A method for creating a new type of two-line sterile line of rice based on gene editing technology

Abstract

The application provides a method for creating a new type of two-line sterile line of rice based on a gene editing technology, and belongs to the fields of genetic engineering and crop genetic breeding. The method of the application is for site-specific editing of a indica-japonica hybrid embryo sac abortion gene S5 in a two-line sterile line of rice by using CRISPR / Cas9 technology, and knocking out the S5 gene of the rice by causing a frame shift mutation of the S5. The application overcomes the sterility of indica-japonica subspecies hybrid, and makes it possible for the hybrid vigor of indica-japonica rice subspecies hybrid to be applied in hybrid rice, and has a good development and application prospect.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering and the field of crop genetic breeding, and relates to a method for creating a new type of two-line sterile line of rice based on gene editing technology. BACKGROUND

[0002] Rice is one of the most important food crops in the world and also the most important food crop in China. With the continuous increase of population and the continuous reduction of arable land, how to improve the yield of rice has become a problem to be solved by scholars. In 1987, Yuan Longping proposed hybrid rice, and research on two-line method hybrid rice based on photoperiod and temperature sensitive genic male sterile rice (hereinafter referred to as "two-line sterile line") was rapidly developed, and significant breakthroughs have been made in the breeding, popularization and application of two-line hybrid rice. However, the preparation of hybrid rice is mainly based on intrasubspecific hybridization, i.e. indica-indica hybridization, while intersubspecific hybridization has not been broken through. The F1 offspring produced by indica rice and japonica rice hybridization has strong heterosis, mainly in the aspects of tall plants, well-developed root systems, and vigorous tillering; however, due to reproductive isolation between indica rice and japonica rice, the fertility of the small spike of the hybrid F1 is very low, thereby hindering the utilization of intersubspecific heterosis, which is also the reason why two-line method cannot break through subspecific hybridization.

[0003] In the "two-line method", breeding sterile lines with excellent traits is the core and difficulty of hybrid rice, and molecular marker assisted selection plays an important role. Molecular marker assisted selection is to select individuals using molecular markers that are closely linked or co-segregated with the target gene. Through systematic selfing and backcrossing, molecular markers are used to determine whether the material contains the desired target gene at the molecular level, thereby allowing donor chromosomal fragments to be introduced into the recipient parent. It is an effective means of applying molecular markers to selection in the process of crop improvement. Traditional rice breeding indirectly selects genotypes by observing phenotypes, which takes a long time and is affected by many factors, and is blind and unpredictable; while molecular marker assisted selection is not affected by other gene effects and environmental factors, and is a selection at the molecular level of target traits, and the selection result is reliable, but these materials often contain many unfavorable genes, some of which are linked to the target gene, and it is difficult to break the linkage through conventional methods. But these materials often contain many unfavorable genes, some of which are linked to the target gene, and it is difficult to break the linkage through conventional methods.

[0004] CRISPR-Cas9 gene editing technology can directly modify the genes of target traits, with simple operation, high knockout efficiency, short breeding cycle, and can greatly improve the precision of target trait aggregation, thereby accelerating the breeding process. At present, the use of CRISPR / Cas9 technology has made important progress in improving the yield, quality, resistance, fertility, and plant type of rice. The application of gene editing technology in crop genetic improvement is mainly through the site-directed mutation of target genes to cause gene function loss to achieve trait improvement, so the knocked-out genes must be negative regulatory genes of target traits. S5 is a representative site that controls the female gamete abortion of indica-japonica hybrid F1, which encodes an aspartic protease, and the S5-n of wide compatibility variety lacks 136bp at the 5' end of the coding region, resulting in the loss of signal peptide, thereby causing changes in protein localization and loss of function. By gene editing of the S5 site of the two-line sterile line, the F1 hybridized with indica rice and japonica rice is normal and fertile, so that the hybrid vigor between subspecies can be utilized in the two-line sterile line combination. SUMMARY

[0005] The purpose of the present application is to overcome the sterility of indica-japonica subspecies hybrid by providing a method for creating a new two-line sterile line of rice based on gene editing technology, so as to utilize the strong hybrid vigor between indica and japonica subspecies to improve rice yield.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0007] A method for creating a new two-line sterile line of rice based on gene editing, which uses CRISPR / Cas9 technology to edit the indica-japonica hybrid embryo sac abortion gene S5 in two-line sterile line rice, causes frameshift mutation of S5, knocks out the S5 gene of rice, and obtains a two-line sterile line of rice with wide compatibility characteristics.

