Gene editing system and its application in constructing a psoriasis model pig with a mutated TNIP1 gene in nuclear transfer donor cells

By constructing a psoriasis model with a TNIP1 gene mutation in pig cells using CRISPR/Cas9 technology, the problems of large differences between mouse models and human disease states and high costs in primates have been solved. This has enabled efficient construction of psoriasis models and drug research, reducing costs and difficulties.

CN115806981BActive Publication Date: 2026-01-02NANJING KGENE GENETIC ENG CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210976019.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-15
Publication Date
2026-01-02
Estimated Expiration
2042-08-15

AI Technical Summary

Technical Problem

Existing mouse models differ significantly from human psoriasis in simulating its physiological and pathological state, failing to accurately reflect the human disease state. Furthermore, primate models are costly and difficult to reproduce, while existing gene-editing technologies are inefficient in constructing animal models and struggle to effectively simulate the genetic characteristics of psoriasis.

Method used

Using CRISPR/Cas9 technology combined with dual gRNA editing, a kit containing TNIP1-gRNA2, TNIP1-gRNA3, and NCN proteins was prepared to perform gene editing on porcine cells, construct a psoriasis model pig with TNIP1 gene mutation, and establish a psoriasis model by somatic cell cloning using porcine cells.

Benefits of technology

This study enabled the efficient construction of psoriasis model pigs with TNIP1 gene mutations, improved the single-cell cloning rate of gene editing, shortened the model pig production cycle, provided effective experimental data for psoriasis drug development and pathogenesis research, and reduced costs and difficulties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0003798478520000011
    Figure HDA0003798478520000011
Patent Text Reader

Abstract

The application discloses a gene editing system and application thereof in constructing a porcine nuclear transfer donor cell of a psoriasis model with a TNIP1 gene mutation. The application provides a kit comprising a TNIP1-gRNA2 shown in SEQ ID NO: 16, a TNIP1-gRNA3 shown in SEQ ID NO: 17 and an NCN protein. The application also provides a method for preparing a recombinant porcine cell: the TNIP1-gRNA2, the TNIP1-gRNA3 and the NCN protein are co-transfected into a porcine cell to obtain the recombinant porcine cell. The recombinant porcine cell is a recombinant cell with a TNIP1 gene mutation. The kit is used for: preparing the recombinant porcine cell; preparing a psoriasis model pig; preparing a psoriasis cell model or a psoriasis tissue model or a psoriasis organ model. The application has great application value for research and development of a psoriasis drug and revealing a pathogenesis of the disease.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, specifically to the field of gene editing, and more specifically relates to a gene editing system and its application in constructing a porcine model of psoriasis with TNIP1 gene mutation for nuclear transfer donor cells. BACKGROUND

[0002] Psoriasis, also known as "white scabies" or "psoriasis", is a chronic skin disease. The typical clinical manifestation of the disease is the appearance of scaly erythema on the skin, and severe cases can cause disabling psoriatic arthritis, which seriously affects the patient's life and causes a huge economic burden to the patient and his family. There is currently no cure for psoriasis.

[0003] Family aggregation studies have confirmed that psoriasis can be inherited and is a polygenic genetic disease. TNFα-induced protein 3-interacting protein 1 (TNIP1) gene is a psoriasis susceptibility gene common to Chinese Han and European and American populations. The TNIP1 protein encoded by the TNIPI gene belongs to the TNIPs family along with TNIP2 and TNIP3. This family is named because it can bind to ubiquitin editing protein A20 and inhibit the transcriptional activity of nuclear factor-κB (NF-κB), and thus has another name ABINs (A20-binding inhibitor of NF-κB). In addition, TNIP1 can also function independently of A20 and NF-κB. Extracellular signal-regulated kinase 1 / 2 (ERK 1 / 2), retinoic acid receptor-α / γ (RAR-α / γ), peroxisome proliferator-activated receptor (PPAR), and CCAAT / enhancer-binding protein β (C / EBPβ) have been confirmed as targets of TNIP1. These molecules activated by TNIP1 can exert different biological effects through multiple signaling pathways.

[0004] Research on the mechanisms of the occurrence and development of psoriasis and the development of corresponding drugs needs to be based on animal models. The commonly used animal model is the mouse model. However, mice differ greatly from humans in terms of size, organ size, physiology, pathology, and other aspects, and cannot truly simulate normal human physiological and pathological states. Pigs, as large animals, are similar to humans in size and physiological functions, are easy to breed in large quantities, and have lower requirements in terms of ethics and animal protection, making them ideal animal models for human diseases.

[0005] Gene editing is a biological technology that has made great progress in recent years, including gene editing based on homologous recombination to ZFN, TALEN, CRISPR / Cas9 based nuclease editing technology, among which CRISPR / Cas9 technology is the most advanced gene editing technology at present. At present, gene editing technology is more and more applied to the production of animal models. SUMMARY

[0006] The purpose of the present application is to provide a gene editing system and its application in constructing a TNIP1 gene mutated psoriasis model pig nuclear transfer donor cell.

