Preparation method and application of DNA and RNA hybrid nanoflowers

Abstract

The invention relates to a preparation method and application of DNA and RNA hybrid nanoflowers, which effectively solve the problem of nanomedicines with suitable particle size, high biosafety, high drug loading, and the ability to target cerebral hemorrhage sites, capture hemoglobin, and regulate brain inflammatory microenvironment. A phosphorylated DNA template containing a hemoglobin aptamer sequence, a primer, and a buffer containing a DNA ligase are mixed for cyclization reaction to obtain a circular DNA template containing the hemoglobin aptamer sequence; a phosphorylated DNA template containing a miR-124 sequence and a primer are mixed in a buffer containing a DNA ligase for cyclization reaction to obtain a circular DNA template containing the miR-124 sequence; the circular DNA template containing the hemoglobin aptamer sequence, dNTP, and a DNA polymerase are subjected to rolling circle replication in an RNA polymerase buffer, a circular DNA template containing the miR-124 sequence is added, rolling circle replication and rolling circle transcription are carried out simultaneously, the reaction is terminated, and centrifugation is performed to obtain a hybrid nanoflower; the preparation method of the invention is easy to operate, safe to use, and has good efficacy.

Description

Technical Field

[0001] The present invention relates to the medical field, and in particular to a preparation method of DNA and RNA hybrid nanoflowers and applications thereof. Background Art

[0002] The constituent bases of DNA are ATGC, and the unit is deoxynucleotide. The constituent bases of RNA are AUGC, and the unit is ribonucleotide. DNA is a double helix structure and belongs to genetic material. RNA is generally single-stranded and does not serve as genetic material. RNA is a single-stranded strand formed by transcription based on the principle of complementary base pairing, using one strand of DNA as a template. Its main function is to realize the expression of genetic information on proteins and is a bridge in the process of genetic information transformation into phenotype. Unlike DNA, RNA is generally a single-stranded long molecule and does not form a double helix structure, but many RNAs also need to form certain secondary structures or even tertiary structures through the principle of base pairing to perform biological functions. The base pairing rules of RNA are basically the same as those of DNA, but in addition to AU and GC pairing, GU can also pair. In terms of viruses, many viruses only use RNA as their only genetic information carrier (different from the double-stranded DNA commonly used as a carrier in cellular organisms). The mRNA in RNA is the template for protein synthesis, and its content is transcribed according to the DNA in the cell nucleus. tRNA is the identifier of the base sequence (i.e., genetic codon) on the mRNA and the transporter of amino acids. rRNA is a component of the ribosome and is the workplace for protein synthesis. It is of great significance in the treatment of disease drugs.

[0003] Intracerebral hemorrhage is the most deadly subtype of stroke, affecting the lives and health of millions of people every year. Although the incidence of intracerebral hemorrhage only accounts for 10-15% of all stroke types, it has a high mortality and disability rate. Patients with intracerebral hemorrhage often suffer from severe and long-term neurological damage. Although some patients can receive relatively appropriate treatment for the primary injury of intracerebral hemorrhage, the secondary injury caused by blood entering the brain parenchyma can lead to more severe inflammation, causing neurological damage, disability or even death in patients, which is an important factor in determining the patient's prognosis.

[0004] Studies have shown that secondary injury is mainly caused by hemoglobin in blood lysates and neuroinflammation mediated by activated microglia. After cerebral blood vessels rupture, blood enters the brain parenchyma and quickly forms a hematoma. The activated complement system causes the red blood cells in the blood to lyse and release a large amount of hemoglobin. These excess free hemoglobins can cause neurotoxicity. In addition, excessive hemoglobin polarizes microglia in brain tissue to M1 type (pro-inflammatory type), causing them to release a variety of inflammatory factors, chemokines, etc., exacerbating the formation of an inflammatory microenvironment in the brain. Therefore, efficiently capturing hemoglobin and regulating the inflammatory microenvironment in the brain is expected to effectively treat cerebral hemorrhage.

