A kind of brewer's yeast strain for producing breast milk lipid substitute and its application

Abstract

The present invention discloses a saccharomyces cerevisiae strain for producing a breast milk lipid substitute, which increases the content of palmitic acid (C16:0) at the Sn-2 position of triglycerides produced by saccharomyces cerevisiae by integrating a heterologous lysophosphatidic acid acyltransferase into saccharomyces cerevisiae and knocking out its own natural lysophosphatidic acid acyltransferase, synthesizes breast milk substitute fat, and knocks out genes related to metabolic pathways on this basis, further increasing the content of breast milk lipid substitute in the product. The present invention realizes the de novo synthesis of breast milk lipid substitutes using saccharomyces cerevisiae for the first time, achieving more than 15% of total fatty acids, and the relative content of C16:0 at the Sn-2 position reaches about 60%.

Description

Technical Field

[0001] The invention relates to a brewer's yeast strain for producing a breast milk lipid substitute and application thereof, belonging to the field of biotechnology. Background Art

[0002] Infants and young children are at a special stage of growth. During this period, they need to take in a large amount of comprehensive nutrition. The quantity and quality of nutrition taken during this period directly affect the future growth and development of infants and young children. Breast milk is the most direct source of energy and nutrients for infants and young children, and contains a large number of special ingredients that can promote the healthy growth and development of infants.

[0003] Breast milk lipids are the main nutrients in breast milk, accounting for 3%-5% of breast milk. 98% of breast milk lipids are triglycerides, which are the main energy source for infant growth and development. When infants are 0-6 months old, breast milk lipids provide 40%-50% of the energy required by infants. At the same time, breast milk lipids also provide infants with essential fatty acids. Studies have found that not only the fatty acid composition, but also the distribution of fatty acids in breast milk lipids is the key to whether infants can absorb the nutrients in breast milk. In breast milk lipids, nearly 50% of the 2nd position (Sn-2) is palmitic acid. This specific triglyceride structure enables infants to better absorb calcium ions, which can effectively prevent infant diarrhea, avoid infant malnutrition, and reduce infant mortality. However, although breastfeeding is the best way to feed infants, when breast milk cannot be used for feeding due to some reasons, infant formula suitable for infants with breast milk as the gold standard becomes an ideal product to replace breast milk.

[0004] In recent years, domestic and foreign research has not only focused on the composition and content of breast milk fatty acids, but also on the positional distribution of breast milk fatty acids in triglycerides. In breast milk fat, palmitic acid (16:0) is esterified to the middle (Sn-2 or β) position of the glycerol backbone, and oleic acid (18:1) is mainly esterified to the external (Sn-1,3) position, making triglycerides (TG) have a unique stereoisomer structure, which is helpful for infant intestinal nutrient absorption. However, the fat used in most infant formula comes from animals. Unlike the triglyceride structure in breast milk, unsaturated fatty acids such as C18:1 in animal triglycerides are mainly located in the middle (Sn-2 or β) position of the glycerol backbone, while saturated fatty acids such as C16:0 are mainly located in the external (Sn-1,3) position of the glycerol backbone, which is not conducive to infant absorption and growth.

[0005] At present, breast milk lipid substitutes (triglycerides with specific structures) are mainly synthesized by enzymatic methods and occupy a major position in the market. For example, Xiong Zhiqin (Enzymatic Preparation and Properties of Breast Milk Fat Substitutes) uses camellia oil as raw material and palmitic acid as acyl donor to enzymatically synthesize palmitic acid-rich triglycerides at the Sn-2 position in an organic solvent system. With the production and development of breast milk lipid substitutes, biological de novo synthesis has attracted more and more attention because it is easy to regulate and can synthesize various products needed by people. There is great potential for industrial production strains to produce specific lipid compositions through genetic engineering. At the same time, the use of genetic engineering to construct genetically engineered strains to synthesize products from scratch has many advantages, such as low cost, no restrictions on raw materials, simple extraction process, no seasonality, short production time, and little environmental pollution, which has attracted the attention of many scholars. For example, a study used genetic engineering to synthesize an Arabidopsis plant that can synthesize breast milk substitutes in Arabidopsis; in microorganisms, some researchers have also synthesized breast milk substitutes by changing the substrate supply. However, there is no report on the preparation of breast milk lipid substitutes by de novo synthesis. Summary of the invention

[0006] To solve the above problems, the present invention provides an engineered yeast for synthesizing breast milk lipid substitutes, which increases the content of palmitic acid (C16:0) at the Sn-2 position of triglycerides produced by Saccharomyces cerevisiae by integrating heterologous lysophosphatidic acid acyltransferase into Saccharomyces cerevisiae and knocking out its own natural lysophosphatidic acid acyltransferase, thereby synthesizing breast milk substitute fat. On this basis, genes related to the metabolic pathway are knocked out to further increase the content of breast milk lipid substitutes in the product.

