KASP molecular markers of Brassica rapa and their application in germplasm identification
By developing KASP primers for non-heading Chinese cabbage and using KASP technology for SNP genotyping, the accuracy and cost issues in the identification of non-heading Chinese cabbage varieties have been solved. This has enabled rapid and accurate identification of germplasm resources and seed purity, while reducing the demand for DNA samples and experimental costs.
Patent Information
- Application Number
- CN202211417240.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-14
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2042-11-14
AI Technical Summary
Existing technologies for identifying non-heading Chinese cabbage varieties suffer from insufficient accuracy, high cost, and complex operation, especially in rapidly distinguishing between homozygous and heterozygous types and identifying seed purity.
A set of KASP primers for non-heading Chinese cabbage was developed. SNP typing was performed using KASP technology. By designing specific primers and fluorescent probes, rapid and accurate identification of non-heading Chinese cabbage was achieved, including identification of germplasm resources, varieties, and seed purity.
It enables rapid and accurate identification of non-heading Chinese cabbage germplasm resources and seed purity, reduces DNA sample requirements and experimental costs, improves identification efficiency, and is suitable for low, medium, and high throughput research.
Smart Images

Figure CN115747370B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology, specifically relating to a set of KASP molecular markers for non-heading Chinese cabbage and their application in germplasm resource identification. Background Technology
[0002] Non-heading Chinese cabbage is widely cultivated in the middle and lower reaches of the Yangtze River. It has a short growth cycle, rapid turnover, strong adaptability, no fixed sowing time, and includes cold- and heat-resistant varieties, allowing for year-round supply. Currently, the cultivation area of non-heading Chinese cabbage is continuously expanding, gradually becoming a global vegetable. With the increasing market demand, breeders have conducted extensive research on non-heading Chinese cabbage, developing many excellent varieties. However, with the increasing number of varieties and the expanding cultivation area, cases of identical or different varieties, and even substandard seeds entering the market, have frequently occurred. Therefore, rapid and accurate identification of non-heading Chinese cabbage varieties is crucial for identifying counterfeit varieties and resolving intellectual property disputes.
