A molecular marker related to body size traits of sheep, a detection method thereof and application thereof

Abstract

The application provides a molecular marker related to a body size trait of sheep, a detection method and application of the molecular marker, and a nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at the 327th position is T or C. The application performs PCR amplification and sequence analysis on a PLEC gene of a Hushe sheep, finds that a T / C polymorphic site exists at the 327th position of an amplified fragment, i.e. the 23157th position of the PLEC gene, further detects the polymorphic site of 1313 Hushe sheep by using KASPar primers, establishes a least square model, and performs correlation analysis on genotypes and growth traits, and finally determines that the amplified CC gene fragment can be used as a molecular marker related to the body size trait of sheep. By detecting the molecular marker, the application can be used for selecting and reserving a sheep with a CC homozygous gene into a core group as a breeding sheep, so as to improve the body size trait of the sheep and help to increase economic benefits.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to a PLEC gene fragment as a molecular marker affecting sheep body size traits, a detection method thereof and application. BACKGROUND

[0002] PLEC encodes Plectin. Plectin, namely PLEC, is a huge cytoskeletal protein with a polypeptide chain length of about 4500 amino acid residues. PLEC has binding sites for all types of intermediate filament (IF) subunit proteins and plays an important role in linking and anchoring the organization and performance of cells (Wiche G, 2011). PLEC is widely distributed in the human body, mainly existing in skeletal muscle and playing its physiological functions. It is reported that missense, frameshift and splice-site mutations will lead to nearly 100 kinds of human diseases (Zrelski MM, 2021). In addition, some studies have shown that PLEC can promote muscle cell differentiation and proliferation, inhibit its apoptosis, and regulate skeletal muscle development (Huadong Yin, 2021). However, the research on PLEC gene in sheep is less, and it is not clear what effect PLEC gene has on sheep, especially in the production practice.

[0003] Sheep are an important source of meat, dairy products and wool, and play a vital role in the global agricultural economy. Body size is a key feature of the sheep industry (Tao L et al, 2020.). Lake sheep is a famous multi-product breed, which has four seasons of estrus, fast growth, early sexual maturity and high lambing number (Feng et al., 2018). Lake sheep is mainly distributed in the Yangtze River basin. Missense mutations occur in the coding region, leading to defective translation proteins and being associated with many diseases (Lee et al., 2008). Synonymous mutations do not produce altered proteins in non-coding regions, but change DNA and RNA sequences, and are considered as silent mutations, so they are easily ignored (Sharma et al.). However, synonymous mutations can change the stability of mRNA, splicing regulatory sites, miRNA binding sites or translation efficiency, thereby leading to changes in protein levels or protein conformation (Sauna et al, 2011). The present application explores the correlation between different genotypes of PLEC gene and sheep body size by sequencing and analyzing the PLEC gene, aiming to provide genetic materials for improving the genetic improvement of sheep body size and to accelerate the breeding process of new varieties of fast-growing high-quality mutton sheep with independent intellectual property rights. SUMMARY

[0004] In order to overcome the defects of the prior art, the present application provides a PLEC gene fragment as a molecular marker related to sheep body size traits, a detection method thereof and application.

[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0006] A molecular marker related to the body size trait of sheep, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at the 327th base pair position represents T or C; since the sequence has a T / C mutation at the 327th position, i.e., the 23157th base of the PLEC gene, thereby causing the T / C polymorphism of the sheep PLEC gene at the site.

[0007] A primer pair for detecting the above-mentioned molecular marker, any primer capable of specifically amplifying the above-mentioned molecular marker or a fragment containing the above-mentioned polymorphic site is suitable for detecting the molecular marker, preferably, it comprises primer M-F and primer M-R, the nucleotide sequence of the primer M-F is shown as SEQ ID NO. 2, and the nucleotide sequence of the primer M-R is shown as SEQ ID NO. 3.

[0008] A primer pair for detecting the above-mentioned molecular marker, preferably a KASPar primer pair, which comprises a forward primer A1 for detecting Allele C, a forward primer A2 for detecting Allele T and a universal reverse primer C, the nucleotide sequence of the forward primer A1 for detecting Allele C is shown as SEQ ID NO. 4, the nucleotide sequence of the forward primer A2 for detecting Allele T is shown as SEQ ID NO. 5, and the nucleotide sequence of the universal reverse primer C is shown as SEQ ID NO. 6.