[0005] MiR-124 is considered to be a brain-specific microRNA and is highly expressed in the brain. Studies have shown that it can effectively regulate the phenotype of microglia to an anti-inflammatory phenotype. Nucleic acid aptamers are a type of short-chain DNA or RNA with high affinity to the target. Studies have screened out DNA aptamers that are specific to Hb. Therefore, co-delivery of Hb aptamers and miR-124 is expected to effectively treat cerebral hemorrhage. Nucleic acid nanoflowers are petal-shaped nucleic acid nanospheres that form a large number of nucleic acid copies through rolling circle amplification of nucleic acid fragments. The high-density overlap of nucleic acid chains on its surface makes it highly stable to nucleases, significantly improving the application range of nucleic acid drugs. However, current nucleic acid nanoflowers can only deliver a single DNA drug or RNA drug, and cannot deliver two different types of nucleic acids at the same time. Therefore, there is an urgent need for a new rolling circle amplification method that can achieve the co-delivery of Hb aptamers and miR-124. The present invention synthesizes a DNA and RNA hybrid nanoflower that includes both DNA and miRNA by optimizing the rolling circle amplification method, and uses it to treat cerebral hemorrhage, but there has been no public report so far. Summary of the invention

[0006] In view of the above situation, in order to overcome the defects of the prior art, the purpose of the present invention is to provide a preparation method and application of DNA and RNA hybrid nanoflowers, which can effectively solve the problem of nanomedicines with suitable particle size, high biosafety, high drug loading, and the ability to target the site of cerebral hemorrhage, capture hemoglobin, and regulate the inflammatory microenvironment of the brain.

[0007] The technical solution provided by the present invention is a method for preparing a DNA and RNA hybrid nanoflower, wherein the hybrid nanoflower contains a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), comprising the following steps:

[0008] 1) Mix the phosphorylated DNA template SEQ ID No. 1 containing the hemoglobin aptamer sequence at a concentration of 1 μM, the primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing DNA ligase at a volume ratio of 10:1:10, and perform a cyclization reaction at a temperature of 18-25°C for 3-4 hours to obtain a circular DNA template containing the hemoglobin aptamer sequence;

[0009] The phosphorylated DNA template containing the hemoglobin aptamer sequence is prepared by mixing a 10 μM DNA template containing the hemoglobin aptamer sequence, a 1 mM APT, a 0.25 U / μL T4 polynucleotide kinase and a T4 polynucleotide kinase buffer at a volume ratio of 1:1:0.25:10, and performing a phosphorylation reaction at 37°C for 1 h to obtain a phosphorylated DNA template containing the hemoglobin aptamer sequence.

[0010] The T4 polynucleotide kinase buffer is an aqueous solution containing 50 mM Tris-HCl, 10mM MgCl2, 5 mM dithiothreitol, 0.1 mM spermidine, 0.1 mM adenosine diphosphate;

[0011] The DNA template and primers containing the hemoglobin aptamer sequence are from Shenzhen BGI Co., Ltd., and the sequence information of the hemoglobin aptamer is 5'-ACAGCACCACAGACCAACAGCTACCATCTAACACTCGCGTCGTCTCCCTCACCT-3';

[0012] The buffer containing DNA ligase is an aqueous solution containing 40 mM Tris-HCl, 10 mM MgCl2, 10 mM dithiothreitol, 0.5 mM adenosine triphosphate, and 0.5U / μL T4 DNA ligase;

[0013] 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 18-25°C for 3-4 hours to obtain a circular DNA template containing the miR-124 sequence;

[0014] The phosphorylated DNA template containing the miR-124 sequence is prepared by mixing a 10 μM DNA template containing the miR-124 sequence, 1 mM ATP, and 0.5 U / μL T4 polynucleotide kinase in a buffer containing T4 polynucleotide kinase, with the volume ratio of 1:1:0.5:10, and performing a phosphorylation reaction at 37°C for 1 h to obtain a phosphorylated DNA template containing the miR-124 sequence;

[0015] The DNA template and primers containing the miR-124 sequence were from Shenzhen BGI Co., Ltd.;

[0016] The sequence information of the DNA template containing the miR-124 sequence is 5'-TCGTATTAACGTACCAACAATAAGGCACGCGGTGAATGCCACTTGGGCATTCACCGCGTGCCTTATTTAGAGGCATATCCCTATAGTGAG-3';

[0017] name Sequence (5'-3') SEQ ID No.1 ACAGCACCACAGACCAACAGCTACCATCTAACACTCGCGTCGTCTCCCTCACCTGGTGTTTGTCTTCCTGCC SEQ ID No.2 TCTGTGGTGCTGTGGCAGGAAGACAAAC SEQ ID No.3 TCGTATTAACGTACCAACAATAAGGCACGCGGTGAATGCCACTTGGGCATTCACCGCGTGCCTTATTTAGAGGCATATCCCTATAGTGAG SEQ ID No.4 TTGTTGGTACGTTAATACGACTCACTATAGGGAT