[0003] In recent years, with the rapid development of molecular marker technology, variety identification and seed purity assessment have entered the DNA level. Due to their high accuracy, stability, and repeatability, they provide more accurate and reliable results for crop variety purity analysis. RFLP markers exhibit co-dominance, distinguishing between homozygous and heterozygous types, and have a wide range of applications in the genome. However, they require a large amount of DNA template, are technically challenging to operate, have low sensitivity to polymorphism, and require the use of radioactive elements, resulting in high environmental pollution and experimental costs. SSR markers, on the other hand, are co-dominant markers that can distinguish between homozygous and heterozygous types. They require less DNA sample, have lower DNA requirements, are simple to operate, and are highly reliable. They exhibit a large number of allelic differences, avoiding the use of radioactive isotopes in RFLP. However, the DNA sequences at both ends of the repetitive motif must be identified; if they cannot be directly found in a DNA database, resequencing is required, leading to high costs. SNP molecular markers are finding increasingly diverse applications. Compared to first- and second-generation DNA molecular markers, KASP-SNP markers offer advantages such as abundant quantity, high density, relatively stable genetics, high accuracy, higher efficiency, wide distribution across the genome, and ease of automation and large-scale analysis. KASP technology, derived from KASP technology, is used for crop genetic breeding. KASP technology relies on specific base matching at the primer ends to genotype SNPs and detect InDels insertions and deletions. It employs two fluorescent probes, two universal quenching probes, and multiple site-specific probes to detect multiple SNP sites. A fully automated quantitative PCR platform is used to read the data and perform genotyping. KASP's specific primer fragments are typically 24–26 bp in length, offering higher specificity and accuracy compared to the commonly used 8–12 bp TaqMan probes. When configuring the KASP reaction system, only a very small amount of sample DNA needs to be added. For example, 100 ng / μL of sample DNA only needs to be added to a 10 μL reaction system, thus reducing reagent consumption and significantly reducing costs. Moreover, the reaction does not require conventional gel genotyping; gene genotyping can be observed at the end of the experiment. The KASP detection platform can also simultaneously detect a large number of loci in a small number of samples or a small number of loci in a large number of samples, catering to low, medium, and high-throughput studies as well as single experiments. Summary of the Invention
[0004] The purpose of this invention is to provide a set of primers for the identification of non-heading Chinese cabbage, which can enable rapid, accurate and effective identification of germplasm resources and seed purity of non-heading Chinese cabbage.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A set of KASP primers for non-heading Chinese cabbage includes the following primer pairs:
[0007] SNP01 F1:GAAGGTGACCAAGTTCATGCTcaatctgtttgggagaaggtggttA