[0009] A detection kit for detecting the above-mentioned molecular marker, the kit contains the primer pair or the KASPar primer pair for detecting the above-mentioned molecular marker.

[0010] A method for detecting a molecular marker related to the body size trait of sheep, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein Y at the 327th base pair position represents T or C, the method comprises detecting the genomic DNA of sheep by using the above-mentioned primer pair or kit, and the specific detection method comprises the following steps:

[0011] S1, amplifying the genomic DNA of sheep by using the above-mentioned primer pair, KASPar primer pair or kit containing the above-mentioned primer pair;

[0012] S2, identifying the polymorphic site of the amplification product obtained in step S1.

[0013] In step S2, the typing identification method includes but is not limited to direct sequencing method, probe method, gene chip method and high-resolution melting curve method.

[0014] Preferably, the specific detection method comprises the following steps: A) extracting genomic DNA from sheep blood sample, and performing PCR amplification on the sheep genomic DNA using the primer pair shown in SEQ ID NO. 2 and SEQ ID NO. 3;

[0015] B) sequencing and sequence analyzing the PCR amplification product, so as to determine the genotype by the base type of the polymorphic site.

[0016] Further preferably, the method for detecting the molecular marker related to the body size trait of sheep using the primer pair comprises the following steps:

[0017] a) extracting genomic DNA from sheep blood sample, and performing high-throughput water bath PCR amplification on the genomic DNA using the KASPar primer pair shown in nucleotide sequences of SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6;

[0018] b) after the amplification, detecting the fluorescence signal using the BMG PHERAstar instrument and checking the typing result.

[0019] The application of the detection method of the molecular marker, primer pair or kit as described above in the detection of the body size trait of sheep can determine the growth trait of sheep by detecting the molecular marker of the application in the genomic DNA of the sheep to be detected and analyzing the type of the polymorphic site, so as to screen out fast-growing sheep.

[0020] The application of the detection method of the molecular marker, primer pair or kit as described above in the breeding of sheep can determine the genotype of the PLEC gene of the sample to be detected by amplifying and detecting the genomic DNA of sheep using the primer pair or kit, so as to breed fast-growing sheep varieties.

[0021] Finding the variation site of the gene and discovering the relationship between the gene and the trait through association analysis are an important means for studying the function of the gene and the basis for marker-assisted selection. The application finds a T / C polymorphic site at the 327th site of the amplified fragment by performing PCR amplification and sequencing on the PLEC gene of the representative sheep of the Lake sheep, and determines a molecular marker related to the body size trait of sheep by detecting the polymorphism of 1313 Lake sheep and the least square model established, which can be used for the cultivation of new varieties of high-quality mutton sheep, provides an effective genetic engineering means for the genetic improvement of the body size trait of sheep, and has great practical application value.

[0022] The application detects the above molecular marker by designing KASPar primers required for competitive allele-specific PCR (KASP), which does not need to synthesize specific fluorescent probes for each SNP site, but is based on the unique ARM PCR principle, so that all site detection finally uses universal fluorescent primer amplification, greatly reducing the cost of reagents, and having high accuracy, thereby providing a simple, accurate and low-cost operation method for the detection of the molecular marker of the application.

[0023] The application has the advantages that:

[0024] The application provides a molecular marker related to the body size trait of sheep, specifically a polymorphic site of T / C at position 327 of the fragment shown in SEQ ID NO. 1, and by determining the genotype of the polymorphism, whether the sheep is a fast-growing type can be effectively identified, thereby providing an effective detection means for the selection of fast-growing sheep.

[0025] The application can be used for selecting and retaining sheep with CC homozygous genes as breeding sheep, for breeding, for improving the growth traits of sheep, and for improving the economic benefits of sheep breeding. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 It is a gel electrophoresis map of the sheep PLEC gene fragment used as a molecular marker in the application.

[0027] Figure 2 It is the sequencing result of the sheep PLEC gene mutation site in the application.