[0007] The present application provides a kit comprising TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein.

[0008] The present application also provides a kit comprising TNIP1-gRNA2, TNIP1-gRNA3 and PRONCN protein.

[0009] The present application also provides a kit comprising TNIP1-gRNA2, TNIP1-gRNA3 and specific plasmid.

[0010] The kit described above also comprises a pig cell.

[0011] The present application provides the application of TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein in the preparation of a kit.

[0012] The present application also provides the application of TNIP1-gRNA2, TNIP1-gRNA3 and PRONCN protein in the preparation of a kit.

[0013] The present application also provides the application of TNIP1-gRNA2, TNIP1-gRNA3 and specific plasmid in the preparation of a kit.

[0014] The use of the kit described above is as follows (a) or (b) or (c): (a) preparation of a recombinant pig cell; (b) preparation of a psoriasis model pig; (c) preparation of a psoriasis cell model or a psoriasis tissue model or a psoriasis organ model.

[0015] The present application provides a method for preparing a recombinant pig cell, comprising the following steps: co-transfecting TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein into a pig cell to obtain a recombinant pig cell.

[0016] The co-transfection is specifically in the form of electroporation.

[0017] The parameter setting of the electroporation can be 1450V, 10ms, 3pulse.

[0018] The co-transfection can be performed using a Neon kit (Thermofisher) and a NeonTM transfection system electroporator.

[0019] The ratio of TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein is 0.8-1.2 μg TNIP1-gRNA2: 0.8-1.2 μg TNIP1-gRNA3: 3-5 μg NCN protein in turn.

[0020] The ratio of TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein is 1 μg TNIP1-gRNA2: 1 μg TNIP1-gRNA3: 4 μg NCN protein in turn.

[0021] The ratio of pig cells, TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein is 100,000 pig cells: 0.8-1.2 μg TNIP1-gRNA2: 0.8-1.2 μg TNIP1-gRNA3: 3-5 μg NCN protein in turn.

[0022] The ratio of pig cells, TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein is 100,000 pig cells: 1 μg TNIP1-gRNA2: 1 μg TNIP1-gRNA3: 4 μg NCN protein in turn.

[0023] The TNIP1-gRNA2 is sgRNA, and the target sequence binding region is shown in SEQ ID NO: 16.

[0024] Specifically, the TNIP1-gRNA2 is shown in SEQ ID NO: 16.

[0025] Specifically, the TNIP1-gRNA2 is shown in SEQ ID NO: 11.

[0026] The TNIP1-gRNA3 is sgRNA, and the target sequence binding region is shown in SEQ ID NO: 17.

[0027] Specifically, the TNIP1-gRNA3 is shown in SEQ ID NO: 17.

[0028] Specifically, the TNIP1-gRNA3 is shown in SEQ ID NO: 12.

[0029] Any of the NCN proteins mentioned above is a Cas9 protein or a fusion protein containing a Cas9 protein.

[0030] Specifically, the NCN protein is shown in SEQ ID NO: 3.

[0031] The porcine cells mentioned above are porcine fibroblasts.

[0032] The porcine cells mentioned above are primary porcine fibroblasts.

[0033] The porcine cells mentioned above are primary porcine fibroblasts obtained from newborn pigs.

[0034] The method for preparing the NCN protein includes the following steps:

[0035] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria;

[0036] (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and induced at 25°C, and then the bacterial cells were collected.

[0037] (3) The collected bacterial cells were broken down to collect the crude protein solution;

[0038] (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography;

[0039] (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein.

[0040] The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO: 1.

[0041] The preparation method of the NCN protein specifically includes the following steps:

[0042] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0043] (2) Inoculate the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culture with shaking;

[0044] (3) Inoculate the bacterial culture obtained in step (2) into liquid LB medium and culture at 30°C with shaking at 230 rpm until OD. 600nm The value was 1.0, then IPTG was added to make the concentration in the system 0.5mM, and then the cells were cultured at 25℃ and 230rpm for 12 hours with shaking, and then the cells were collected by centrifugation.

[0045] (4) The bacteria obtained in step (3) are washed with PBS buffer;

[0046] (5) The bacteria obtained in step (4) are suspended in a crude extraction buffer, and then the bacteria are disrupted, and the supernatant is collected by centrifugation, filtered with a 0.22 μm pore size filter, and the filtrate is collected;

[0047] (6) The fusion protein (fusion protein shown in SEQ ID NO: 2) having a His6 tag is purified from the filtrate obtained in step (5) using affinity chromatography;

[0048] (7) The post-column solution collected in step (6) is concentrated using an ultrafiltration tube, and then diluted with 25 mM Tris-HCl (pH 8.0);

[0049] (8) The recombinant bovine enterokinase having a His6 tag is added to the solution obtained in step (7), and the enzyme is cut;

[0050] (9) The solution in which step (8) is completed is mixed with Ni-NTA resin, incubated, and then the supernatant is collected by centrifugation;

[0051] (10) The supernatant obtained in step (9) is concentrated using an ultrafiltration tube, and then added to an enzyme storage solution, which is the NCN protein solution.