[0018] 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer;

[0019] The DNA polymerase is phi29 DNA polymerase, the concentration is 1U / μL, and the dNTP concentration is 1mM;

[0020] The concentration of the RNA polymerase buffer is an aqueous solution containing 40 mM Tris-HCl, 6 mM MgCl2, 1 mM dithiothreitol, and 2 mM spermidine;

[0021] 4) After 18-22 minutes of rolling circle replication reaction at 36-38°C, the circular DNA template containing the miR-124 sequence is mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system, so that rolling circle replication and rolling circle transcription are carried out simultaneously, wherein the circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer are in a volume ratio of 100:16:20:20, and react at 36-38°C for 28-32 hours, and the reaction mixture is placed at 92-98°C for 4-6 minutes to terminate the reaction, and centrifuged at 10000-12000g for 20-22 minutes to obtain a precipitate, and the precipitate is washed with double distilled water (ddH2O) for 20-22 minutes to obtain a hybrid nanoflower;

[0022] The final concentration of rNTP is 2.5 mM;

[0023] The RNA polymerase is T7 RNA polymerase, with a concentration of 0.5U / μL;

[0024] The final concentration of the RNA polymerase buffer is an aqueous solution containing 40 mM Tris-HCl, 6 mM MgCl2, 1 mM dithiothreitol, and 2 mM spermidine;

[0025] The hybrid nano flower particles are spherical particles with a size of 400-600 nm and have layered petal-like wrinkles on the surface.

[0026] Application of the hybrid nanoflower prepared by the method of the present invention in preparing a drug for treating cerebral hemorrhage.

[0027] The raw materials of the invention are abundant and easily available, the preparation method is easy to operate, the use is safe, the curative effect is good, and the invention is effectively used for the treatment of cerebral hemorrhage. The invention is an innovation in the rolling circle amplification technology and has huge economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is a scanning electron microscope image of the hybrid nanoflower of the present invention;

[0029] Figure 2 This is a particle size analysis diagram of the hybrid nanoflower of the present invention;

[0030] Figure 3 This is a graph showing the binding characteristics of the hybrid nanoflower of the present invention to Hb;

[0031] Figure 4 This is a diagram showing the regulation of the content of miR-124 in microglia by the hybrid nanoflower of the present invention;

[0032] Figure 5 This is a result diagram of the protective effect of the hybrid nanoflower of the present invention on Hb-induced neural cells;

[0033] Figure 6 This is a diagram showing the results of the hybrid nanoflowers of the present invention regulating the phenotype of microglia;

[0034] Figure 7 This is a graph showing the results of measuring the effect of the hybrid nanoflowers of the present invention on the apoptosis of nerve cells;

[0035] Figure 8 This is a diagram of brain hematoma area in mice with cerebral hemorrhage in different treatment groups of hybrid nanoflowers of the present invention;

[0036] Fig. 9 The NeuN staining image results of brain tissues of the hybrid nanoflowers in different treatment groups of the present invention are shown;

[0037] Fig.10 This is the TUNEL staining image result of brain tissue in different treatment groups of the hybrid nanoflowers of the present invention. DETAILED DESCRIPTION

[0038] The specific implementation modes of the present invention are described in detail below in combination with embodiments and specific situations.

[0039] The present invention is specifically implemented by the following examples.

[0040] Example 1

[0041] The present invention provides a method for preparing a DNA and RNA hybrid nanoflower, wherein the hybrid nanoflower contains a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), comprising the following steps:

[0042] 1) Mix the phosphorylated DNA template SEQ ID No. 1 containing the hemoglobin aptamer sequence at a concentration of 1 μM, the primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing DNA ligase at a volume ratio of 10:1:10, and perform a cyclization reaction at a temperature of 22°C for 3.5 hours to obtain a circular DNA template containing the hemoglobin aptamer sequence;

[0043] 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 22°C for 3.5 hours to obtain a circular DNA template containing the miR-124 sequence;

[0044] 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer;

[0045] 4) After 20 minutes of rolling circle replication reaction at 37°C, the circular DNA template containing the miR-124 sequence was mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system to allow rolling circle replication and rolling circle transcription to proceed simultaneously. The circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer were in a volume ratio of 100:16:20:20. The reaction was carried out at 37°C for 30 hours. The reaction mixture was placed at 95°C for 5 minutes to terminate the reaction. The reaction was centrifuged at 12000g for 20 minutes to obtain a precipitate, which was washed with double distilled water (ddH2O) for 21 minutes to obtain a hybrid nanoflower.