[0007] The first object of the present invention is to provide a Saccharomyces cerevisiae strain for producing a breast milk lipid substitute, wherein the Saccharomyces cerevisiae strain expresses a lysophosphatidic acid acyltransferase CrlPAAT1, knocks out genes SLC1, ALE1 and LOA1 encoding lysophosphatidic acid acyltransferase, and knocks out genes TGL3, TGL4 and TGL5 encoding triglyceride hydrolases;

[0008] The lysophosphatidic acid acyltransferase CrlPAAT1 has its own localization signal peptide knocked out and an endoplasmic reticulum localization signal peptide connected to the C-terminus.

[0009] Furthermore, the nucleotide sequence of the lysophosphatidic acid acyltransferase CrlPAAT1 is shown in SEQ ID NO. 4. Specifically, the sequence is as follows:

[0010] 。

[0011] Furthermore, the nucleotide sequence of the self-localization signal peptide of the lysophosphatidic acid acyltransferase CrlPAAT1 is shown in SEQ ID NO. 8. Specifically, the sequence is as follows:

[0012] TTGATCCAACCAAGCATTAAAAGCTTCTTTATCAGCAATAGTACCTCTCTTAAACAAAACAATACCTTTCAAAATCATGCAAGAAGTACAAAAAACAGGGAAAACAAAATAAACCAACCATCTAGACATTAAAGCAGCTCTACCTTCAGTCAAATAAGCATCAATAAAAAAATCAGCCCAAGATCTATGATTACACAAATACAAACATGG ACCACCTTTACAAAGTATGTTCACCAGCTTGCAACAAAGTAACTCTAAAATAAGCAACCAAAGCTCTAGCCCAATCCAACATATCATTTCTTTTACCCAAAGAAGCGAATCTGATTCTATATAAAATAGCAAAGATTGGTAAAGACCAATAAAAAACAAAAACAGAAAACAAGAAAGATGGTAAACCCAACCATTTAGTCAAAACAGA.

[0013] Furthermore, the endoplasmic reticulum localization signal peptide is HDEL, and its nucleotide sequence is shown in SEQ ID NO. 13. The endoplasmic reticulum localization signal peptide is expressed in a heterologous lysophosphatidic acid acyltransferase, and the heterologous acyltransferase is modified so that it can reside in the endoplasmic reticulum and function. Specifically, the sequence is as follows:

[0014] TCAGAACAAGCAGCACAACAAGCAGTTAATAATGCGGGCTGGTCAGTTATTTCAGCAGCACAACTGGGCTATGCGGGCAAAACAGATGCAAGAGGCACATATTATGGCGAAACAGCGGGCTATACAACAGCACAAGCAGAAGTTCTGGGCAAATATGATTCAGAAGGCAATCTGACAGCAATTGGCATTTCATTTAG AGGCACAAGCGGCCCGAGAGAATCACTGATTGGCGATACAATTGGCGATGTTATTAATGATCTGCTGGCGGGCTTCGGCCCGAAAGGCTATGCAGATGGCTATACACTGAAAGCATTTGGCCAACTGCTGGGCGATGTTGCAAAATTTGCACAAGCACATGGCCTGAGCGGCGAAGATGTTGTGGTTAGCGGCCAT.

[0015] Furthermore, the gene encoding lysophosphatidic acid acyltransferase CrlPAAT1 uses plasmid pMHyLp-LEU as an expression vector, and the nucleotide sequence of pMHyLp-LEU is shown in SEQ ID NO.5.

[0016] Furthermore, the nucleotide sequence of the SLC1 is shown as SEQ ID NO.15, the nucleotide sequence of the ALE1 is shown as SEQ ID NO.16, and the nucleotide sequence of the LOA1 is shown as SEQ ID NO.17.