[0008] F2:GAAGGTCGGAGTCAACGGATTcaatctgtttgggagaaggtggttC
[0009] R:catcctccagtatccaaagattaaaacgg
[0010] SNP02 F1:GAAGGTGACCAAGTTCATGCTtacatcaactcttgccttaggtacG
[0011] F2:GAAGGTCGGAGTCAACGGATTtacatcaactcttgccttaggtacT
[0012] R:gcatactcggtgttctctaagttcagata
[0013] SNP03 F1:GAAGGTGACCAAGTTCATGCTcagacctctagagagcttcctaaaC
[0014] F2:GAAGGTCGGAGTCAACGGATTcagacctctagagagcttcctaaaG
[0015] R:ggatcatgtttcgatgaagagagaattcg
[0016] SNP04 F1:GAAGGTGACCAAGTTCATGCTctaagcacatcccttcaacgaaatG
[0017] F2:GAAGGTCGGAGTCAACGGATTctaagcacatcccttcaacgaaatT
[0018] R:caaagtgtggctgaagtaagtgatgatg
[0019] SNP05 F1:GAAGGTGACCAAGTTCATGCTtcaagtttttcgggtagggtttggG
[0020] F2:GAAGGTCGGAGTCAACGGATTtcaagtttttcgggtagggtttggA
[0021] R:gcgtcatcttcttattcttagattgggtc
[0022] SNP06 F1:GAAGGTGACCAAGTTCATGCTcatctcagaagaagattgcaagggA
[0023] F2:GAAGGTCGGAGTCAACGGATTcatctcagaagaagattgcaagggG
[0024] R:catcttgtcaagaacgtttgcagagatag
[0025] SNP07 F1:GAAGGTGACCAAGTTCATGCTtatcacgagtacttacacctgaccA
[0026] F2:GAAGGTCGGAGTCAACGGATTtatcacgagtacttacacctgaccC
[0027] R:tacttgttcttgctcagtctctgttatgg
[0028] SNP08 F1:GAAGGTGACCAAGTTCATGCTtgaatctcacccttctgtcaacctT
[0029] F2:GAAGGTCGGAGTCAACGGATTtgaatctcacccttctgtcaacctC
[0030] R:gataatctttttggagatgctcttagcctg
[0031] SNP09 F1:GAAGGTGACCAAGTTCATGCTctaatgggggtgctcttagatgtgG
[0032] F2:GAAGGTCGGAGTCAACGGATTctaatgggggtgctcttagatgtgT
[0033] R:gcttctgatcatgtctctcattattgtgc
[0034] SNP10 F1:GAAGGTGACCAAGTTCATGCTttgatttctctgttctggtggcagA
[0035] F2:GAAGGTCGGAGTCAACGGATTttgatttctctgttctggtggcagC
[0036] R:ttgtgtagatatctgcagagatggagaag
[0037] SNP11 F1:GAAGGTGACCAAGTTCATGCTaccaaaccgaacccgtaattaaacC
[0038] F2:GAAGGTCGGAGTCAACGGATTaccaaaccgaacccgtaattaaacT
[0039] R:cagttttgctatgtttctctctgattggg
[0040] SNP12 F1:GAAGGTGACCAAGTTCATGCTggtttgaaatagcagctgcaaacaA
[0041] F2:GAAGGTCGGAGTCAACGGATTggtttgaaatagcagctgcaaacaG
[0042] R:cgtaagtttcccatataactttccaagcc
[0043] SNP13 F1:GAAGGTGACCAAGTTCATGCTtgcgttttgggatgatgttacactC
[0044] F2:GAAGGTCGGAGTCAACGGATTtgcgttttgggatgatgttacactG
[0045] R:ccaatgtaaccattctcgccaatcttatg
[0046] SNP14 F1:GAAGGTGACCAAGTTCATGCTcagctccatttcttagtatgggacC
[0047] F2:GAAGGTCGGAGTCAACGGATTcagctccatttcttagtatgggacT
[0048] R:cgctgtaacctgttcagaatagcttattc
[0049] SNP15 F1:GAAGGTGACCAAGTTCATGCTtgaagaggaaacctggtgagagagA
[0050] F2:GAAGGTCGGAGTCAACGGATTtgaagaggaaacctggtgagagagT
[0051] R:gacagaatcttagatgtgaggaagctctt
[0052] SNP16 F1:GAAGGTGACCAAGTTCATGCTcaccaaagaagaacatacctcttcG
[0053] F2:GAAGGTCGGAGTCAACGGATTcaccaaagaagaacatacctcttcA
[0054] R:catgtggtctaatttagcccatgagatg
[0055] SNP17 F1:GAAGGTGACCAAGTTCATGCTactccatgtttctcaatactggccA
[0056] F2:GAAGGTCGGAGTCAACGGATTactccatgtttctcaatactggccG
[0057] R:gaaatcttggctggagacactcttaatg
[0058] SNP18 F1:GAAGGTGACCAAGTTCATGCTgaggcttggagaacatagccatatT
[0059] F2:GAAGGTCGGAGTCAACGGATTgaggcttggagaacatagccatatG
[0060] R:atatattatatgcggagaggaccttgcag
[0061] SNP19 F1:GAAGGTGACCAAGTTCATGCTtccgctataccattcaagaagagtA
[0062] F2:GAAGGTCGGAGTCAACGGATTtccgctataccattcaagaagagtT
[0063] R:atcatcgaaaccgatccatatcttggtag