[0008] Further, the method for creating a new two-line sterile line of rice based on gene editing comprises the following steps: designing two pairs of target points for the signal peptide coding region of the S5 gene of the two-line sterile line, constructing a pCRISPR / Cas9-S5-gRNA recombinant expression vector containing the target point sequence, transforming the two-line sterile line of rice with the recombinant expression vector using the Agrobacterium-mediated method, causing the signal peptide of the S5 gene in the two-line sterile line to be deleted or causing the function of the gene to be lost, thereby obtaining a two-line sterile line of rice with wide compatibility characteristics.

[0009] Further, the two-line sterile line is Bph68S.

[0010] Further, the two pairs of target points are target points 1 and 2, and target points 3 and 4, and their sequences are as follows:

[0011] 1) Target 1: TACTCAGGGGCAGGATTCGT

[0012] 2) Target 2: GTAGCAGCTGCAGCTGCAAC;

[0013] 3) Target 3: AGTCATTGTTACTCAGGGGC,

[0014] 4) Target 4: GGGACACTCCAACTCGTCGT.

[0015] The two-line sterile rice with broad compatibility obtained through the above method can be used as the female parent to cross with a two-line restorer line male parent with excellent traits to form a two-line hybrid rice combination for hybrid seed production. The two-line restorer lines include 9391, 7375 Wukejing, Nanjing 83111, Nanjing 83043, Jinxiangyu 1, and Ningxiangjing 11.

[0016] A gene editing site that causes deletion of the signal peptide in the rice S5 gene or loss of function of the rice S5 gene is identified as target sites 1 and 2, and target sites 3 and 4, with the following sequences:

[0017] 1) Target 1: TACTCAGGGGCAGGATTCGT

[0018] 2) Target 2: GTAGCAGCTGCAGCTGCAAC;

[0019] 3) Target 3: AGTCATTGTTACTCAGGGGC,

[0020] 4) Target 4: GGGACACTCCAACTCGTCGT.

[0021] The aforementioned editing sites can be used to prepare hybrid rice two-line sterile lines.

[0022] Traditional rice breeding often relies on phenotypic selection and breeder experience, resulting in long breeding cycles and low selection efficiency. This invention utilizes gene editing technology to directionally improve rice fertility, significantly shortening the breeding cycle, increasing breeding efficiency, and providing strong technical support for the selection of new rice germplasm.

[0023] This invention overcomes the sterility of intersubspecies hybrids of indica and japonica rice, and the seed setting rate of the resulting F1 generation of indica-japonica crosses exceeds 80%. This invention makes it possible to apply the heterosis of indica-japonica rice subspecies hybrids in hybrid rice, and has good prospects for development and application. Attached Figure Description

[0024] Figure 1 This is the identification of the S5 locus genotype of Bph68S.

[0025] Figure 2 This describes the construction of the pYLCRISPR / Cas9-S5-gRNA vector. A, Schematic diagram of pYLCRISPR / Cas9-S5-gRNA vector construction; B, S5 gene structure and target sequence; C, amplification of the sgRNA expression cassette; D, PCR amplification to identify positive S5 knockout vectors.

[0026] Figure 3 This is an S5 mutant induced by the CRISPR / Cas9 system. #B-1 to B-13 are T0 generation single plants; PAM structures are shown in green, insertion or deletion mutations are shown in red, signal peptide coding sequences are in blue, and start codons are in yellow. WT, wild type; Bi.M, biallelic mutation; Ho.M, homozygous mutation; Het, heterozygous mutation.

[0027] Figure 4 It is the fertility of the F1 generation of the cross between Bph68S and Balilla.