[0052] The specific method for purifying the fusion protein having a His6 tag from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0053] First, the Ni-NTA agarose column is equilibrated with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then 50 ml of the filtrate obtained in step (5) is loaded (at a flow rate of 0.5-1 ml / min); then the column is washed with 5 column volumes of equilibration buffer (at a flow rate of 1 ml / min); then the column is washed with 5 column volumes of buffer (at a flow rate of 1 ml / min) to remove impurities; then 10 column volumes of elution buffer are used to elute at a flow rate of 0.5-1 ml / min, and the post-column solution (90-100 ml) is collected.

[0054] Any of the above-described PRONCN proteins sequentially includes the following elements from upstream to downstream: a signal peptide, a chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.

[0055] The signal peptide functions to promote protein secretion expression. The signal peptide can be selected from the group consisting of E. coli alkaline phosphatase (phoA) signal peptide, S. aureus protein A signal peptide, E. coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the intracellular protein from the bacteria, and the target protein secreted into the bacterial periplasmic cavity is soluble expression, which can be cleaved by the signal peptide enzyme in the bacterial periplasmic cavity.

[0056] The molecular chaperone functions to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably thioredoxin (TrxA protein). Thioredoxin, which can act as a molecular chaperone to help the co-expressed target protein (such as Cas9 protein) form disulfide bonds, improve protein stability, folding accuracy, increase solubility and activity of the target protein.

[0057] The protein tag functions for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, further preferably a His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein.

[0058] The protease cleavage site functions to remove the non-functional segment after purification to release the native form of the Cas9 protein. The protease can be selected from the group consisting of enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endoprotease, further preferably enterokinase. EK is the enterokinase cleavage site, which facilitates the removal of the fused TrxA-His segment using enterokinase to obtain the native form of the Cas9 protein. After the application uses commercial enterokinase with His tag to cleave the fusion protein, the TrxA-His segment and the enterokinase with His tag can be removed by one-step affinity chromatography to obtain the native form of the Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification and dialysis.

[0059] The nuclear localization signal can be any nuclear localization signal, preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal. The NLS is a nuclear localization signal, and one NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the nucleus for gene editing.

[0060] The Cas9 protein can be a saCas9 or a spCas9, preferably a spCas9 protein.

[0061] The PRONCN protein is specifically shown in SEQ ID NO: 2.

[0062] The specific plasmid of any of the above includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a coding gene of a PRONCN protein, and a terminator.

[0063] The promoter can be specifically a T7 promoter. The T7 promoter is a strong promoter for prokaryotic expression, which can efficiently drive the expression of an exogenous gene.

[0064] The operator can be specifically a Lac operator. The Lac operator is a regulatory element for lactose-induced expression, which can be used to induce the expression of the target protein at low temperature after the bacteria grow to a certain amount, thereby avoiding the influence of the early expression of the target protein on the growth of the host bacteria, and significantly improving the solubility of the expressed target protein.

[0065] The ribosome binding site is the ribosome binding site during protein translation, which is necessary for protein translation.

[0066] The terminator can be specifically a T7 terminator. The T7 terminator can effectively terminate the transcription of the target gene at the end of the target gene, thereby avoiding the transcription and translation of other downstream sequences other than the target gene.

[0067] For the codons of the spCas9 protein, the codons thereof are optimized in the present application to completely adapt to the codon bias of the selected E. coli high-efficiency expression strain E. coli BL21(DE3), thereby improving the expression level of the Cas9 protein.

[0068] The T7 promoter is shown in SEQ ID NO: 1 at nucleotides 5121-5139.

[0069] The Lac operator is shown in SEQ ID NO: 1 at nucleotides 5140-5164.

[0070] The ribosome binding site is shown in SEQ ID NO: 1 at nucleotides 5178-5201.

[0071] The coding sequence of the alkaline phosphatase signal peptide is shown in SEQ ID NO: 1 at nucleotides 5209-5271.

[0072] The coding sequence of the TrxA protein is shown in SEQ ID NO: 1 at nucleotides 5272-5598.

[0073] The coding sequence of the His-Tag is shown in SEQ ID NO: 1 at nucleotides 5620-5637.

[0074] The coding sequence of the enterokinase cleavage site is shown in SEQ ID NO: 1 at nucleotides 5638-5652.

[0075] The coding sequence of the nuclear localization signal is shown in SEQ ID NO: 1 at nucleotides 5656-5670.

[0076] The coding sequence of the spCas9 protein is shown in SEQ ID NO: 1 at nucleotides 5701-9801.

[0077] The coding sequence of the nuclear localization signal is shown in SEQ ID NO: 1 at nucleotides 9802-9849.

[0078] The T7 terminator is shown in SEQ ID NO: 1 at nucleotides 9902-9949.

[0079] Specifically, the specific plasmid is plasmid pKG-GE4.