[0046] Example 2

[0047] The present invention provides a method for preparing a DNA and RNA hybrid nanoflower, comprising the following steps:

[0048] 1) A phosphorylated DNA template SEQ ID No. 1 containing a hemoglobin aptamer sequence at a concentration of 1 μM, a primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing a DNA ligase were mixed together at a volume ratio of 10:1:10, and a cyclization reaction was performed at a temperature of 19°C for 4 hours to obtain a circular DNA template containing a hemoglobin aptamer sequence;

[0049] 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 19°C for 4 hours to obtain a circular DNA template containing the miR-124 sequence;

[0050] 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer;

[0051] 4) After 19 minutes of rolling circle replication reaction at 37.5°C, the circular DNA template containing the miR-124 sequence was mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system to allow rolling circle replication and rolling circle transcription to proceed simultaneously. The circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer were mixed in a volume ratio of 100:16:20:20, and the reaction was carried out at 36°C for 32 hours. The reaction mixture was placed at 92°C for 6 minutes to terminate the reaction, and the mixture was centrifuged at 10,000 g for 22 minutes to obtain a precipitate. The precipitate was washed with double distilled water (ddH2O) for 20 minutes to obtain a hybrid nanoflower.

[0052] Example 3

[0053] The present invention provides a method for preparing a DNA and RNA hybrid nanoflower, wherein the hybrid nanoflower contains a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), comprising the following steps:

[0054] 1) Mix the phosphorylated DNA template SEQ ID No. 1 containing the hemoglobin aptamer sequence at a concentration of 1 μM, the primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing DNA ligase at a volume ratio of 10:1:10, and perform a cyclization reaction at a temperature of 25°C for 3 hours to obtain a circular DNA template containing the hemoglobin aptamer sequence;

[0055] 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 25°C for 3 hours to obtain a circular DNA template containing the miR-124 sequence;

[0056] 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer;

[0057] 4) After 18 minutes of rolling circle replication reaction at 38°C, the circular DNA template containing the miR-124 sequence was mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system to allow rolling circle replication and rolling circle transcription to proceed simultaneously. The circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer were in a volume ratio of 100:16:20:20. The reaction was carried out at 38°C for 28 hours. The reaction mixture was placed at 98°C for 4 minutes to terminate the reaction. The mixture was centrifuged at 11000g for 22 minutes to obtain a precipitate, which was washed with double distilled water (ddH2O) for 22 minutes to obtain a hybrid nanoflower.

[0058] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, which should all be included in the protection scope of the present invention.

[0059] The hybrid nanoflower prepared by the present invention is easy to operate, the raw materials are abundant and easy to obtain, the product quality is good, and it can be effectively used to treat cerebral hemorrhage. The experiment has achieved very good beneficial technical effects. The relevant experimental data are as follows (taking Example 1 as an example):

[0060] Detection and analysis

[0061] 1) DNA and RNA hybrid nanoflowers (h-DRNS) were analyzed by scanning electron microscopy, scale bar 100 nm, the results are as follows Figure 1 shown.

[0062] from Figure 1 From the observation and analysis, it can be seen that the hybrid nanoflower (h-DRNS) is spherical and has layered petal-like wrinkles on the surface.

[0063] 2) The particle size distribution (n = 3) of DNA and RNA hybrid nanoflowers (h-DRNS) was analyzed by hydrodynamics. The results are as follows: Figure 2 shown.

[0064] from Figure 2 From the analysis, we can see that the hydrodynamic size of DNA and RNA hybrid nanoflowers (h-DRNS) is about 488 nm and its Zeta potential is about −30 mV.

[0065] 3) Testing the Hb capture ability of DNA and RNA hybrid nanoflowers (h-DRNS)

[0066] The specific operation is as follows: Hb solution (0.4 mg / ml) was mixed with nanoflowers and incubated at 37°C for 2 h, and then at 4°C, 12000 g , centrifuged for 20 min, and the Hb concentration (μg / mL) in the supernatant was detected by UV-VIS spectrometer (UV2550, Japan).

[0067] from Figure 3 The analysis showed that compared with RNS, DNS and h-DRNS could significantly reduce the concentration of Hb in the supernatant, indicating that nanoflowers containing Hb aptamers can effectively capture Hb, which provides a theoretical basis for their protection of nerve cells.