[0017] Furthermore, the nucleotide sequence of TGL3 is shown as SEQ ID NO.18, the nucleotide sequence of TGL4 is shown as SEQ ID NO.19, and the nucleotide sequence of TGL5 is shown as SEQ ID NO.20.

[0018] Furthermore, the recombinant Saccharomyces cerevisiae strain uses Saccharomyces cerevisiae CEN PK2-1C, W303, FY1679 or BY4743 as a starting strain.

[0019] The method for constructing a recombinant Saccharomyces cerevisiae strain of the present invention comprises the following steps, which may be in any order:

[0020] S1, knocking out the self-localization signal peptide of the lysophosphatidic acid acyltransferase gene, connecting the endoplasmic reticulum localization signal peptide at the C-terminus to obtain the de-lysophosphatidic acid acyltransferase gene, and introducing the de-lysophosphatidic acid acyltransferase gene into Saccharomyces cerevisiae;

[0021] S2, knocking out the lysophosphatidic acid acyltransferase (SLC1, ALE1 and LOA1) of Saccharomyces cerevisiae;

[0022] S3, knocking out the triglyceride hydrolases (TGL3, TGL4 and TGL5) of Saccharomyces cerevisiae to obtain the recombinant Saccharomyces cerevisiae strain.

[0023] Further, in step S1, the lysophosphatidic acid acyltransferase gene is integrated into the Saccharomyces cerevisiae genome using Cre / loxp technology, comprising the following steps:

[0024] 1) The lysophosphatidic acid acyltransferase encoding gene is expressed by gene integration through the Cre / loxp system as shown in SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, and the constitutive promoter P is selected. TEF1 ,P TDH1 ,P PGK1 ,P PYK ,P INO2 ,P ITR1 ,P ALD5 ,P ION1 ,P LEU2 ,P ZWF1 , terminator T ADH1 ,T DNM1 ,T TPS1 ,T TDH3 ,T SLX5 ,T ATP5 ,T CYC1 , designed PCR primers so that the overlapping region of adjacent fragments of the gene expression frame reached 40 to 100 bp, and constructed the gene expression integration frame of CrlPAAT1 (NCBI Reference Sequence: XP_042921325.1).

[0025] 2) The expression cassette of the lysophosphatidic acid acyltransferase gene was integrated into the 104c, 416d, 208c, 1622a, 308a and 911b sites of Saccharomyces cerevisiae by the Cre / loxp method.

[0026] Furthermore, in step S2, the Cre / loxp method is used to knock out the genes encoding lysophosphatidic acid acyltransferase ALE1, LOA1 and SLC1 of Saccharomyces cerevisiae.

[0027] The second object of the present invention is to provide the use of the above-mentioned Saccharomyces cerevisiae strain in preparing a breast milk lipid substitute.

[0028] Furthermore, the application is to use glucose as a substrate to ferment and produce a breast milk lipid substitute.

[0029] Furthermore, during the fermentation production process, the pH is 6.0-8.0.

[0030] Furthermore, during the fermentation production process, the temperature is 20-30°C.

[0031] Furthermore, the above-mentioned brewer's yeast strain is inoculated into a sterile culture medium with glucose as the carbon source and no amino nitrogen source, a YPD sterile culture medium with a limited nitrogen source, an inorganic salt sterile culture medium or a soy peptone sterile culture medium with a limited nitrogen source for fermentation, and aeration fermentation is carried out at pH = 6.0-8.0, 200-300rpm, 20-30°C.

[0032] Beneficial effects of the present invention:

[0033] The recombinant cerevisiae provided by the present invention can produce breast milk substitute fat by fermentation in a sterile culture medium with glucose as a carbon source, laying a foundation for metabolic engineering of cerevisiae to synthesize breast milk lipids. The construction method of the recombinant cerevisiae provided by the present invention is simple, easy to use, and has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 To change the localization of the heterologous gene CrlPAAT1;

[0035] Figure 2 The results of thin layer chromatography separation of triglycerides;

[0036] Figure 3 Relative contents of total fatty acids and Sn-2 C16:0 in different strains. DETAILED DESCRIPTION

[0037] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0038] Experimental materials involved:

[0039] 250ml shake flask, analytical balance, autoclave, recombinant strain, shaker

[0040] Culture medium (g / L):

[0041] YNB medium: YNB 3.4, ammonium sulfate 10, glucose 20, uracil 0.05, histidine 0.05, leucine 0.05, tryptophan 0.05;