[0064] SNP20 F1:GAAGGTGACCAAGTTCATGCTttgatcttagaccagtgttctctcA
[0065] F2:GAAGGTCGGAGTCAACGGATTttgatcttagaccagtgttctctcC
[0066] R:gaagaaatatcctctgtcattgacggtg
[0067] SNP21 F1:GAAGGTGACCAAGTTCATGCTaaagtctgcgagtttacgggttaaG
[0068] F2:GAAGGTCGGAGTCAACGGATTaaagtctgcgagtttacgggttaaA
[0069] R:ctgtaaacgatttcttgccatcagagaag
[0070] SNP22 F1:GAAGGTGACCAAGTTCATGCTtacgaagagagagagacagagataC
[0071] F2:GAAGGTCGGAGTCAACGGATTtacgaagagagagagacagagataG
[0072] R:cggtaataataatgttggaatcgaaccgg
[0073] SNP23 F1:GAAGGTGACCAAGTTCATGCTaccatgttttatatgcaggagagcA
[0074] F2:GAAGGTCGGAGTCAACGGATTaccatgttttatatgcaggagagcG
[0075] R:caataagtaagaaacgcatccgcaaac
[0076] SNP24 F1:GAAGGTGACCAAGTTCATGCTgaggtaaagatctcccttacaactC
[0077] F2:GAAGGTCGGAGTCAACGGATTgaggtaaagatctcccttacaactT
[0078] R:cctgtgaaaaacggtatcatgaagagttg
[0079] SNP25 F1:GAAGGTGACCAAGTTCATGCTaaactctcacaaatgtcggtctcgA
[0080] F2:GAAGGTCGGAGTCAACGGATTaaactctcacaaatgtcggtctcgG
[0081] R:taatagtggaagaagaagcgtatgaggag
[0082] SNP26 F1:GAAGGTGACCAAGTTCATGCTCcctcaaaattcacctaactcgaacT
[0083] F2:GAAGGTCGGAGTCAACGGATTcctcaaaattcacctaactcgaacG
[0084] R:ggtaaaagaaacatgtagaagcacctctc
[0085] SNP27 F1:GAAGGTGACCAAGTTCATGCTTaccattcaagcctttaagtgtggT
[0086] F2:GAAGGTCGGAGTCAACGGATTtaccattcaagcctttaagtgtggC
[0087] R:catagggttgaagaaaacagaggaatg
[0088] SNP28 F1:GAAGGTGACCAAGTTCATGCTctcactcgtccatactcaagagtcT
[0089] F2:GAAGGTCGGAGTCAACGGATTctcactcgtccatactcaagagtcC
[0090] R:ctttttccctagagtttgaaactggatgc
[0091] SNP29 F1:GAAGGTGACCAAGTTCATGCTtccaaggtatatcacaccgctaatA
[0092] F2:GAAGGTCGGAGTCAACGGATTtccaaggtatatcacaccgctaatG
[0093] R:gaagaaacaactcagtaagaagcctctg
[0094] SNP30 F1:GAAGGTGACCAAGTTCATGCTgagaggagaaggagagttaaggagG
[0095] F2:GAAGGTCGGAGTCAACGGATTgagaggagaaggagagttaaggaA
[0096] R:aactagaaatggagagtgagagaaaggtc
[0097] SNP31 F1:GAAGGTGACCAAGTTCATGCTcgtgtggtcttatttttcatccacT
[0098] F2:GAAGGTCGGAGTCAACGGATTcgtgtggtcttatttttcatccacG
[0099] R:ctaagacttgttggagtggaaataacgac
[0100] SNP32 F1:GAAGGTGACCAAGTTCATGCTggtcaaagatgggaagaaaagtgtG
[0101] F2:GAAGGTCGGAGTCAACGGATTggtcaaagatgggaagaaaagtgtC
[0102] R:ctgattgtgagaaagtggagagactttg
[0103] SNP33 F1:GAAGGTGACCAAGTTCATGCTctcttcttactgtacaggtgacttT
[0104] F2:GAAGGTCGGAGTCAACGGATTctcttcttactgtacaggtgacttG
[0105] R:ggatctttaggcataagcatttcctttcc
[0106] SNP34 F1:GAAGGTGACCAAGTTCATGCTttgcgatggtcacaggtatcaaatC
[0107] F2:GAAGGTCGGAGTCAACGGATTttgcgatggtcacaggtatcaaatG
[0108] R:gagtttcagttctgtcacaatcagatacc
[0109] SNP35 F1:GAAGGTGACCAAGTTCATGCTgaaatctctgacatgtgtggtctgA
[0110] F2:GAAGGTCGGAGTCAACGGATTgaaatctctgacatgtgtggtctgC
[0111] R:gttccatagccttggctataaaggtttc
[0112] SNP36 F1:GAAGGTGACCAAGTTCATGCTttgcactgaacataaccatctgacG
[0113] F2:GAAGGTCGGAGTCAACGGATTttgcactgaacataaccatctgacA
[0114] R:gttgaggaaccaacaactcatgtatcttg
[0115] SNP37 F1:GAAGGTGACCAAGTTCATGCTcacttcttatgtcaatcgttggctT
[0116] F2:GAAGGTCGGAGTCAACGGATTcacttcttatgtcaatcgttggctC
[0117] R:caagctatacttttcgtgtgcataccaag
[0118] SNP38 F1:GAAGGTGACCAAGTTCATGCTtttggcttcttcgctataggttctA
[0119] F2:GAAGGTCGGAGTCAACGGATTtttggcttcttcgctataggttctG