[0080] The plasmid pKG-GE4 has a DNA molecule shown in SEQ ID NO: 1 at nucleotides 5121-9949.

[0081] Specifically, the plasmid pKG-GE4 is shown in SEQ ID NO: 1.

[0082] The present application also protects the recombinant pig cell prepared by any of the above-mentioned methods.

[0083] The recombinant pig cell is a recombinant pig cell with a mutated TNIP1 gene.

[0084] Specifically, the recombinant pig cell can be a single cell clone with a genotype of heterozygous, double alleles with the same mutation, or double alleles with different mutations in Table 1.

[0085] The present application also protects the use of the recombinant pig cell in preparing a psoriasis model pig.

[0086] The recombinant pig cell is used as a donor cell for somatic cell cloning by nuclear transfer, and a cloned pig, i.e., a psoriasis model pig, can be obtained.

[0087] The present application also protects a pig tissue of a model pig prepared by using the recombinant pig cell, i.e., a psoriasis tissue model.

[0088] The present application also protects a pig organ of a model pig prepared by using the recombinant pig cell, i.e., a psoriasis organ model.

[0089] The present application also protects a pig cell of a model pig prepared by using the recombinant pig cell, i.e., a psoriasis cell model.

[0090] The present application also protects the use of the recombinant pig cell, the psoriasis tissue model, the psoriasis organ model, the psoriasis cell model, or the psoriasis model pig for (d1) or (d2) or (d3) or (d4) as follows:

[0091] (d1) screening drugs for treating psoriasis;

[0092] (d2) performing efficacy evaluation of psoriasis drugs;

[0093] (d3) performing efficacy evaluation of gene therapy and / or cell therapy for psoriasis;

[0094] (d4) studying the pathogenesis of psoriasis.

[0095] The pig according to any one of the above embodiments can be specifically a Minjiang pig.

[0096] The pig according to any one of the above embodiments can be specifically a newborn Minjiang pig.

[0097] The pig according to any one of the above embodiments can be specifically a Bama pig.

[0098] The pig according to any one of the above embodiments can be specifically a newborn Bama pig.

[0099] The psoriasis according to any one of the above embodiments is caused by a mutation in the TNIP1 gene.

[0100] Pig TNIP1 gene information: encoding TNFAIP3-interacting protein 1; located on chromosome 16; Gene ID is 100271903, Sus scrofa.

[0101] The amino acid sequence of the protein encoded by the pig TNIP1 gene is shown in SEQ ID NO: 8.

[0102] The pig TNIP1 gene has a DNA segment shown in SEQ ID NO: 9.

[0103] The mutation according to any one of the above embodiments is deletion and / or insertion and / or substitution of one or more nucleotides.

[0104] The mutation according to any one of the above embodiments is deletion of one or more nucleotides.

[0105] Any of the above mutations is one or more nucleotide insertions.

[0106] Any of the above mutations is one or more nucleotide deletions and insertions.

[0107] Compared with the prior art, the present application has at least the following beneficial effects:

[0108] (1) The research object (pig) of the present application has better applicability than other animals (mice, primates).

[0109] Rodents such as mice are very different from humans in terms of body size, organ size, physiology, pathology, etc., and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs verified effective in mice are ineffective in human clinical trials. As for large animals, primates are the closest animals to humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, with very slow population expansion speed and high feeding cost. In addition, the cloning efficiency of primate animals is low, difficult and costly.

[0110] Pigs, as model animals, do not have the above shortcomings. Pigs are the closest animals to humans except primates, and their body size, weight, organ size, etc. are similar to those of humans, and are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, etc. At the same time, pigs mature early (4-6 months), have high reproductive capacity, and can form a large population in 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as animal models for human diseases.

[0111] (2) The vector constructed by the application uses the strong promoter T7-lac which can efficiently express the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic alkaline phosphatase (phoA) to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the target protein from the intracellular protein of the bacterium, and the target protein secreted into the bacterial periplasmic cavity is soluble expression. Meanwhile, the Cas9 protein is expressed in fusion with the thioredoxin TrxA, and the TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. Meanwhile, an enterokinase cleavage site is designed after the His tag, which facilitates the removal of the fused TrxA-His polypeptide fragment, so as to obtain the natural form of the Cas9 protein. After the fusion protein is cleaved by the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed by one-step affinity chromatography, so as to obtain the natural form of the Cas9 protein, which avoids the damage and loss of the target protein caused by multiple purifications and dialysis. Meanwhile, an NLS site is designed at the N and C terminals of the Cas9, so that the Cas9 can more effectively enter the nucleus for gene editing. In addition, the E. coli BL21(DE3) strain is selected as the target protein expression strain, which can efficiently express the foreign genes cloned in the expression vector (such as pET-32a) containing the bacteriophage T7 promoter. Meanwhile, the codons of the Cas9 protein are optimized to adapt to the codon bias of the expression strain, so as to improve the expression level of the target protein. In addition, the expression of the target protein is induced by IPTG at low temperature after the bacteria grow to a certain number, which can avoid the influence of the premature expression of the target protein on the growth of the host bacteria, and the induction expression at low temperature also significantly improves the solubility of the expressed target protein. After the above optimization design and experimental implementation, the activity of the obtained Cas9 protein is significantly higher than that of the commercial Cas9 protein.