[0042] YPD sterile medium with limited nitrogen source: 20% glucose, 10% yeast extract, and 10% peptone;

[0043] Inorganic salt sterile medium: glucose 10, (NH4 ) 2 SO 4 1. K 2 HPO 4 0.125, KHPO 4 0.875, KI0.0001, MgSO 4 7H 2 O 0.5, CaCl 2 ·2H 2 O 0.1, NaCl 0.1, vitamin element mother solution 1mL, vitamin mother solution 1mL;

[0044] The basic fermentation medium with limited nitrogen source was 20% glucose, 4% ammonium sulfate, and KH 2 PO 4 2.5,MgSO 4 7H 2 O0.5;

[0045] Seed culture medium: YNB medium, inorganic salt sterile medium, nitrogen source limited YPD sterile medium, nitrogen source limited basic fermentation medium;

[0046] Fermentation medium: YNB medium, inorganic salt sterile medium, nitrogen source limited YPD sterile medium, nitrogen source limited basic fermentation medium.

[0047] Involved detection methods:

[0048] Gas chromatography-mass spectrometry (GC-MS) detection method: Shimadzu (GCMS-QP2010 SE), SH-Rtx-Wax chromatographic column, mobile phase He, column temperature 100°C, injection volume 1 μL, split ratio 20:1, flow rate 1.0 ml / min.

[0049] In the present invention, recombinant S. cerevisiae CEN PK2-1C MATa; ura3-52; trp1-289; leu2-3,112; his3-Δ1; MAL2-8C; SUC2; S. cerevisiae W303 MATa; ura3-1; trp1-Δ1; leu2-3,112; his3-11; ade2-1; can1-100; S. cerevisiae FY1679 MATa; ura3-52; trp1-Δ63; leu2-Δ1; his3-Δ200; GAL2 and S. cerevisiae BY4743 MATa; ura3-Δ0; met15-Δ0; leu2-Δ0; his3-Δ1; lys-Δ0 were used as the starting strains, and the lysophosphatidic acid acyltransferase from Chlamydomonas was integrated into the Saccharomyces cerevisiae genome using the Cre / loxp method to obtain a Saccharomyces cerevisiae strain capable of synthesizing breast milk lipid substitutes (triglycerides).

[0050] Saccharomyces cerevisiae is also known as baker's yeast or budding yeast. Saccharomyces cerevisiae is the yeast with the widest relationship with humans. As a food safety strain, it has been used to make foods such as bread and steamed buns, and in the brewing industry. In recent years, scholars have begun to study the use of Saccharomyces cerevisiae to produce natural products, such as artemisinic acid and notoginseng saponins. Saccharomyces cerevisiae has the advantages of high safety, low pathogenicity, high stress resistance, and low probability of phage contamination, so it also plays an important role in the field of genetic engineering. However, the triglyceride structure of Saccharomyces cerevisiae itself is quite different from that of breast milk. Therefore, in order to obtain an engineered strain for the production of breast milk lipid substitutes, we used Cre / loxp technology to integrate the acyltransferase metabolic pathway into Saccharomyces cerevisiae to achieve the effect of producing breast milk lipid substitutes.

[0051] The primers used in the following examples are shown in the table below:

[0052]

[0053]

[0054]

[0055] Example 1 Construction of heterologous acyltransferase expressing Saccharomyces cerevisiae strains (TG-1 to TG-4)

[0056] According to the lysophosphatidic acid acyltransferase CrlPAAT1 from Chlamydomonas published on NCBI (NCBI Reference Sequence: XP_042921325.1), codon optimization was performed according to the codon preference of Saccharomyces cerevisiae and the whole gene was synthesized. According to the overlapping derivative PCR primer design method, primers were designed to make the overlapping region of adjacent fragments of the gene expression frame reach 40 to 100 bp. Primers were designed to amplify the upstream and downstream homologous arms of the 911b site of the chromosome of Saccharomyces cerevisiae CEN PK2-1C, the promoter P TEF1 ,P TDH1 ,P PGK1 ,P PYK ,P INO2 ,P ITR1 ,P ALD5 ,P ION1 ,P LEU2 and P ZWF1 , terminator T ADH1 ,T DNM1 ,T TPS1 ,T TDH3 ,T SLX5 ,T ATP5 and T CYC1 and a signal peptide (HDEL) fragment.