[0120] R:ctctgtccactttgagatagaccttgag
[0121] SNP39 F1:GAAGGTGACCAAGTTCATGCTaccttcgtaacgatgttgtacgacT
[0122] F2:GAAGGTCGGAGTCAACGGATTaccttcgtaacgatgttgtacgacC
[0123] R:ttgttcagaaaccacgaatcctgc
[0124] SNP40 F1:GAAGGTGACCAAGTTCATGCTcgattaagtccttcgacaagtggaT
[0125] F2:GAAGGTCGGAGTCAACGGATTcgattaagtccttcgacaagtggaG
[0126] R:caaatctgcaaggagagttgaaggaatc
[0127] SNP41 F1:GAAGGTGACCAAGTTCATGCTcagaagccattgttggtctactctT
[0128] F2:GAAGGTCGGAGTCAACGGATTcagaagccattgttggtctactctC
[0129] R:ctgttgtatgttcaggagaatgcaaagag
[0130] SNP42 F1:GAAGGTGACCAAGTTCATGCTacaattatccatgggatgtgcaagG
[0131] F2:GAAGGTCGGAGTCAACGGATTacaattatccatgggatgtgcaagA
[0132] R:gacaacattgtactgtacgctacaacatc
[0133] SNP43 F1:GAAGGTGACCAAGTTCATGCTtccgagtcgtagaatgaattgttcC
[0134] F2:GAAGGTCGGAGTCAACGGATTtccgagtcgtagaatgaattgttcT
[0135] R:cagctttggggtcttacttcttgagatta
[0136] SNP44 F1:GAAGGTGACCAAGTTCATGCTaaaacaggaccgttaatgaccaagA
[0137] F2:GAAGGTCGGAGTCAACGGATTaaaacaggaccgttaatgaccaagT
[0138] R:gatacgtgaacagcttgctatgattgag
[0139] SNP45 F1:GAAGGTGACCAAGTTCATGCTgccggtagctctactttgtcttacG
[0140] F2:GAAGGTCGGAGTCAACGGATTgccggtagctctactttgtcttacC
[0141] R:cgcgtagactagggtcattatcatttact
[0142] SNP46 F1:GAAGGTGACCAAGTTCATGCTatggtgtttttggtgtacatggagC
[0143] F2:GAAGGTCGGAGTCAACGGATTatggtgtttttggtgtacatggagT
[0144] R:ccttgatgtgagcactttgtaactagaga
[0145] SNP47 F1:GAAGGTGACCAAGTTCATGCTactggaatgagagatatgtgctcaC
[0146] F2:GAAGGTCGGAGTCAACGGATTactggaatgagagatatgtgctcaG
[0147] R:cacttttcccgacaaaacatattgaggag
[0148] SNP48 F1:GAAGGTGACCAAGTTCATGCTcgactctctgtctatatggtacgcC
[0149] F2:GAAGGTCGGAGTCAACGGATTcgactctctgtctatatggtacgcA
[0150] R:aaaccgtttattgacatgctgccat
[0151] SNP49 F1:GAAGGTGACCAAGTTCATGCTgatgctgtcacaatcgtcgttttcA
[0152] F2:GAAGGTCGGAGTCAACGGATTgatgctgtcacaatcgtcgttttcG
[0153] R:tagctgaatatacaggggacgttgattac
[0154] SNP50 F1:GAAGGTGACCAAGTTCATGCTgaggaggagaagcattagaaccatG
[0155] F2:GAAGGTCGGAGTCAACGGATTgaggaggagaagcattagaaccatT
[0156] R:gaagagacaaaaggagagagagagagaga
[0157] Application of the above primer set in constructing a fingerprint map of non-heading Chinese cabbage germplasm resources.
[0158] Application of the above primer set in the identification of non-heading Chinese cabbage varieties.
[0159] The application of the above primer set in finding differences between the parents and offspring of non-heading Chinese cabbage.
[0160] Application of the above primer set in identifying the purity of non-heading Chinese cabbage seeds.
[0161] Based on the genome and KASP resequencing technology of non-heading Chinese cabbage, this invention develops a set of core SNP markers for the identification of non-heading Chinese cabbage hybrids, which can realize rapid, accurate and effective identification of non-heading Chinese cabbage germplasm resources and seed purity. Attached Figure Description
[0162] Figure 1 Polymorphism map of A01:15209798 marker in 77 non-heading Chinese cabbage germplasm resources;
[0163] Figure 2 Polymorphism map of A02:24167713 in 77 non-heading Chinese cabbage germplasm resources.