[0028] Figure 5 This is a comparison of the plant morphology of the parent plants and F1. From left to right and from top to bottom, the combinations are Bc-1 and 9391, 7375 Wukejing, Nanjing 83111, Nanjing 83043, Jinxiangyu No.1, and Ningxiangjing 11. Detailed Implementation

[0029] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0030] Example 1

[0031] 1. Genotyping of the maternal parent in a two-line sterile line

[0032] The S5 locus on rice chromosome 6 consists of three closely linked genes: ORF3, ORF4, and ORF5. ORF5 encodes an aspartic protease; there is a two-nucleotide difference between indica and japonica rice, but both are located in the cell wall. ORF4 encodes an unknown protein; in japonica rice, ORF4 is located in the cell membrane and Golgi apparatus, while indica rice ORF4, due to an 11bp deletion leading to premature termination, is located in the endoplasmic reticulum. ORF3 encodes an HSP70 protein; compared to indica rice, japonica rice ORF3 lacks 13bp before the stop codon, causing premature translation termination, and both are located in the endoplasmic reticulum. Therefore, indica rice ORF5 is represented as functional ORF5+, and japonica rice as ORF5-; japonica rice ORF4 is represented as functional ORF4+, and indica rice as ORF4-; indica rice ORF3 is represented as functional ORF3+, and japonica rice as ORF3-. ORF5 is considered the "killer," ORF4 is its "partner," and ORF3 is its "protector." When both ORF5+ and ORF4+ are present and ORF3 is ORF3-, the gametes are killed; however, if ORF3+ is present, the gametes survive. Therefore, the goal is to disable the function of ORF5+ in indica rice, thus rendering it ineffective as a "killer."

[0033] The gene sequences of the S5 loci (EU889295, JX138498, JX138499, JX138502, JX138503, EU889293, EU889294) were obtained through NCBI (http: / / www.ncbi.nlm.gov / ). Based on the sequence differences of the alleles, specific primers 3-F / 3-R, 4-F / 4-R, and 5-F / 5-R were designed for amplification of ORF3, ORF4, and ORF5.

[0034] 3-F: GAGCACATCAAGGAGCAGCAT,

[0035] 3-R:TCGTCGTAGCCAAAGCATAAG;

[0036] 4-F:GTCGTGGCTGCTCCTCCTTGTGCT,

[0037] 4-R: GCTGGACTGAAGAAGATGTGGTAG;

[0038] 5-F:CTGCCCCTGAGCAAGCAAGAAAG,

[0039] 5-R: ATGTGTAGGATCTGCCGGGATCGA.

[0040] Genomic DNA was extracted from leaves of the two-line sterile line using the CTAB method: Leaves were chopped and placed in 2 mL EP tubes, 100 μL of CTAB solution was added, and a steel ball was added to each tube before grinding for 1 min; 700 μL of CTAB solution was added, and the mixture was vigorously shaken and placed in a 65 °C water bath for 1 h, mixing every 15 min during the process; 500 μL of chloroform was added and the mixture was shaken and centrifuged at 12000 rpm for 10 min; the supernatant was transferred to a new EP tube, and 700 μL of isopropanol was added, and the mixture was precipitated at -20 °C for 30 min, followed by centrifugation at 12000 rpm for 10 min; the supernatant was discarded, and 500 μL of 75% ethanol solution was added, followed by centrifugation at 12000 rpm for 10 min; after the ethanol had evaporated, 50 μL of ddH2O was added to dissolve the DNA.

[0041] The genotypes of ORF5 at the S5 locus of 10 two-line sterile lines (Peia 64S, K7S, 8801S, 1892S, 57-4S, Bph68S, W6154S, W7415S, 5460S, and 8902S) were amplified and sequenced. Sequencing results showed that the amplified fragments of Peia 64S and 1892S were 938 bp in length, indicating a 136 bp deletion, thus containing the wide-affinity gene S5-n; while the amplified fragments of K7S, 8801S, 57-4S, Bph68S, W6154S, W7415S, 5460S, and 8902S were 1074 bp in size, indicating S5-i.