[0057] Using the fully synthesized CrlPAAT1 plasmid as a template, primers were designed for heterologous lysophosphatidic acid acyltransferase. Using the plasmid pMHyLp-LEU as a template (as shown in SEQ ID NO.5), PCR was performed to amplify the defective tag fragment, and the gene integration frame was obtained by overlap extension PCR.

[0058] (1) Primers F1 and R1; F2 and R2 were used to amplify the upstream and downstream homology arm fragments of the 911b site, and primers F3 and R3 were used to amplify the promoter P TEF1 The fragment was amplified by primers F4 and R4 to obtain the terminator T ADH1 The fragment was amplified by primers F5 and R5 to obtain the CrlPAAT1 gene fragment shown in SEQ ID NO.4, and the pMHyLp-LEU fragment was amplified by primers F6 and R6. The gene expression cassette was constructed by overlap extension PCR and transferred into Saccharomyces cerevisiae CEN PK2-1C to obtain strain TG-1.

[0059] (2) The localization signal peptide (as shown in SEQ ID NO.8) of the CrlPAAT1 gene (the gene sequence is shown in SEQ ID NO.4) was knocked out using F5 and R7 to obtain the mCrlPAAT1 gene, and the gene expression frame composed of the homologous arms, (F7 and R3) promoter, terminator, and defective tag fragment in (1) was transferred into Saccharomyces cerevisiae CEN PK2-1C according to the method of (1) to obtain strain TG-2.

[0060] (3) The signal peptide HDEL (as shown in SEQ ID NO. 13) fragment connected to the C-terminus and N-terminus of the mCrlPAAT1 gene was amplified by primers F8 and R8, F9 and R9, and the signal peptide HDEL fragment connected to the C-terminus of the mCrlPAAT1 gene and the fragment in (2) were combined to form a gene expression cassette and transferred into Saccharomyces cerevisiae CEN PK2-1C to obtain strain TG-3. The signal peptide HDEL fragment connected to the N-terminus of the mCrlPAAT1 gene and the fragment in (2) were combined to form a gene expression cassette and transferred into Saccharomyces cerevisiae CEN PK2-1C to obtain strain TG-4.

[0061] The TG-3 and TG-4 strains were tested and it was found that the relative content of C16:0 at the Sn-2 position of TAG of the TG-3 strain increased to 40%, so the TG-3 strain was selected for subsequent experiments. In the above process, the constructed gene integration frame was transformed into the competent cells of Saccharomyces cerevisiae by the lithium acetate transformation method, and the colonies were picked for PCR verification and some PCR correct transformants were selected for sequencing verification.

[0062] Example 2 Construction of high-yield breast milk lipid substitute recombinant Saccharomyces cerevisiae strains (TG-5 to TG-14)

[0063] According to the overlapping derivative PCR primer design method, the Saccharomyces cerevisiae CEN PK2-1C genome was used as a template to amplify the upstream and downstream homology arms of the (F10, R10 and F11, R11) SLC1, (F12, R12 and F13, R13) ALE1 and (F14, R14 and F15, R15) LOA1 genes. PCR was performed using plasmids (F16, R16) pMHyLp-LEU, (F17, R17) pMHyLp-HIS and (F18, R18) pMHyLp-TRP as templates (as shown in SEQ ID NO.5 to SEQ ID NO.7) to amplify the defective expression cassette fragment. The gene integration frame was obtained by overlapping extension PCR and based on the TG-3 strain, the above three genes were single knockout, double knockout and triple knockout respectively to obtain TG-5 (SLC1 knockout), TG-6 (ALE1 knockout), TG-7 (LOA1 knockout), TG-8 (SLC1, ALE1 knockout), TG-9 (SLC1, LOA1 knockout), TG-10 (ALE1, LOA1 knockout) and TG-11 (SLC1, ALE1, LOA1 knockout) strains.

[0064] The relative contents of total fatty acids and Sn-2 C16:0 in strains TG-5 to TG-11 were tested. Figure 3 Among them, the strain TG-11 had the highest content of C16:0 in the total fatty acids, and the relative content of C16:0 at the Sn-2 position reached more than 60%.