[0164] Figure 3 SNP-DNA fingerprinting of 41 non-heading Chinese cabbage varieties. Detailed Implementation
[0165] Based on the genome and KASP resequencing technology of non-heading Chinese cabbage, this invention develops a set of core SNP markers for the identification of non-heading Chinese cabbage hybrids, which can enable rapid, accurate and effective identification of non-heading Chinese cabbage germplasm resources and seed purity.
[0166] 1. Development of KASP tags
[0167] KASP marker development steps: The genome of the non-heading Chinese cabbage NHCC001 (http: / / tbir.njau.edu.cn / ) was compared with resequencing data. The data was filtered using vcftools (version 0.1.16), with parameters set as follows: average depth 5X or higher, marker quality value 30 or higher, minimum integrity 0.7 or higher, minimum allele frequency 0.05, biallelic markers, etc.; polymorphism information content 0.2 or higher, expected heterozygosity 0.2 or higher, etc.; RepeatMasker (version: ...) was used... 4.1.0) Mark repetitive sequences in the genome and remove SNP markers from the repetitive sequences; extract 50bp sequences upstream and downstream of the SNP marker, and then use BLAST software (version: 2.10.1+) to align the sequences with the reference genome, removing two or more markers (including those at their original positions); use primer design software Primer3 (version: 2.4.0) to fix the upstream primer position and design primers; select one marker every 2Mb to ensure that there are more than 5 pairs of markers per chromosome, and then experimentally detect the success rate of KASP markers. The primer SNP positions and alleles are shown in Table 1.
[0168] Table 1. Relevant information for 50 core SNP loci
[0169]
[0170]
[0171] 2. Synthesis of KASP primers
[0172] Based on the developed SNP sites, KASP primers were converted. These primers, numbered SNP01-SNP50, were evenly distributed across all ten chromosomes, with five primer pairs on each chromosome. Specific primer information is shown in Table 2. Each KASP primer combination was used to amplify the corresponding SNP marker. Each primer consisted of two forward primers, F1 and F2, and one reverse primer, R. KASP technology is based on specific base matching at the primer ends to genotype SNPs and detect InDels insertions and deletions. Two fluorescent probes, two universal quenching probes, and multiple site-specific probes were used to detect multiple SNP sites. A fully automated quantitative PCR platform was used to read the data and perform genotyping. The main component of the reaction system is Primer Mix, which consists of two allele-specific forward primers with different terminal bases and one universal reverse primer. The 5' ends of the two forward primers are respectively equipped with different detection primer sequences, namely fluorescent probes FAM and VIC. Primer F1 has the FAM fluorescent tag sequence GAAGGTGACCAAGTTCAT added to its 5' end; primer F2 has the VIC fluorescent tag sequence GAAGGTCGGAGTCAACGGATT added to its 5' end. Another main component is Master Mix, which can detect the different fluorescence carried by the two forward primers. Biallelic recognition is achieved through the competitive binding of the two allele-specific forward primers.
[0173] Table 2 Primer information for core SNP molecular markers of non-heading Chinese cabbage developed based on KASP technology.
[0174]
[0175]
[0176]
[0177]
[0178]
[0179] Note: The primer sequences above correspond to SEQ ID NO.1-SEQ NO.150 in the sequence listing, respectively.
[0180] 3. Variety selection and DNA extraction
[0181] Seventy-seven non-heading Chinese cabbage varieties from the Chinese cabbage systems biology laboratory of Nanjing Agricultural University were selected, and the selected varieties are shown in Table 3.
[0182] Table 3. Details of 77 non-heading Chinese cabbage germplasm resources from Jiangsu Province
[0183]
[0184]
[0185] DNA was extracted from young plant leaves using a modified CTAB method, as detailed below:
[0186] Step 1: Take 0.1g of tender leaves of the selected variety, put them into a sampling tube, and grind them after adding liquid nitrogen;
[0187] Step 2: Add 600 μL of CTAB to the sampling tube and vortex for 2-3 minutes.
[0188] Step 3: Incubate in a 65℃ water bath for 30 minutes, manually agitating the water 2-3 times during the water bath.