[0068] 4) Determination of the regulation of miR-124 content in microglia by DNA and RNA hybrid nanoflowers (h-DRNS)

[0069] Specifically, after BV2 cells adhered to the wall and grew, they were cultured for 24 hours in a medium without FBS, including a blank group with a medium without any preparations, and an experimental group with DNS (2 nM), RNS (2 nM), and h-DRNS (2 nM). The cells were then collected, total RNA was extracted with Trizol reagent, and then reverse transcribed to obtain cDNA, and then miR-124 was detected by qRT-PCR. The miR-124 primers were 5'-GAGTAAGGCACGCGGTGAA-3' (forward) and 5'-TATGGTTCTTGACGACTGGTTGAC-3' (reverse).

[0070] from Figure 4 The analysis showed that both RNS and h-DRNS could significantly upregulate the content of miR-124 in BV2 cells.

[0071] 5) DNA and RNA hybrid nanoflowers (h-DRNS) were tested to see if they could reduce the damage of Hb to nerve cells:

[0072] Specifically: HT-22 cells (5×10 3Cells / well) were cultured in 100 μL culture medium (96-well plate) until adherent growth. Blank group: culture medium without any preparation, positive control group: Hb (50 μM), experimental group 1: Hb (50 μM) + RNS (10 nM), experimental group 2: Hb (50 μM) + RNS (10 nM), experimental group 3: Hb (50 μM) + h-DRNS (10 nM), the three groups were incubated with HT-22 cells (5×10 3 The cells were incubated for 24 h and the cell viability was assessed by MTT assay. Figure 5 shown.

[0073] from Figure 5 The analysis showed that both DNS and h-DRNS could significantly reduce the damage to HT-22 cells, indicating that the hybrid nanoflowers could protect nerve cells by capturing Hb.

[0074] 6) Microglial phenotype analysis experiment

[0075] iNOS expression assay: BV2 cells (2×10 5 Cells / well) were cultured in 1 mL of culture medium (6-well plate) until they adhered to the wall. Blank group: culture medium without FBS was added, positive control group: LPS (10 μg / ml), experimental group 1: LPS (10 μg / ml) + RNS (10 nM), experimental group 2: LPS (10 μg / ml) + RNS (10 nM), experimental group 3: LPS (10 μg / ml) + h-DRNS (10 nM), and the five groups were incubated with BV2 cells (2×10 5 ) were incubated for 24 hours, and the expressions of iNOS and CD206 in cells were detected by immunofluorescence. Figure 6 shown.

[0076] from Figure 6 It can be seen that both RNS and h-DRNS can effectively reduce the expression of iNOS and promote the expression of CD206 in BV2 cells, indicating that the presence of miR-124 in DNA and RNA hybrid nanoflowers (h-DRNS) can effectively promote the transformation of BV2 cell phenotype to M2 type.

[0077] 7) DNA and RNA hybrid nanoflowers (h-DRNS) were used to resist neuronal apoptosis

[0078] HT-22 cells and BV2 cells were co-cultured using Transwell chambers. HT-22 cells (5×10 4 cells / well) were cultured in 0.5 ml of culture medium (lower chamber), and BV2 cells (10 4Cells / well) were cultured in 0.1 ml culture medium (upper chamber) until adherence. Blank group: added culture medium without FBS, positive control group: Hb (100 μM), experimental group 1: Hb (100 μM) + RNS (10 nM), experimental group 2: Hb (100 μM) + RNS (10 nM), experimental group 3: Hb (100 μM) + h-DRNS (10 nM), the five groups were incubated with BV2 cells in culture medium without FBS for 24 hours, and the apoptosis of neurons in the lower chamber was detected by live-dead cell staining. The results are shown in Figure 7 shown.

[0079] from Figure 7 The analysis shows that the three preparations can protect nerve cells to varying degrees, among which DNA and RNA hybrid nanoflowers (h-DRNS) have the best effect, indicating that on the one hand, it inhibits the damage of nerve cells by capturing Hb, and on the other hand, it protects nerve cells by regulating the phenotype of BV2 cells.