[0042] Using the sterile line Bph68S with genotype S5-i as the maternal parent, the ORF3 and ORF4 genes of Bph68S were identified. Sequencing results showed that the genotype of Bph68S at the S5 locus was: ORF3+ / ORF4- / ORF5+. Figure 1 The image shows a sequence comparison between Bph68S and the widely compatible variety S5-n. Bph68S does not have a 136bp deletion at ORF5, and the ORF5 gene of this material can be edited to make its signal peptide disappear or lose its function.

[0043] 2. Construction of S5 knockout expression vector based on pYLCRISPR / Cas9 system

[0044] (1) Design of S5 gene knockout target sites. ORF5 encodes an aspartic protease, and the 28 amino acid residues at the N-terminus of this protein encode a signal peptide, which mediates ORF5's nuclear translocation and function. However, in broad-affinity varieties, the absence of the N-terminal signal peptide leads to subcellular localization errors, preventing nuclear translocation and ultimately resulting in localization in the cytoplasm, thus failing to perform its function properly. Therefore, this embodiment aims to knock out the N-terminal signal peptide using a multi-target sgRNA design strategy. Target sites were designed targeting the region encoding the signal peptide in the first exon of ORF5, with one site upstream of the ATG and another near the end of the signal sequence, so that the size of the deleted fragment is as close as possible to the S5-n deletion. The selection and design of knockout target sites were based on the following principles: the size of the knocked fragment should be as close as possible to the 136bp deletion at the N-terminus; Off-target <0.6 and the lower the better; GC content should be between 50% and 70%; and the downstream target of the homologous sequence should be located in the CDS region. The final design included... Figure 2 The two pairs (T1T2 and T3T4) shown in B are close to the target sites of MHSs (microhomologous sequences, MHSs):

[0045] 1)Target1(T1):TACTCAGGGGCAGGATTCGT,

[0046] 2)Target2(T2):GTAGCAGCTGCAGCTGCAAC;

[0047] 3)Target3(T3):AGTCATTGTTACTCAGGGGC,

[0048] 4)Target4(T4):GGGACACTCCAACTCGTCGT.

[0049] Based on the above four target sites, target-linking primers were designed as shown in the table below:

[0050]

[0051]

[0052] (2) Construction of gene expression vectors. Using a cut-and-ligate approach, the target sequence was first introduced into the sgRNA expression cassette via overlapping PCR. The amplified sequences were 831 bp, 515 bp, 924 bp, and 603 bp in size. Then, multiple sgRNA expression cassettes were loaded into the binary vector pYLCRISPR / Cas9, where the BsaI site is located near RB, using the GoldenGate cloning method. The designed amplification primers are as follows:

[0053]

[0054] The primer pairs Pps-GGL / Pgs-GG2, Pps-GG2 / Pgs-GG3, Pps-GG3 / Pgs-GG4, and Pps-GG4 / Pgs-GGR amplify the corresponding U#-T1-gRNA, U#-T2-gRNA, U#-T3-gRNA, and U#-T4-gRNA, where T1 is target sequence 1, T2 is target sequence 2, T3 is target sequence 3, and T4 is target sequence 4; U# represents each promoter.

[0055] 1) First round of PCR:

[0056]

[0057]

[0058] Each sgRNA expression cassette was used in a separate PCR reaction, with four primers used in each reaction: UF and gRT#, U#T#-, and gRT#+. Specifically, primers UF and gRT1 and OsU6aT1 and gR-R were used to amplify OsU6a, primers UF and gRT2 and OsU6bT2 and gR-R were used to amplify OsU3, primers UF and gRT3 and OsU3T3 and gR-R were used to amplify OsU6c, and primers UF and gRT4 and OsU6cT4 and gR-R were used to amplify OsU6c.

[0059] Reaction program: 94℃, 15s; 58℃, 15s; 72℃, 20s, 30 cycles of amplification.

[0060] 2) Take 1 μL of the PCR product from the first round as the template for this round of PCR amplification. Set up a 50 μL PCR amplification system for each target site and add working solution for each primer combination (Pps-GGL / Pgs-GG2, Pps-GG2 / Pgs-GG3, Pps-GG3 / Pgs-GG4, Pps-GG4 / Pgs-GGR are each a primer pair) to a final concentration of 0.15 μM.