[0028] Figure 3 It is the KASPar SNP genotyping result of the T / C polymorphic site at position 327 in the amplified fragment SEQ ID NO. 1 of the sheep in the application. DETAILED DESCRIPTION

[0029] The molecular marker of the application is amplified from the PLEC gene of Lake sheep, and the specific nucleotide sequence is shown in SEQ ID NO. 1. By amplifying and sequencing the DNA sequence of the PLEC gene of Lake sheep, the polymorphic site of the PLEC gene is found, the correlation between different genotypes and the body size trait of sheep is analyzed, the detection method of the molecular marker containing the polymorphic site is established, and the molecular marker can be applied to the cultivation of new high-quality meat sheep new varieties.

[0030] The following examples are used to further illustrate the application, but should not be construed as limiting the application. Modifications or replacements made to the application without departing from the spirit and essence of the application shall fall within the scope of the application.

[0031] If not specifically indicated, the technical means used in the examples are the conventional means known to those skilled in the art, and unless otherwise specified, the reagents used in the present application are all of analytical purity or above.

[0032] Example 1 Amplification of PLEC gene

[0033] Using the DNA of PLEC gene of Hu sheep (GenBank accession number: NC_040260.1) as a template, a pair of primers, forward primer M-F and reverse primer M-R, were designed by using Oligo7.0 software, and the primer sequences were as follows:

[0034] M-F (SEQ ID NO. 2): 5'-GCTGCATTCAGTCCCTAGTCA-3'

[0035] M-R (SEQ ID NO. 3): 5'-CTAATCGTACGGTAACCTGCT-3'

[0036] (2) Amplification and sequencing of PLEC gene

[0037] The total volume of the PCR amplification reaction was 35 μL, including 1.5 μL of DNA template, 17.5 μL of 2x PCR Master Mix, 1 μL of M-F (concentration of 10 μmol / L), 1 μL of M-R (concentration of 10 μmol / L), and 14 μL of ddH2O. Among them, the DNA template was the genomic DNA extracted from the whole blood cells of sheep as the DNA template.

[0038] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, and finally 72℃ extension for 10 min.

[0039] The PCR amplification reaction product was detected by electrophoresis with 1.5% agarose gel, and the electrophoresis result was as shown in Figure 1 , in which M lane: DL 2000 Marker, 1-10 lanes: results of PLEC gene amplification. The amplified PCR fragments were sequenced, and the sequencing result showed that a specific 880 bp amplification fragment was obtained. The specific nucleotide sequence of the amplification fragment was as shown in SEQ ID NO. 1, wherein there was a polymorphic site in the fragment (SEQ ID NO. 1), specifically, Y at the 327 bp site was T or C, that is, there was a T / C polymorphism at the 23157 bp site of PLEC gene (see Figure 2 ).

[0040] Among them, SEQ ID NO. 1 was as follows:

[0041] GCTGCATTCAGTCCCTAGTCAGGAAACTAGGTCTGACAGGCCCCAGTGGAAACCTGGCACAGCCAAATTAAATGAAGAAATAAATACTTTAAAAGTTATCCAGCGATGTGCCACACAGACCCCTCACTTGCTCACAGCATCGCCCCTCTGGTCCATCTGCAGAAGGGAAGGTCAGCACGTGGGCCCAGCCCGCCACACTCGTCACAGCGGCCTTGCTCAGGTGGACCGCCTCTGCCCGGCCAGCCCTCGCCAGGGAGCTGCGGACCCCTTCCCCCGTGCCCTGGTGGTCTGCTCATCCGTGTGGGAAGGTGTCCACTTGCTTGTTCYGCCACTTACCAGTCAGTTCCAGGCTGAGTCCCTGGCTGGAGGCCCCCAGCATGTGGGATGGATGGGCTGGGTGAAGAGCGAGTGGTCTGGGAGGGCCCCTGTGAGAGACGCCCTGAGCTGAGCCCTGACCGAGGAGGACAGCGCTCAGAGAGCTGCCAGGAGGTCCGACAGGGGTCCTCTGGGGTTACTGGAGAGATGGACCCGGGGGAGTGGGTTTCATACATGAATTTCATTTCTCAATGAGCCTGGCTCAAAATTCAGAAAGAACTAGAACTTCAGTAGAAAAGAAGTGCTGTCCGAACACGCTCACCCCTGTGCTCCAGCAGCCTCTATGCTGTGGGTGCAGGTGCCCTGCAAGGCTGGCTGCTCCTGGCCATGCCGTGCACCTGACTGTCCCACGGGCTTGTCCGCAGGCGCAGAGCCCTGCCGCTCCCTTTCACGGCACGTGGCGCCCCTGCCAGCCCTCCATTAGTCTCCAGTTTTGTGTCTGGTTATCTGCGGGGAGACGCGTAGAACTCTGGCGGGTTTTCTAAGCAGGTTACCGTACGATTAG.