[0065] Based on the TG-11 strain, the genes related to the triglyceride hydrolysis pathway of Saccharomyces cerevisiae were knocked out. The primers were designed using the previous method, and the upstream and downstream homologous arms and defective expression frame (F25-F27 and R25-R27) fragments of TGL3 (F19, R19 and F20, R20), TGL4 (F21, R21 and F22, R22) and TGL5 (F23, R23 and F24, R24) genes were amplified. The three gene knockout expression frames were successively transferred into the TG-11 strain to obtain TG-12 (TGL3 knockout), TG-13 (TGL3, TGL4 knockout) and TG-14 (TGL3, TGL4, TGL5 knockout) strains.

[0066] The relative contents of total fatty acids and Sn-2 C16:0 in strains TG-12 to TG-14 were tested. Figure 3The final detection showed that the total fatty acid content of TG-14 strain was higher than that of TG-11, and the relative content of C16:0 at the Sn-2 position of TAG increased to 60%. In the above process, the constructed gene integration frame was transformed into Saccharomyces cerevisiae competent cells by lithium acetate transformation method, and colonies were picked for PCR verification and some PCR correct transformants were selected for sequencing verification.

[0067] Example 3 Fermentation of recombinant Saccharomyces cerevisiae to produce breast milk lipid substitutes

[0068] All recombinant Saccharomyces cerevisiae strains in the present invention are fermented in the following manner: streak the recombinant Saccharomyces cerevisiae strain on a plate without an amino nitrogen source (lacking an amino acid corresponding to the defective type) and culture at 30° C. until a large number of colonies grow.

[0069] Pick a single colony to the seed culture medium (any culture medium including amino nitrogen source-free sterile culture medium with glucose as the carbon source, YPD sterile culture medium with limited nitrogen source, inorganic salt sterile culture medium and soy peptone sterile culture medium with limited nitrogen source can be used as the fermentation medium), and culture at 30°C and 220rpm for 18 to 20h until the cells reach the logarithmic growth phase.

[0070] The seed culture solution is inoculated into the fermentation medium (any medium including a sterile medium without amino nitrogen source and using glucose as carbon source, a sterile YPD medium with limited nitrogen source, a sterile inorganic salt medium, and a sterile soy peptone medium with limited nitrogen source can be selected as the fermentation medium) at an initial inoculation amount of 2-5%, and cultured at 30°C and 220rpm for 72h. After 72h, the culture is stopped, and the yeast cells after fermentation are centrifuged and freeze-dried for subsequent detection and analysis.

[0071] Example 4 Extraction and detection of recombinant Saccharomyces cerevisiae breast milk lipid substitute

[0072] The lipids in all recombinant saccharomyces cerevisiae strains of the present invention are extracted in the following manner. Pentadecanoic acid triglyceride is added to the freeze-dried thalline as an internal standard, methanol and glass beads are added for oscillation and crushing, and then the broken solution is transferred to a new volumetric flask, chloroform is added, the solution is placed in an ultrasonic water bath for 10 minutes, the supernatant completed by ultrasound is transferred to a new volumetric flask, 1.5ml methanol / chloroform solvent is added again for extraction, this step is repeated twice, and the resulting lipid extracts are merged, and 2.5ml chloroform and 3ml NaCl aqueous solution are added to the merged solution. The sample is vigorously shaken, centrifuged at 10000rpm for 5min, the upper liquid is discarded, the lower organic phase is transferred to a new glass tube, the organic phase is blown dry using a nitrogen blower, and normal hexane is used for redissolution. The extracted lipids were separated by thin layer chromatography using n-hexane: ether: acetic acid (70:30:1, v:v:v) as the developing agent. Bromothymol blue was used to develop the lipids on the chromatography plate. The triglyceride band was removed using a sampler based on the color development results. The separated triglyceride sample was then placed in a 10 ml centrifuge tube, and 0.2 ml of n-hexane was added to the test tube. Then add 50mg pancreatic triglyceride hydrolase and 2ml Tris-HCL (pH=8) buffer, shake carefully, then add 0.5ml sodium cholate solution, 0.2ml calcium chloride solution, cover the centrifuge tube cap, shake carefully, then place the centrifuge tube in a 40℃ water bath for 5min, keep shaking by hand, remove the shaker after the water bath and shake for 2min, then add 1ml hydrochloric acid solution (6mol / l) and 1ml ether, cover the lid, shake vigorously for 10s, centrifuge at 4000rpm for 4min, aspirate the organic phase, blow nitrogen to 200ul, and then use GC-MS for determination. The gene positioning results are as follows Figure 1 The thin layer results are as follows Figure 2 , C16:0 content accounts for Figure 3 .