[0112] (3) The Cas9 high-efficiency protein combination constructed and expressed by the application is combined with the in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA is optimized, and finally the ratio of the gene editing single cell clone reaches 86.2%, which is much higher than the conventional gene editing efficiency (10-30%).

[0113] (4) The target gene knockout single cell clone strain obtained by the application can be directly used for somatic cell nuclear transfer animal cloning to obtain a cloned pig with a target gene knockout, and the gene variation can be stably inherited.

[0114] The method of fertilized egg microinjection of gene editing material and then embryo transfer in the mouse model making has a relatively low probability of directly obtaining gene mutant offspring, and needs to be hybridized and selected, and is not suitable for long gestation period large animal (such as pig) model making. Therefore, the application adopts the primary cell in vitro editing with high technical difficulty and high challenge, and the Cas9 protein and double gRNA cutting and screening positive editing single cell clone method, and then directly obtains the corresponding disease model pig through the somatic cell nuclear transfer animal cloning technology, so that the model pig making cycle can be greatly shortened, and manpower, material resources and financial resources can be saved.

[0115] The application adopts the CRISPR / Cas9 technology combined with double gRNA editing to knockout the TNIP1 gene, simulates the genetic characteristics of psoriasis, and obtains the single cell clone of the TNIP1 gene knockout, so as to lay a foundation for cultivating the psoriasis model pig through the somatic cell nuclear transfer animal cloning technology in the later period. The application will help to research and reveal the pathogenesis of psoriasis caused by the abnormal function of the TNIP1 gene, and can be used for drug screening, drug efficacy evaluation, gene therapy and cell therapy research, and can provide effective experimental data for further clinical application, and further provides a powerful experimental means for successfully treating human psoriasis. The application has great application value for the research and development of psoriasis drugs and the revelation of the pathogenesis of the disease. BRIEF DESCRIPTION OF DRAWINGS

[0116] Figure 1 It is a structural schematic diagram of the plasmid pET-32a.

[0117] Figure 2 It is a structural schematic diagram of the plasmid pKG-GE4.

[0118] Figure 3 It is an electrophoresis diagram of gRNA and NCN protein dosage ratio optimization in Example 2.

[0119] Figure 4 It is an electrophoresis diagram of the gene editing efficiency comparison between NCN protein and commercial Cas9 protein in Example 2.

[0120] Figure 5 It is an electrophoresis diagram of the genomic extraction from the ear tissue of the pig named BX4 in Example 3.

[0121] Figure 6 It is an electrophoresis diagram of the genomic DNA of 10 pigs as a template in Example 3.

[0122] Figure 7Alignment of forward sequencing of single cell clone numbered 4 with wild type sequence.

[0123] Figure 8 Alignment of forward sequencing of single cell clone numbered 2 with wild type sequence.

[0124] Figure 9 Alignment of forward sequencing of single cell clone numbered 15 with wild type sequence.

[0125] Figure 10 Alignment of forward sequencing of single cell clone numbered 8 with wild type sequence. DETAILED DESCRIPTION

[0126] The application will be further described in conjunction with the preferred embodiments thereof with reference to the following implementation examples. The implementation examples are given to illustrate the application only, not to limit the scope of the application. The implementation examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0127] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. The recombinant plasmids constructed in the examples have been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good effect. The commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 constant temperature incubator.

[0128] The porcine primary fibroblasts used in Example 2 were prepared from the ear tissue of a newborn Jiangxiang pig. The porcine primary fibroblasts used in Example 3 and Example 4 were both prepared from the ear tissue of a newborn Bama Xiang pig. The method for preparing porcine primary fibroblasts from porcine ear tissue is as follows: ① Take 0.5 g of porcine ear tissue, remove the hair and bone tissue, then immerse in 75% alcohol for 30-40 s, then wash with PBS buffer containing 5% (by volume) Penicillin-Streptomycin (Gibco) for 5 times, then wash with PBS buffer once; ② Cut the tissue into small pieces with scissors, digest with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 h, then centrifuge at 500g for 5 min, discard the supernatant; ③ Resuspend the precipitate with 1 mL of complete culture medium, then plate into a 10 cm diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR), culture until the cells cover about 60% of the bottom of the dish; ④ After completing step ③, digest and collect the cells with trypsin, then resuspend in complete culture medium. The cells are used for subsequent electroporation experiments.

[0129] Example 1, Preparation and purification of NCN protein

[0130] I. Construction of prokaryotic Cas9 high-efficiency expression vector

[0131] The structure of plasmid pET-32a is shown in Figure 1 .

[0132] Plasmid pKG-GE4 is obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4) is shown in SEQ ID NO: 1, which is a circular plasmid, and the structure is shown in Figure 2 .