[0061]

[0062] Reaction program: 94℃, 5 min; 94℃, 15 s; 58℃, 15 s; 72℃, 20 s, amplification for 30 cycles; 72℃, 5 min.

[0063] Take 2-3 μL of the product and check the success of the expression cassette construction by agarose gel electrophoresis. The PCR amplification lengths of the expression cassettes of OsU6a-gRNA, OsU6b-gRNA, OsU6c-gRNA, and OsU3-gRNA were 831 bp, 515 bp, 924 bp, and 603 bp, respectively. Figure 2 As shown in C.

[0064] 3) Assembly of sgRNA expression cassette into pYLCRISPR / Cas9 vector using Golden Gate cloning strategy (ACCESSION: AF234296): Enzyme digestion-ligation reaction of binary vector and sgRNA expression cassette.

[0065] Enzyme digestion and ligation system (15 μL)

[0066]

[0067] Temperature-dependent cyclic enzymatic digestion and ligation: 3 cycles (37℃, 10 min; 10℃, 5 min; 20℃, 5 min); 10 cycles (37℃, 3 min; 10℃, 5 min; 20℃, 5 min); final cycle 37℃, 5 min.

[0068] 3) Transformation of the ligation product into *E. coli*: Transform the ligation product into *E. coli* DH5α competent cells, culture and select single clones, amplify the expression cassette using primers SP-L / SP-R (primer SP-L: GCGGTGTCATCTATGTTACTA, primer SP-R: CCGACATAGATGCAATAACTTC) and perform electrophoresis (e.g., ...). Figure 2 (As shown in D) The expression cassette length was detected and sequenced. Bacterial cultures with correct sequencing were preserved, and plasmids were extracted to obtain a dual-target pYLCRISPR / Cas9-eui-gRNA expression vector, such as... Figure 2 As shown in Figure A.

[0069] 3. Agrobacterium-mediated genetic transformation of rice

[0070] (1) Induction and subculture of rice callus

[0071] Remove the shells from Bph68S seeds, select rice grains with intact embryo structure and no mold, place them in sterile Erlenmeyer flasks, and label them accordingly. First, rinse them thoroughly with ddH2O, then rinse with 75% ethanol for 5 minutes. Add 50 mL of sterile ddH2O and wash 5 times. Add 50 mL of sterile ddH2O and 0.15% HgCl2 to submerge the rice grains, shake well, and let stand for 15 minutes. Finally, wash 4-5 times with sterile ddH2O. On a clean bench, use sterile tweezers to pick up the rice grains and place them evenly on the induction medium, then seal them with sealing film or bottle sealing film. Incubate in the dark at 29℃ for 4 weeks. When the callus tissue becomes firm, bright yellow in color, and grows to a moderate size, proceed with subculture.

[0072] (2) Agrobacterium tumefaciens-mediated genetic transformation of rice

[0073] The S5 knockout vector constructed in Example 2 was transformed into Agrobacterium (EHA105) using electroporation. On a sterile operating table, the bright yellow, firm callus tissue was transferred into a sterile Erlenmeyer flask, and an appropriate amount of Agrobacterium was added and the flask was incubated for 20 minutes. After draining the callus tissue with sterile filter paper, it was placed on a co-culture medium using forceps. The co-cultured callus tissue was then placed on a selection medium containing 50 mg / L Hygromycin, and the surviving callus tissue was selected and placed on a secondary selection medium. The surviving callus tissue after the secondary selection was placed on a differentiation medium containing 50 mg / L Hygromycin to differentiate into seedlings. When the shoots differentiated from the resistant callus tissue reached approximately 2 cm in length, the seedlings were transferred to a rooting medium and cultured for about two weeks.