[0080] 8) DNA and RNA hybrid nanoflowers (h-DRNS) were used for in vivo hemorrhagic stroke efficacy experiments

[0081] The cerebral hemorrhage model was established by intracerebral injection of 0.0375U collagenase (type IV) into the striatum of each mouse brain. (1) Normal saline (control group); (2) RNS (experimental group 1); (3) DNS (experimental group 2); (4) h-DRNS (experimental group 3). The drugs were administered through the tail vein at 4, 24, and 36 hours. Brain tissues were collected 48 hours after treatment and sliced ​​to detect the area of ​​cerebral hematoma. The results are shown in Figure 2. Figure 8 NeuN and TUNEL staining were used to analyze the neuronal cell inventory and pathology. Fig. 9 and Fig.10 shown.

[0082] Figure 8 In the experiment, all three preparations could reduce the hematoma area to varying degrees. Among them, the hybrid nanoflower (h-DRNS) had the best effect. Compared with the normal saline group, the hematoma area was reduced by 21.98 times, indicating that the hybrid nanoflower (h-DRNS) can synergistically treat cerebral hemorrhage through Hb capture and inflammatory ablation.

[0083] NeuN staining results showed that a large number of nerve cells died after cerebral hemorrhage, and RNS treatment had only a weak effect, indicating that in the absence of Hb aptamer, it was difficult for the preparation to efficiently target the site of cerebral hemorrhage. AD exerted a certain therapeutic effect by targeting the site of cerebral hemorrhage and capturing Hb. DNA and RNA hybrid nanoflowers (h-DRNS) effectively protected nerve cells by exerting a synergistic effect to efficiently target the brain and capture Hb, regulate brain inflammation, and effectively protect nerve cells.

[0084] from Fig. 9 , 10 The analysis shows that the hybrid nanoflower (h-DRNS) can effectively reduce the number of apoptotic cells in the site of cerebral hemorrhage. This is due to the efficient co-delivery of Hb aptamer and miR-124 by the hybrid nanoflower (h-DRNS). On the one hand, h-DRNS can capture a large amount of Hb in the site of cerebral hemorrhage, and on the other hand, it achieves the precise delivery of miR-124 to microglia, synergistically treating cerebral hemorrhage by promoting hematoma clearance and protecting nerve cells.

[0085] The DNA and RNA hybrid nanoflower (h-DRNS) in the present invention provides a new drug for treating cerebral hemorrhage. Through the targeting effect of the Hb aptamer, the hybrid nanoflower can efficiently target the site of cerebral hemorrhage and specifically bind to Hb, promote the transport of Hb to microglia, and reduce the damage of Hb to nerve cells. At the same time, the delivery of miR-124 to microglia is achieved, and the action of miR-124 promotes the transformation of microglia to an anti-inflammatory phenotype, reshapes the inflammatory microenvironment of the brain, and synergistically treats cerebral hemorrhage. The DNA and RNA hybrid nanoflower (h-DRNS) provided by the present invention is a major innovation in gene therapy for cerebral hemorrhage.

[0086] While the above experiment was conducted on Example 1, experiments were also conducted on other examples, all of which obtained the same or similar results, which will not be listed here one by one.

[0087] Experiments show that the hybrid nanoflower prepared by the present invention is easy to operate, the raw materials are abundant and easy to obtain, the product quality is good, and it can be effectively used to treat cerebral hemorrhage. Compared with the prior art, it has the following beneficial technical effects:

[0088] 1. The DNA and RNA hybrid nanoflower provided by the present invention is formed by self-assembly of long-chain nucleic acids containing hemoglobin DNA aptamers and miR-124. It is a carrier-free pure nucleic acid nanostructure with 100% drug loading capacity. In addition, nucleic acids, as endogenous molecules in organisms, have high safety. Therefore, the hybrid nanoflower provided by the present invention has almost no side effects, good therapeutic effect and high safety.

[0089] 2. The DNA and RNA hybrid nanoflowers provided by the present invention do not need to be modified with other brain-targeting molecules, and can be directly targeted to the site of cerebral hemorrhage, and specifically bind to hemoglobin to form a hybrid nanoflower-hemoglobin complex. It can then be targeted to microglia again, thereby achieving the precise delivery of miR-124 to microglia. By combining hemoglobin clearance and brain inflammatory microenvironment regulation, efficient synergistic treatment of cerebral hemorrhage is achieved.