[0133] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode a phoA signal peptide, nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for the E. coli BL21 (DE3) strain.

[0134] The main modifications of the plasmid pKG-GE4 are as follows: 1) the coding region of the TrxA protein is retained, which can help the expressed target protein form disulfide bonds, increase the solubility and activity of the target protein; a coding sequence of a phoA signal peptide is added before the coding region of the TrxA protein, which can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cleaved by the prokaryotic periplasmic signal peptide enzyme; 2) a coding sequence of a His-Tag is added after the coding sequence of the TrxA protein, which can be used for enrichment of the expressed target protein; 3) a coding sequence of an enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of the His-Tag, and the purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; 4) a codon-optimized Cas9 gene suitable for expression in the E. coli BL21 (DE3) strain is inserted, and a nuclear localization signal coding sequence is added upstream and downstream of the gene, which increases the nuclear localization ability of the purified Cas9 protein in the later stage.

[0135] The fusion gene in the plasmid pKG-GE4 is shown in nucleotides 5209-9852 of SEQ ID NO: 1, which encodes a fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein). Due to the presence of the phoA signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form a protein shown in SEQ ID NO: 3, which is named NCN protein.

[0136] II. Inducing expression

[0137] 1. Introducing plasmid pKG-GE4 into E. coli BL21(DE3) to obtain recombinant bacteria.

[0138] 2. Inoculating the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin, and culturing at 37°C with 200 rpm shaking overnight.

[0139] 3. Inoculating the bacterial solution obtained in step 2 into liquid LB medium, and culturing at 30°C with 230 rpm shaking until the OD value = 1.0, then adding isopropyl thiogalactoside (IPTG) to make its concentration in the system 0.5 mM, then culturing at 25°C with 230 rpm shaking for 12 hours, then centrifuging at 4°C and 10000 g for 15 minutes to collect the bacterial bodies. 600nm

[0140] 4. Washing the bacterial bodies obtained in step 3 with PBS buffer.

[0141] III. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0142] 1. Taking the bacterial bodies obtained in step two, adding crude extraction buffer and suspending the bacterial bodies, then crushing the bacterial bodies with a homogenizer (1000 par cycles for three times), then centrifuging at 4°C and 15000 g for 30 min to collect the supernatant, filtering the supernatant with a 0.22 μm pore size filter membrane to collect the filtrate. In this step, 10 ml of crude extraction buffer is added per g of wet bacterial bodies.

[0143] Crude extraction buffer: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 1 mM PMSF, and the rest is ddH2O.

[0144] 2. Purifying the fusion protein by affinity chromatography.

[0145] First, equilibrating the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate 1 ml / min); then loading 50 ml of the filtrate obtained in step 1 (flow rate 0.5-1 ml / min); then washing the column with 5 column volumes of equilibration buffer (flow rate 1 ml / min); then washing the column with 5 column volumes of buffer to remove impurities (flow rate 1 ml / min); then eluting with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collecting the post-column solution (90-100 ml).

[0146] Ni-NTA agarose column: Kingsway, L00250 / L00250-C, with a filler of 10 ml.​

[0147] Equilibration buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, the rest is ddH2O.

[0148] Buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, the rest is ddH2O.

[0149] Elution buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, the rest is ddH2O.

[0150] IV. Enzymatic digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0151] 1. Take 15 ml of the solution collected after column chromatography in step three, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). A total of 6 ml is obtained using 6 ultrafiltration tubes.

[0152] 2. Add commercially available recombinant bovine enterokinase with His6 tag (Shenguo Biotech, C620031, recombinant bovine enterokinase light chain with His6 tag, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (about 6 ml), and incubate at 25°C for 16 hours. Add 2 units of enterokinase for every 50 μg of protein.

[0153] 3. Take the solution after completing step 2 (about 6 ml), mix with 480 μl of Ni-NTA resin (Genscript, L00250 / L00250-C), rotate for 15 min at room temperature, then centrifuge at 7000 g for 3 min, collect the supernatant (4-5.5 ml).

[0154] 4. Take the supernatant obtained in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then add enzyme storage solution, and adjust the protein concentration to 5 mg / ml, which is the NCN protein solution.

[0155] Sequencing shows that the protein in the NCN protein solution has the N-terminal 15 amino acid residues as shown in SEQ ID NO: 3, i.e., NCN protein.

[0156] The NCN protein used in the following examples was provided from an NCN protein solution.

[0157] Enzyme stock solution (pH 7.4): 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, remainder ddH2O.

[0158] Example 2, Performance of NCN protein

[0159] Two gRNA target sites targeting the TTN gene were selected as follows:

[0160] TTN-gRNA1 target site: AGAGCACAGTCAGCCTGGCG;

[0161] TTN-gRNA2 target site: CTTCCAGAATTGGATCTCCG.