[0074] 4. Identification of positive transgenic plants and analysis of T0 generation mutations

[0075] (1) Identification of positive transgenic plants

[0076] In this study, the vector used to construct the S5 knockout plants was a binary vector of the pYLCRISPR / Cas9Pubi-H series, which is hygromycin resistant. Therefore, PCR amplification and electrophoresis were used to detect whether the rice plants contained the hygromycin gene, in order to determine whether the binary vector had been successfully transferred into the knockout plants. To verify whether the regenerated plants with the vector were positive transgenic plants, leaves from the regenerated plants at the tillering stage were taken, and genomic DNA was extracted using the CTAB method. PCR amplification of the plant DNA was performed using the specific primers HPT-F: ACGGTGTCGTCCATCACAGTTTG and HPT-R: TTCCGGAAGTGCTTGACATTGGGGA. The results showed that the transgenic positivity rate was 100% (the 13 individual plants were named B-1 to B-13).

[0077] (2) Mutation analysis of transgenic T0 generation single plants

[0078] Primers F5 / R11 (primer F5: CTGCCCCTGAGCAAGCAAGAAAG, primer R11: ATGTGTAGGATCTGCCGGGATCGA) were designed flanking the S5 target site. PCR amplification was performed on positive plants, and the products were sequenced. Sequencing results showed that 4 plants were wild-type, 2 could not be sequenced, 3 plants had mutations in the 5'-UTR region, and the other 4 plants had frameshifts in the S5-i coding region. Figure 3 It can be seen that B-1 underwent a heterozygous mutation, B-2 and B-11 underwent biallelic mutations, and B-3 underwent a homozygous mutation.

[0079] (3) Screening of T1 generation plants without transgenic components.

[0080] Three T0 generation plants (B-2, B-3, and B-11) were selected and self-pollinated to obtain a T1 generation transgenic segregating population. Genomic DNA was extracted from the leaves of the T1 generation transformed rice plants using the CTAB method. Using this DNA as a template, PCR amplification was performed using primers specific to the hygromycin resistance gene. Plants that failed to amplify the target band were considered mutants without transgenic components. The results showed that among the 23 T1 progeny of B-3, 8 plants lacked the hygromycin resistance gene. This mutation caused a frameshift in S5-i translation, disrupting gene function; therefore, B-3 was considered a non-functional S5-i mutant family. S5-n lost its function due to a 136bp deletion at the N-terminus. The frameshift caused by the mutation in the S5-i coding region in the above 8 mutants prematurely terminated protein translation, preventing it from functioning. Therefore, the above 8 homozygous mutant plants without transgenic components were named Bc-1 to Bc-8, respectively.

[0081] 5. Seed setting rate of hybrid F1

[0082] Previous experiments showed that the F1 pollen produced by crossing Bph68S with Balilla had normal fertility and germination, but a very low seed set rate. This suggests that female gamete abortion may be the cause of the decreased spikelet fertility. Figure 4 As shown. To verify the potential application value of the S5-i nonfunctional mutant two-line male-sterile line in indica-japonica hybrid rice, the S5 homozygous mutant Bc-1 from line 4 was paired with japonica restorer lines (9391, 7375 Wukejing, Nanjing 83111, Nanjing 83043, Jinxiangyu 1, and Ningxiangjing 11) in the experimental base to form indica-japonica F1 generations, and the seed setting rate of F1 was examined. Results ( Figure 5 The results showed that the F1 varieties of indica and japonica rice in the experimental group generally exhibited hybrid vigor such as taller plants and larger ears, and the seed setting rate was mostly over 80%, with obvious advantages.

[0083] This demonstrates that the gene editing method for two-line sterile lines provided by this invention can improve the fertility of two-line hybrid rice and has significant application value in improving breeding efficiency.