[0090] 3. The DNA and RNA hybrid nanoflowers provided by the present invention have innovated the existing rolling circle amplification technology, and for the first time, rolling circle replication and rolling circle transcription are simultaneously performed in one system, providing a new preparation technology for nucleic acid nanoflowers. The technical principle of the present invention is based on the self-assembly between nucleic acids. By designing the template DNA sequence, nanoflowers containing other miRNA sequences can be obtained. Therefore, the DNA and RNA hybrid nanoflowers provided by the present invention can be used as a universal miRNA delivery platform to achieve precise intracellular delivery of various miRNAs during cerebral hemorrhage.

[0091] 4. The miR-124 of the present invention is a miRNA that can regulate the phenotype of microglia. The half-life of miR-124 in vivo is improved by delivering miR-124 through hybrid nanoflowers. The targeting ability of hemoglobin aptamers is utilized to increase the stability and targeting of miR-124, which will provide a new solution for the in vivo delivery of miRNA and have huge economic and social benefits.

Claims

1. A method for preparing a DNA and RNA hybrid nanoflower, wherein the hybrid nanoflower contains a hemoglobin DNA aptamer and microRNA-124 (miRNA-124), The following steps are involved: 1) Mix the phosphorylated DNA template SEQ ID No. 1 containing the hemoglobin aptamer sequence at a concentration of 1 μM, the primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing DNA ligase at a volume ratio of 10:1:10, and perform a cyclization reaction at a temperature of 18-25°C for 3-4 hours to obtain a circular DNA template containing the hemoglobin aptamer sequence; The phosphorylated DNA template containing the hemoglobin aptamer sequence is prepared by mixing a 10 μM DNA template containing the hemoglobin aptamer sequence, a 1 mM APT, a 0.25 U / μL T4 polynucleotide kinase and a T4 polynucleotide kinase buffer at a volume ratio of 1:1:0.25:10, and performing a phosphorylation reaction at 37°C for 1 h to obtain a phosphorylated DNA template containing the hemoglobin aptamer sequence. The T4 polynucleotide kinase buffer contains 50 mM Tris-HCl, 10 mM MgCl 2 , 5 mM dithiothreitol, 0.1 mM spermidine, 0.1 mM adenosine diphosphate in water; The DNA template contains a hemoglobin aptamer sequence, and the sequence information of the hemoglobin aptamer is 5'-ACAGCACCACAGACCAACAGCTACCATCTAACACTCGCGTCGTCTCCCTCACCT-3'; The buffer containing DNA ligase is 40 mM Tris-HCl, 10 mM MgCl 2 , 10 mM dithiothreitol, 0.5 mM adenosine triphosphate, 0.5 U / μL T4 DNA ligase in water; 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 18-25°C for 3-4 hours to obtain a circular DNA template containing the miR-124 sequence; The phosphorylated DNA template containing the miR-124 sequence is prepared by mixing a 10 μM DNA template containing the miR-124 sequence, 1 mM ATP, and 0.5 U / μL T4 polynucleotide kinase in a buffer containing T4 polynucleotide kinase, with the volume ratio of 1:1:0.5:10, and performing a phosphorylation reaction at 37°C for 1 h to obtain a phosphorylated DNA template containing the miR-124 sequence; The sequence information of the DNA template containing the miR-124 sequence is 5'-TCGTATTAACGTACCAACAATAAGGCACGCGGTGAATGCCACTTGGGCATTCACCGCGTGCCTTATTTAGAGGCATATCCCTATAGTGAG-3'; 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer; The DNA polymerase is phi29 DNA polymerase, the concentration is 1U / μL, and the dNTP concentration is 1mM; The concentration of the RNA polymerase buffer is 40 mM Tris-HCl, 6 mM MgCl 2 , 1 mM dithiothreitol, 2 mM spermidine in water; 4) After 18-22 minutes of rolling circle replication reaction at 36-38°C, the circular DNA template containing the miR-124 sequence is mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system, so that rolling circle replication and rolling circle transcription are carried out simultaneously, wherein the circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer are in a volume ratio of 100:16:20:20, and the reaction is carried out at 36-38°C for 28-32 hours, and the reaction mixture is placed at 92-98°C for 4-6 minutes to terminate the reaction, and centrifuged at 10000-12000g for 20-22 minutes to obtain a precipitate, and the precipitate is washed with double distilled water for 20-22 minutes to obtain a hybrid nanoflower; The final concentration of rNTP is 2.5 mM; The RNA polymerase is T7 RNA polymerase, with a concentration of 0.5U / μL; The final concentration of the RNA polymerase buffer contained 40 mM Tris-HCl, 6 mM MgCl 2 , 1 mM dithiothreitol, 2 mM spermidine in water; The hybrid nanoflowers are spherical particles of 400-600 nm, and have layered petal-like wrinkles on the surface.