[0162] Primers used to identify the target fragment containing the gRNA in the TTN gene are as follows:

[0163] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0164] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0165] I. Preparation of gRNA

[0166] 1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

[0167] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0168] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0169] 2. In vitro transcription to obtain gRNA

[0170] The TTN-T7-gRNA1 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then recovered and purified using MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) to obtain TTN-gRNA1. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0171] TTN-gRNA2 was obtained by using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to transcribe the TTN-T7-gRNA2 transcription template in vitro, and then using MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) to recover and purify, to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0172] II. Optimization of the dosage ratio of gRNA and NCN protein

[0173] 1. Co-transfection of porcine primary fibroblasts

[0174] The first group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.

[0175] The second group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.

[0176] The third group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0177] The fourth group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.

[0178] The fifth group: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0179] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0180] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0181] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0182] See electrophoresis image Figure 3 The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).

[0183] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.

[0184] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1 μg:1 μg:4 μg.

[0185] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0186] 1. Co-transfection of porcine primary fibroblasts

[0187] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.

[0188] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2 and NCN protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0189] Cas9-B group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.

[0190] Control group: TTN-gRNA1, TTN-gRNA2 are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0191] Co-transfection is carried out by electroporation, and mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse) are used.

[0192] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, and then replace the new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0193] 3. After completing step 2, the cells are digested with trypsin and collected, genomic DNA is extracted, PCR amplification is carried out using a primer pair composed of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis is carried out.

[0194] The electrophoretogram is shown in Figure 4 The gene deletion mutation efficiency using commercial Cas9-A protein is 28.5%, the gene deletion mutation efficiency using NCN protein is 85.6%, and the gene deletion mutation efficiency using commercial Cas9-B protein is 16.6%.

[0195] The results show that compared with the commercial Cas9 protein, the NCN protein prepared by the application can significantly improve the gene editing efficiency.

[0196] Example 3, screening of high-efficiency gRNA target sites of TNIP1 gene

[0197] Pig TNIP1 gene information: encoding TNFAIP3 interacting protein 1; located on chromosome 16; Gene ID is 100271903, Sus scrofa. The amino acid sequence of the protein encoded by the pig TNIP1 gene is shown as SEQ ID NO: 8. In the pig genomic DNA, the TNIP1 gene has a total of 22 exons, and the first coding exon and its upstream and downstream 300 bp are shown as SEQ ID NO: 9.

[0198] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in patent application 202010084343.6. In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 395-680 constitute a CMV enhancer, nucleotides 682-890 constitute an EF1a promoter, nucleotides 986-1006 encode a nuclear localization signal (NLS), nucleotides 1016-1036 encode a nuclear localization signal (NLS), nucleotides 1037-5161 encode a Cas9 protein, nucleotides 5162-5209 encode a nuclear localization signal (NLS), nucleotides 5219-5266 encode a nuclear localization signal (NLS), nucleotides 5276-5332 encode a polypeptide P2A (the amino acid sequence of the polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the cleavage position is between the first and second amino acid residues at the C-terminus), nucleotides 5333-6046 encode an EGFP protein, nucleotides 6056-6109 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the cleavage position is between the first and second amino acid residues at the C-terminus), nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), nucleotides 6722-7310 constitute a WPRE sequence element, nucleotides 7382-7615 constitute a 3'LTR sequence element, and nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 911-6706 form a fusion gene to express a fusion protein. Due to the presence of the self-cleavage polypeptide P2A and the self-cleavage polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with a Cas9 protein, a protein with an EGFP protein, and a protein with a Puro protein.

[0199] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in the patent application 202010084343.6. In SEQ ID NO: 3 in the patent application 202010084343.6, the nucleotides at positions 2280-2539 constitute a hU6 promoter, and the nucleotides at positions 2558-2637 are used to transcribe a gRNA skeleton. When used, a DNA molecule of about 20 bp (a target sequence binding region used to transcribe a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain a gRNA.

[0200] I. Conservation analysis of the preset deletion region of the TNIP1 gene and the adjacent genomic sequence

[0201] 10 newborn Bama mini-pigs, including 6 females (named BC1, BC2, BC3, BC4, BC5, and BC6, respectively) and 4 males (named BX1, BX2, BX3, and BX4, respectively).

[0202] TNIP1-E1-JDF208: ACTAGGATGCCTCAGTGGCT;

[0203] TNIP1-E1-JDR601: TCACGATTCTGGGATGCTGG;

[0204] TNIP1-E1-JDF235: CCCGCTGACATACTGCTGTT;

[0205] TNIP1-E1-JDR713: CTTCTGGAAGACGGCCCATT.

[0206] Genomic DNA was extracted from the ear tissue of the pig named BX4 and used as a template for PCR amplification using different primer pairs, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 5 . Figure 5 Group 1: the primer pair composed of TNIP1-E1-JDF208 and TNIP1-E1-JDR601; Group 2: the primer pair composed of TNIP1-E1-JDF208 and TNIP1-E1-JDR713; Group 3: the primer pair composed of TNIP1-E1-JDF235 and TNIP1-E1-JDR601; and Group 4: the primer pair composed of TNIP1-E1-JDF235 and TNIP1-E1-JDR713. The results show that the primer pair composed of TNIP1-E1-JDF235 and TNIP1-E1-JDR601 is preferably used for amplifying the target fragment.