[0042] DNA sequence homology searches identified:

[0043] The DNA sequence (SEQ ID NO. 1) obtained after sequencing was compared with the known physiological function genes published in GenBank database for sequence homology by BLAST (Basic Local Alignment Search Tool) software of the website of National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain the functional information of the DNA sequence. The search result showed that the sequence was 99% homologous to part of the sequence of PLEC gene DNA of Hu sheep (GenBank accession number: NC_040260.1).

[0044] Establishment of genotyping detection method in Example 2

[0045] (1) Design of primer sequence

[0046] A KASPar primer pair was designed aiming at the T / C polymorphism site shown in the amplified fragment SEQ ID NO. 1 in Example 1, so as to be used for specific detection of the polymorphism site, and the nucleotide sequence of the designed KASPar primer pair was as follows:

[0047] Forward primer A1 (SEQ ID NO. 4) for detecting Allele C: 5'-GAAGGTGACCAAGTTCATGCTAAGGTGTCCACTTGCTTGTTCC-3';

[0048] Forward primer A2 (SEQ ID NO. 5) for detecting Allele T: 5'-GAAGGTCGGAGTCAACGGATTGAAGGTGTCCACTTGCTTGTTCT-3';

[0049] Common reverse primer C, common reverse primer C (SEQ ID NO. 6):

[0050] 5'-GACTCAGCCTGGAACTGACTGGT-3'.

[0051] The above primer was entrusted to Beijing Shengong Bioengineering Co., Ltd. for synthesis. Each group of primers in the KASPar primer pair was diluted to 10 μmol / L, and mixed according to the ratio of 12:12:30 of forward primer A1: forward primer A2: common reverse primer C in volume ratio for standby.

[0052] (2) DNA quality control

[0053] Genomic DNA was extracted from whole blood of sheep using a DNA extraction kit. The quality of the extracted genomic DNA was detected by 1% agarose electrophoresis and Nanodrop 2100. The qualified DNA required the following: agarose electrophoresis showed a single DNA band without obvious diffusion; Nanodrop 2100 detection A260 / 280 was between 1.8-2.0 (i.e. the DNA sample was not contaminated with protein); A260 / 230 was between 1.8-2.0 (i.e. the DNA sample had low salt ion concentration); and 270 nm had no obvious light absorption (i.e. the DNA sample was not contaminated with phenol). The amount of DNA was calculated to be 10-20 ng per sample according to the KASPar detection technology of the British LPLEC company and the size of the genome, and the extracted genomic DNA was diluted to a concentration of 10-20 ng / μL as a DNA template for standby.

[0054] (3) Genotyping detection

[0055] First, the diluted DNA template (10-20 ng / μL) was added to the 384-well reaction plate by K-pette dispensing workstation and the blank control (No template control, NTC, using sterilized water) was added to the 384-well reaction plate by K-pette dispensing workstation, 60°C drying for 30 min (dry box, LPLEC company), and the DNA was changed into dry powder for standby.

[0056] Each primer in the above KASPar primer pair was diluted to 10 μmol / L, and mixed according to the volume ratio of 12:12:30 of forward primer A1: forward primer A2: universal reverse primer C as primer mixture for standby.

[0057] Then, 1x Master mix (1536-well plate, Part No. KBS-1016-011) and primer mixture were added to each reaction well by Meridian sample loading workstation under Kraken operating system. After the Mix was dispensed, the microplate was sequentially placed on Kube heat sealer and Fusion laser sealer for film sealing, and high-throughput water bath PCR amplification was performed by Hydrocyler. The PCR reaction was performed in a high-throughput water bath system Hydrocycler, and the specific program was as follows:

[0058] 94°C pre-denaturation for 15 min;

[0059] 94°C, 20 s (denaturation) - 61°C-55°C, 1 min (annealing & extension), 10 cycles of touch down sequence amplification, each cycle decreasing by 0.6°C;

[0060] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0061] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3 As shown in the figure, each dot represents a sample to be tested. The red dot near the left indicates that the locus is homozygous for the genotype "TT"; the blue dot near the right indicates that the locus is homozygous for the genotype "CC"; and the green dot near the center indicates that the locus is heterozygous for the genotypes "TC" or "CT".