[0189] Step 4: Add 600 μL of chloroform:isoamyl alcohol (24:1) and shake manually for 5 min;
[0190] Step 5: Centrifuge at room temperature, 12000 rpm, for 5 minutes;
[0191] Step 6: After taking 400 μL of the supernatant, add 800 μL of anhydrous ethanol and shake well. Cool at -20℃ for 20 min.
[0192] Step 7: Centrifuge the sample at 12,000 rpm for 5 minutes at room temperature, then pour out the supernatant and let it air dry.
[0193] Step 8: After the sample has been dried, add 100 μL of ddH2O and determine the concentration and OD value of the extracted DNA.
[0194] The extracted DNA was diluted to 20 ng / μL and used in a 5 μL volume system: 2.5 μL KASP Master Mix, 1 μL DNA, 0.1 μL F1, 0.1 μL F2, 0.3 μL R, and 1.25 μL ddH2O. PCR amplification was performed on a BIORAD real-time quantitative instrument. The PCR program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61℃-55℃ for 60 s, for a total of 10 TouchDown cycles (each cycle decreasing by 0.6℃); the second round of PCR reaction consisted of 95℃ denaturation for 20 s, annealing and extension at 55℃ for 60 s, for a total of 36 cycles. Finally, genotyping data were read at 25℃ for 30 sec.
[0195] Figure 1Polymorphism map of marker A01:15209798 (primer SNP03) in 77 non-heading Chinese cabbage germplasm resources. Figure 2 This is a polymorphism map of the A02:24167713 marker (primer SNP08) in 77 non-heading Chinese cabbage germplasm resources. The graph represents the KASP genotyping results at two SNP loci in 77 non-heading Chinese cabbage materials and two pure water negative controls at an initial DNA concentration of 20 ng / μL. Points closer to the Y-axis and X-axis represent two different homozygous genotypes, while points on the diagonal of the coordinate axes represent heterozygous genotypes.
[0196] Real-time quantitative PCR results ( Figure 1 , Figure 2 The results showed that both sets of KASP primers, SNP03 and SNP08, could yield good KASP typing results after amplification.
[0197] The KASP genotyping technology of this invention performs precise bicelestem typing of target SNPs / InDels. Based on the developed SNP sites and designed primers, it can be used to construct DNA fingerprints of selected populations, perform variety identification, and conduct seed purity identification experiments.
[0198] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are within the scope of the present invention. Experimental methods and reagents not specifically described in the embodiments are performed according to conventional conditions in the art.
[0199] Example 1: Construction of fingerprint map of non-heading Chinese cabbage germplasm resources
[0200] Genotyping of 77 non-heading Chinese cabbage varieties was performed using the KASP platform. Of the 50 markers, 32 were successfully genotyped, 7 were ungenotyped, 7 had more than 5 ungenotyped materials, and 3 lacked polymorphism. To ensure accuracy, these 18 markers were removed in subsequent analyses.
[0201] Thirty-two core SNP markers were ultimately obtained to construct the fingerprint map of non-heading Chinese cabbage germplasm resources. Genotyping of 41 local non-heading Chinese cabbage germplasm resources from the Chinese cabbage systems biology laboratory of Nanjing Agricultural University, Jiangsu Province (Table 4) was performed using the 32 core KASP markers to construct the DNA fingerprint map of the non-heading Chinese cabbage germplasm resources. The core locus genotyping results of the 41 materials were converted into binary encoded data, and the resulting fingerprint map is shown below. Figure 3As shown in the figure. This DNA fingerprint can be used to effectively distinguish the local germplasm resources of non-heading Chinese cabbage from the Chinese cabbage systems biology laboratory of Nanjing Agricultural University in Jiangsu Province.
[0202] Table 4. Specific information on 41 non-heading Chinese cabbage varieties
[0203]
[0204]
[0205] Example 2: Identification of non-heading Chinese cabbage varieties
[0206] Primers designed using 12 SNP loci were used to identify whether the non-heading Chinese cabbage variety to be tested was 'B1 Yellow Sprout'.