2. The method for preparing the DNA and RNA hybrid nanoflower according to claim 1, It is characterized in that The following steps are involved: 1) Mix the phosphorylated DNA template SEQ ID No. 1 containing the hemoglobin aptamer sequence at a concentration of 1 μM, the primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing DNA ligase at a volume ratio of 10:1:10, and perform a cyclization reaction at a temperature of 22°C for 3.5 hours to obtain a circular DNA template containing the hemoglobin aptamer sequence; 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 22°C for 3.5 hours to obtain a circular DNA template containing the miR-124 sequence; 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer; 4) After 20 minutes of rolling circle replication reaction at 37°C, the circular DNA template containing the miR-124 sequence is mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system to allow rolling circle replication and rolling circle transcription to proceed simultaneously. The circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer are in a volume ratio of 100:16:20:

20. The reaction is carried out at 37°C for 30 hours. The reaction mixture is placed at 95°C for 5 minutes to terminate the reaction. The reaction is centrifuged at 12000g for 20 minutes to obtain a precipitate, which is washed with double distilled water for 21 minutes to obtain a hybrid nanoflower.

3. The method for preparing the DNA and RNA hybrid nanoflower according to claim 1, It is characterized in that The following steps are involved: 1) Mix the phosphorylated DNA template SEQ ID No. 1 containing the hemoglobin aptamer sequence at a concentration of 1 μM, the primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing DNA ligase at a volume ratio of 10:1:10, and perform a cyclization reaction at a temperature of 19°C for 4 hours to obtain a circular DNA template containing the hemoglobin aptamer sequence; 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 19°C for 4 hours to obtain a circular DNA template containing the miR-124 sequence; 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer; 4) After 19 minutes of rolling circle replication reaction at 37.5℃, the circular DNA template containing the miR-124 sequence was mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system, so that rolling circle replication and rolling circle transcription were carried out simultaneously. The volume ratio of the circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer was 100:16:20:20, and the reaction was carried out at 36℃ for 32 hours. The reaction mixture was placed at 92℃ for 6 minutes to terminate the reaction, and the precipitate was obtained by centrifugation at 10000g for 22 minutes. The precipitate was washed with double distilled water for 20 minutes to obtain hybrid nanoflowers.

4. The method for preparing the DNA and RNA hybrid nanoflower according to claim 1, It is characterized in that The following steps are involved: 1) Mix the phosphorylated DNA template SEQ ID No. 1 containing the hemoglobin aptamer sequence at a concentration of 1 μM, the primer SEQ ID No. 2 at a concentration of 1 μM, and a buffer containing DNA ligase at a volume ratio of 10:1:10, and perform a cyclization reaction at a temperature of 25°C for 3 hours to obtain a circular DNA template containing the hemoglobin aptamer sequence; 2) Mix the phosphorylated DNA template SEQ ID No. 3 containing the miR-124 sequence at a concentration of 1 μM and the primer SEQ ID No. 4 at a concentration of 1.5 μM in a buffer containing DNA ligase at a volume ratio of 10:1.5:10, and perform a cyclization reaction at a temperature of 25°C for 3 hours to obtain a circular DNA template containing the miR-124 sequence; 3) The circular DNA template containing the hemoglobin aptamer sequence, dNTP, and DNA polymerase in a volume ratio of 100:20:2.5:20 were subjected to rolling circle replication in an RNA polymerase buffer; 4) After 18 minutes of rolling circle replication reaction at 38°C, the circular DNA template containing the miR-124 sequence was mixed with rNTP, RNA polymerase and RNA polymerase buffer into the rolling circle replication system to allow rolling circle replication and rolling circle transcription to proceed simultaneously. The circular DNA template containing the miR-124 sequence, rNTP, RNA polymerase and RNA polymerase buffer were in a volume ratio of 100:16:20:

20. The reaction was carried out at 38°C for 28 hours. The reaction mixture was placed at 98°C for 4 minutes to terminate the reaction. The reaction was centrifuged at 11000g for 22 minutes to obtain a precipitate, which was washed with double distilled water for 22 minutes to obtain a hybrid nanoflower.

5. Use of the DNA and RNA hybrid nanoflowers prepared by the method according to any one of claims 1 to 4 in the preparation of drugs for treating cerebral hemorrhage.

Images