[0073] from Figure 1 It can be seen that when the heterologous gene CrlPAAT1 is directly integrated into the Saccharomyces cerevisiae genome, the expression level of the gene is low; the mCrlPAAT1 gene obtained by knocking out the signal peptide of the heterologous gene itself has a significantly increased expression level in Saccharomyces cerevisiae, and it can be found that the gene is mainly expressed freely in the cytoplasm; the rmCrlPAAT1 gene is obtained by adding a signal peptide to the C-terminus of the mCrlPAAT1 gene, which is strongly expressed in Saccharomyces cerevisiae and localized in the endoplasmic reticulum.

[0074] Comparative Example 1

[0075] The lysophosphatidic acid acyltransferase was replaced with the following sequence (1), its localization signal peptide was deleted (the sequence is shown in SEQ ID NO. 22), and the signal peptide HDEL was added to the C-terminus of the knocked-out gene. The specific steps were the same as those in Example 1, and strain TG-15 was obtained;

[0076] The lysophosphatidic acid acyltransferase was replaced with the following sequence (2), and the signal peptide HDEL was added to the C-terminus of the gene. The specific steps were the same as those in Example 1, and strains TG-16 and TG-17 were obtained respectively.

[0077] (1) lysophosphatidic acid acyltransferase LPAT1 from Brassica (NCBI Reference Sequence: AF111161), the gene sequence is shown in SEQ ID NO. 1;

[0078] (2) Homo sapiens-derived lysophosphatidic acid acyltransferases AGPAT1 (NCBI Reference Sequence: NC_000006.12) and AGPAT2 (NCBI Reference Sequence: CAH71722.1), whose gene sequences are shown in SEQ ID NOs. 2 and 3, respectively;

[0079] Comparative Example 2

[0080] The signal peptide HDEL was replaced with the following signal peptides: (1) SRP14 (gene sequence as shown in SEQ ID NO.9), (2) SRP54 (gene sequence as shown in SEQ ID NO.10), (3) CYB5 (gene sequence as shown in SEQ ID NO.11), (4) SEC12 (gene sequence as shown in SEQ ID NO.12), and (5) FEHDEL (gene sequence as shown in SEQ ID NO.14). The specific steps were the same as those of strain TG-3 in Example 1, and strains TG-18 to TG-22 were obtained respectively.

[0081] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A Saccharomyces cerevisiae strain for producing a breast milk lipid substitute, Features: The cerevisiae yeast strain uses cerevisiae CEN PK2-1C as the starting strain to express the lysophosphatidic acid acyltransferase CrlPAAT1, and knocks out the gene encoding the lysophosphatidic acid acyltransferase SLC1 , ALE1 and LOA1 , and knocking out the gene encoding triglyceride hydrolase TGL3 , TGL4 and TGL5 ; The lysophosphatidic acid acyltransferase CrlPAAT1 has its own localization signal peptide knocked out and an endoplasmic reticulum localization signal peptide connected to the C-terminus; The nucleotide sequence of the lysophosphatidic acid acyltransferase CrlPAAT1 is shown in SEQ ID NO.4, the nucleotide sequence of the self-localization signal peptide of the lysophosphatidic acid acyltransferase CrlPAAT1 is shown in SEQ ID NO.8, the nucleotide sequence of the endoplasmic reticulum localization signal peptide is shown in SEQ ID NO.13, SLC1 The nucleotide sequence is shown in SEQ ID NO.15, ALE1 The nucleotide sequence is shown in SEQ ID NO.16, LOA1 The nucleotide sequence is shown in SEQ ID NO.17, TGL3 The nucleotide sequence is shown in SEQ ID NO.18, TGL4 The nucleotide sequence is shown in SEQ ID NO.19, TGL5 The nucleotide sequence is shown in SEQ ID NO.

20.

2. The Saccharomyces cerevisiae strain according to claim 1, Features: The gene encoding lysophosphatidic acid acyltransferase CrlPAAT1 was expressed in plasmid pMHyLp-LEU.

3. Use of the Saccharomyces cerevisiae strain according to claim 1 or 2 in the preparation of a breast milk lipid substitute.

4. The use according to claim 3, Features: The application is to produce a breast milk lipid substitute by fermentation using glucose as a substrate.

Images