[0207] Ten seeds of each of the tested variety and the standard sample 'B1 Huangmiao' were randomly selected. DNA was extracted using the modified CTAB method described above. Then, 12 SNP sites were randomly selected from 50 primers of SNP01-SNP50 for PCR amplification and statistical analysis of genotyping results for variety identification.
[0208] Table 6. Genotyping results of the tested variety and the standard sample "B1 Huangmiao" at 12 SNP loci.
[0209] Primer number Varieties to be tested B1 Yellow Seedling SNP03 G:G C:C SNP05 G:A A:A SNP07 A:A A:A SNP09 T:T T:T SNP12 A:G A:G SNP15 A:A T:T SNP18 T:T G:G SNP21 G:G G:A SNP26 G:G T:G SNP28 T:T T:C SNP29 A:G A:G SNP31 T:T T:T
[0210] Based on the comparison of genotyping results, the genotyping results of SNP03, SNP05, SNP15, SNP18, SNP21, SNP26, and SNP28 are different, indicating that the variety to be tested is not 'B1 Yellow Seedling'.
[0211] Example 3: Finding SNPs (Syndromes) that differentiate between parents and offspring
[0212] Using the 50 pairs of KASP primers developed, F1 plants were obtained by hybridization of the maternal parent 'Suzhou Qing' and the paternal parent 'B1 Huangmiao' during the flowering period of the parents. DNA was extracted from cotyledons using a modified CTAB method, and genotyping was performed using KASP technology. Simultaneously, genotyping was performed using 27 core KASP-SNP markers, with the same detection methods and PCR reactions as described above. The results are shown in Table 7.
[0213] Table 7. Genotyping results of 'Suzhou Qing', 'B1' Huangmiao and their hybrids at 27 SNP loci.
[0214]
[0215]
[0216] The results showed that the KASP primers identified SNPs that differentiated the hybrid 'Suzhou Qing × B1 Huangmiao' from its parents: SNP03, SNP08, SNP13, SNP17, SNP25, and SNP31.
[0217] Example 4: Identification of Seed Purity
[0218] The purity of the hybrid 'Suzhou Qing × B1 Huangmiao' was determined using the developed KASP marker. Based on 50 pairs of designed KASP primers, the differentially expressed SNPs between the first generation of 'Suzhou Qing × B1 Huangmiao' and its parents were identified as SNP03, SNP08, SNP13, SNP17, SNP25, and SNP31. Ninety-four seeds of the hybrid were randomly selected for DNA extraction. After germination, cotyledons and hypocotyls were selected, and DNA was extracted from non-heading Chinese cabbage using a modified CTAB method. Genotyping was performed using KASP technology, and the differentially expressed primer pair SNP03 was used to determine the purity of the hybrid seeds. The DNA from the 94 seeds was added to 94 wells of a 96-well plate, along with two negative controls. Based on the above reaction system and PCR conditions, the genotyping results of the 94 hybrid seed samples at the SNP03 marker locus were obtained. Statistical results showed that most of the 94 samples exhibited a heterozygous genotype C:T, and the hybrid purity was 93.61%.
Claims
1. Application of a primer set in constructing a fingerprint of Brassica rapa L. germplasm resources, wherein the primer set comprises the following primer pairs:
2. Application of a primer set in identifying whether a Brassica rapa L. variety is 'B1 Huangmiao', wherein the primer set comprises the following primer pairs:
3. Application of a primer set in identifying differences between a parent and a progeny of Brassica rapa L., wherein the parent is 'Suzhouqing' and the parent is 'B1 Huangmiao', and the primer set comprises the following primer pairs:
4. Application of a primer set in identifying the seed purity of a hybrid 'Suzhouqing x B1 Huangmiao' of Brassica rapa L., wherein the primer set comprises the following primer pairs:
Citation Information
Patent Citations
Core SNP (single nucleotide polymorphism) marker system suitable for building variety nucleic acid fingerprint database of non-heading Chinese cabbage and its application
CN105349659A
Non-heading Chinese cabbage core SNP molecular marker set developed based on KASP technology and application of non-heading Chinese cabbage core SNP molecular marker set
CN113403423A