[0062] (4) Application in association analysis with sheep body size traits

[0063] The experiment examined the polymorphism of 1313 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and body size traits.

[0064] Y ijk =μ+Genotype i +P j +S k +ε ijk

[0065] Among them, Y ijk Here are the observed body size values, μ is the population mean, and Genotype. i For genotype effect, P j Due to the batch effect, S k Due to seasonal effects, ε ijk Assuming random error, let ε ijk They are independent of each other and follow an N(0, σ2) distribution.

[0066] Genotyping results showed that among the 1313 individuals, there were 89 individuals with the TT genotype, 500 individuals with the CT genotype, and 724 individuals with the CC genotype. The results of the genotype-trait association analysis are shown in Table 1. In the table, "Hight" represents body height (the vertical distance from the top of the sheep's scapula to the ground while standing), and "Length" represents body length (the distance from the shoulder joint to the posterior edge of the ischial tuberosity), both in cm. "Hight80" represents the average body height of the 1313 sheep on day 80; "Length 80" represents the average body length of the 1313 sheep on day 80, and so on.

[0067] Table 1. Association analysis of PLEC gene polymorphism and growth traits in Hu sheep.

[0068]

[0069]

[0070] Note: The same row data between the different letters indicate significant differences (P < 0.05), the same letter or no letter indicates no significant difference (P > 0.05).

[0071] The results showed that the T / C polymorphism site at position 327 in the amplified fragment SEQ ID NO. 1, i.e. the 23157th position of the PLEC gene, was significantly related to the body size of sheep as the determination period was prolonged. The results showed that the body height and body length of sheep carrying CC genotype were superior to those of sheep carrying TT genotype (P < 0.05). It can be seen that the C allele is the dominant allele. In breeding, the CC genotype is selected for breeding, and the CC genotype is used as a breeding sheep to cross with other sheep. Especially using the semen of CC genotype ram to perform artificial insemination can greatly improve the breeding efficiency, obtain sheep flock with growth advantage, and to a certain extent, improve the carcass traits of sheep, so that the sheep breeding has greater economic benefits.

Claims

1. A molecular marker associated with a body size trait in sheep, characterized in that, The nucleotide sequence is shown as SEQ ID NO. 1, wherein Y at 327bp represents T or C, and the mutation results in T / C polymorphism of the molecular marker.

2. A KASPar primer pair for detecting the molecular marker of claim 1, characterized in that, The KASPar primer pair of claim 2, wherein the forward primer A1 for detecting Allele C has the nucleotide sequence shown as SEQ ID NO. 4, the forward primer A2 for detecting Allele T has the nucleotide sequence shown as SEQ ID NO. 5, and the universal reverse primer C has the nucleotide sequence shown as SEQ ID NO.

6.

3. A test kit for detecting the molecular marker of claim 1, characterized by, The KASPar primer pair of claim 2.

4. The method for detecting the molecular marker of claim 1, comprising the following steps: S1, using the KASPar primer pair of claim 2, or using the kit of claim 3, to amplify the genomic DNA of sheep; S2, performing genotyping on the polymorphic site of the amplification product obtained in step S1.

5. The method of claim 4, wherein, The genotyping method in step S2 is fluorescence probe method, gene chip method or high resolution melting curve method.

6. The method of claim 4, wherein, PCR amplification is performed using the KASPar primer pair of claim 2, and after the amplification, the genotyping result is determined by detecting the fluorescence signal.

7. The application of the molecular marker of claim 1 or the KASPar primer pair of claim 2, or the kit of claim 3, or the method of any one of claims 4-6 in detecting the body size trait of sheep.

8. The application of the molecular marker of claim 1 or the KASPar primer pair of claim 2, or the kit of claim 3, or the method of any one of claims 4-6 in sheep breeding.

9. Use according to claim 7, characterized in that, The breeding purpose is to select fast-growing sheep.

Images