation of reagents for promoting the maturation of erythroid cells, wherein the leukotrienes are LTB4; The erythroid cells are nucleated erythrocytes obtained by differentiation of stem cells, and the stem cells are selected from at least one of human pluripotent stem cells and human hematopoietic stem / progenitor cells. The human pluripotent stem cells are human embryonic stem cell line-H1, and the human hematopoietic stem / progenitor cells are human umbilical cord blood hematopoietic stem / progenitor cells.
3. A culture medium system, characterized in that, It includes an erythroid cell maturation medium and an induction differentiation medium, wherein the erythroid cell maturation medium contains leukotrienes, and the leukotrienes are LTB4; The final concentration of the leukotrienes in the erythroid cell maturation medium was 1-320 nM; The erythroid cells are nucleated erythrocytes differentiated from stem cells, and the stem cells are selected from at least one of human pluripotent stem cells and human hematopoietic stem / progenitor cells. The human pluripotent stem cells are human embryonic stem cell line-H1, and the human hematopoietic stem / progenitor cells are human umbilical cord blood hematopoietic stem / progenitor cells.
4. The culture medium system according to claim 3, characterized in that, The erythroid cell maturation medium further includes EPO and heparin; Optionally, in the erythroid cell maturation medium, the final concentration of EPO is 3-8 u / mL; Optionally, in the erythroid cell maturation culture medium, the final concentration of heparin is 1-6 u / mL; Optionally, the erythroid cell maturation culture medium also includes a basic medium.
5. The culture medium system according to claim 3 or 4, characterized in that, The induction differentiation medium includes SCF, TPO, Flt3L, IL-3, VEGF, SB431542, EPO, and transferrin; Optionally, in the induction differentiation medium, the final concentration of the SCF is 40-60 ng / mL; Optionally, in the induction differentiation medium, the final concentration of TPO is 10-30 ng / mL; Optionally, in the induction differentiation medium, the final concentration of Flt3L is 10~30 ng / mL; Optionally, in the induction differentiation medium, the final concentration of IL-3 is 10~30 ng / mL; Optionally, in the induction differentiation medium, the final concentration of VEGF is 10-30 ng / mL; Optionally, in the induction differentiation medium, the final concentration of SB431542 is 5~15 µM; Optionally, in the induction differentiation medium, the final concentration of EPO is 3-8 u / mL; Optionally, in the induction differentiation medium, the final concentration of the transferrin is 80-120 µg / mL; Optionally, the induction differentiation medium further comprises BEL basal medium.
6. A method for inducing erythroid cell maturation, characterized in that, include: 1) The erythroid cells are cultured in the induction differentiation medium of any one of the culture medium systems described in claims 3 to 5 to obtain differentiated cells; 2) The differentiated cells are cultured in the erythroid cell maturation medium of any one of the culture medium systems of claims 3 to 5 in order to obtain the matured erythroid cells; The erythroid cells are nucleated erythrocytes obtained by differentiation of stem cells, and the stem cells are selected from at least one of human pluripotent stem cells and human hematopoietic stem / progenitor cells. The human pluripotent stem cells are human embryonic stem cell line-H1, and the human hematopoietic stem / progenitor cells are human umbilical cord blood hematopoietic stem / progenitor cells.
Citation Information
Patent Citations
Method for promoting directional differentiation and maturation of stem cells to erythroid cells and application
CN114438036A