[0084] Using the sterile lines K7S, 8801S, 57-4S, W6154S, W7415S, 5460S, or 8902S with genotype S5-i as the female parent, the S5 homozygous mutant obtained according to the above examples was used to breed the F1 generation of indica-japonica hybrids with the paternal parent of the japonica restorer line. The seed setting rate of the F1 generation plants obtained by the indica-japonica hybrids was lower than that of the F1 generation plants bred with the edited Bph68S as the female parent. sequence list <110> Wuhan University <120> A method for creating novel two-line sterile rice lines based on gene editing technology <160> twenty two <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Oryza sativa <400> 1 tactcagggg caggattcgt 20 <210> 2 <211> 20 <212> DNA <213> Oryza sativa <400> 2 gtagcagctg cagctgcaac 20 <210> 3 <211> 20 <212> DNA <213> Oryza sativa <400> 3 agtcattgtt actcaggggc 20 <210> 4 <211> 20 <212> DNA <213> Oryza sativa <400> 4 gggacactcc aactcgtcgt 20 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <400> 5 tactcagggg caggattcgt gttttagagc tagaaat 37 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <400> 6 acgaatcctgcccctgagta cggcagccaa gccagca 37 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <400> 7 tagcagctgc agctgcaacg ttttagagct agaaat 36 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <400> 8 gttgcagctg cagctgctac aacacaagcg gcagc 35 <210> 9 <211> 36 <212> DNA <213> Artificial Sequence <400> 9 gtcattgtta ctcaggggcg ttttagagct agaaat 36 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <400> 10 gcccctgagt aacaatgact gccacggatc atctgc 36 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <400> 11 ggacactcca actcgtcgtg ttttagagct agaaat 36 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <400> 12 acgacgagtt ggagtgtccc tgagcctcag cgcag 35 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <400> 13 ctccgtttta cctgtggaat cg 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 cggaggaaaa ttccatccac 20 <210> 15 <211> 42 <212> DNA <213> Artificial Sequence <400> 15 ttcagaggtc tctctcgact agtatggaat cggcagcaaa gg 42 <210> 16 <211> 37 <212> DNA <213> Artificial Sequence <400> 16 agcgtgggtc tcgtcagggt ccatccactc caagctc 37 <210> 17 <211> 38 <212> DNA <213> Artificial Sequence <400> 17 ttcagaggtc tctctgacac tggaatcggc agcaaagg 38 <210> 18 <211> 38 <212> DNA <213> Artificial Sequence <400> 18 agcgtgggtc tcgtcttcac tccatccact ccaagctc 38 <210> 19 <211> 38 <212> DNA <213> Artificial Sequence <400> 19 ttcagaggtc tctaagactt tggaatcggc agcaaagg 38 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <400> 20 agcgtgggtc tcgagtcctt tccatccact ccaagctc 38 <210> twenty one <211> 38 <212> DNA <213> Artificial Sequence <400> twenty one ttcagaggtc tctgactaca tggaatcggc agcaaagg 38 <210> twenty two <211> 42 <212> DNA <213> Artificial Sequence <400> twenty two agcgtgggtc tcgaccgacg cgtatccatc cactccaagc tc 42

Claims

1. The application of a two-line male-sterile rice line obtained by a method for creating novel two-line male-sterile rice lines based on gene editing in breeding, characterized in that, The method involves using CRISPR / Cas9 technology to specifically edit the S5 gene, which controls embryo sac abortion in indica-japonica hybrid rice Bph68s, and knocking out the S5 gene by causing a frameshift mutation in S5, thereby obtaining a two-line male-sterile rice with broad compatibility. The obtained two-line sterile rice was used as the female parent and crossed with the two-line restorer line male parent to form a two-line hybrid rice combination for hybrid seed production.

2. The application according to claim 1, characterized in that, The method includes the following steps: designing two pairs of target sites targeting the signal peptide coding region of the S5 gene in the two-line male-sterile line, constructing a pCRISPR / Cas9-S5-gRNA recombinant expression vector containing the target sequence, transforming the recombinant expression vector into the two-line male-sterile rice line using Agrobacterium-mediated transformation, thereby causing the signal peptide of the S5 gene in the two-line male-sterile line to be deleted or the function of the gene to be lost, thus obtaining a two-line male-sterile rice line with broad affinity characteristics.

3. The application according to claim 2, characterized in that, The two pairs of target points are target points 1 and 2, and target points 3 and 4, and their sequences are as follows: 1) Target 1: TACTCAGGGGCAGGATTCGT 2) Target 2: GTAGCAGCTGCAGCTGCAAC; 3) Target 3: AGTCATTGTTACTCAGGGGC, 4) Target 4: GGGACACTCCAACTCGTCGT.

4. The application according to claim 1, characterized in that, The two restored parent lines mentioned above include 7375 Wukejing, Jinxiangyu No. 1, and Ningxiangjing 11.

Images