[0207] The genomic DNA of 10 pigs was used as a template for PCR amplification using the primer pair TNIP1-E1-JDF235 and TNIP1-E1-JDR601, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 6 . The PCR amplification product was recovered and sequenced, and the sequencing results were compared with the TNIP1 gene sequence in the public database. The conserved region common to 10 pigs was selected for gRNA target design.

[0208] II. Screening of target points

[0209] Several target points were initially screened by screening NGG (avoiding possible mutation sites), and 4 target points were further screened from them through a pre-experiment.

[0210] The 4 target points are as follows:

[0211] TNIP1-E1-gRNA1 target point: TACCGGATCTACGACCCCGG;

[0212] TNIP1-E1-gRNA2 target point: ATACCGGATCTACGACCCCG;

[0213] TNIP1-E1-gRNA3 target point: CGACTGAAGGAAAAGATGCA;

[0214] TNIP1-E1-gRNA4 target point: GACTGAAGGAAAAGATGCAA.

[0215] III. Preparation of gRNA

[0216] The plasmid pKG-U6gRNA was digested with restriction enzyme BbsI, and the vector skeleton (about 3 kb of linear large fragments) was recovered.

[0217] TNIP1-E1-gRNA1-S and TNIP1-E1-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(TNIP1-E1-gRNA1). The plasmid pKG-U6gRNA(TNIP1-E1-gRNA1) expresses sgRNA TNIP1-E1-gRNA1 .

[0218] sgRNA TNIP1-E1-gRNA1 (SEQ ID NO: 10):

[0219] AUACCGGAUCUACGACCCCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0220] TNIP1-E1-gRNA2-S and TNIP1-E1-gRNA2-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(TNIP1-E1-gRNA2). The plasmid pKG-U6gRNA(TNIP1-E1-gRNA2) expresses sgRNA represented by SEQ ID NO: 11 TNIP1-E1-gRNA2 .

[0221] sgRNA TNIP1-E1-gRNA2 (SEQ ID NO: 11):

[0222] AUACCGGAUCUACGACCCCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0223] TNIP1-E1-gRNA3-S and TNIP1-E1-gRNA3-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(TNIP1-E1-gRNA3). The plasmid pKG-U6gRNA(TNIP1-E1-gRNA3) expresses sgRNA represented by SEQ ID NO: 12 TNIP1-E1-gRNA3 .

[0224] sgRNA TNIP1-E1-gRNA3 (SEQ ID NO: 12):

[0225] CGACUGAAGGAAAAGAUGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0226] TNIP1-E1-gRNA4-S and TNIP1-E1-gRNA4-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain plasmid pKG-U6gRNA(TNIP1-E1-gRNA4). The plasmid pKG-U6gRNA(TNIP1-E1-gRNA4) expresses sgRNA represented by SEQ ID NO: 13 TNIP1-E1-gRNA4 .

[0227] sgRNA TNIP1-E1-gRNA4 (SEQ ID NO: 13):

[0228] GACUGAAGGAAAAGAUGCAAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0229] TNIP1-E1-gRNA1-S: caccgTACCGGATCTACGACCCCGG;

[0230] TNIP1-E1-gRNA1-A: aaacCCGGGGTCGTAGATCCGGTAc;

[0231] TNIP1-E1-gRNA2-S: caccgATACCGGATCTACGACCCCG;

[0232] TNIP1-E1-gRNA2-A: aaacCGGGGTCGTAGATCCGGTATc;

[0233] TNIP1-E1-gRNA3-S: caccgCGACTGAAGGAAAAGATGCA;

[0234] TNIP1-E1-gRNA3-A: aaacTGCATCTTTTCCTTCAGTCGc;

[0235] TNIP1-E1-gRNA4-S: caccGACTGAAGGAAAAGATGCAA;

[0236] TNIP1-E1-gRNA4-A: aaacTTGCATCTTTTCCTTCAGTC.

[0237] TNIP1-E1-gRNA1-S, TNIP1-E1-gRNA1-A, TNIP1-E1-gRNA2-S, TNIP1-E1-gRNA2-A, TNIP1-E1-gRNA3-S, TNIP1-E1-gRNA3-A, TNIP1-E1-gRNA4-S, TNIP1-E1-gRNA4-A are all single-stranded DNA molecules.

[0238] IV. Comparison of editing efficiency of different target combinations

[0239] 1. Co-transfection

[0240] First group: co-transfect plasmid pKG-U6gRNA(TNIP1-E1-gRNA1), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(TNIP1-E1-gRNA1): 1.08 μg plasmid pKG-GE3.

[0241] Second group: co-transfect plasmid pKG-U6gRNA(TNIP1-E1-gRNA2), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(TNIP1-E1-gRNA2): 1.08 μg plasmid pKG-GE3.

[0242] Third group: co-transfect plasmid pKG-U6gRNA(TNIP1-E1-gRNA3), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(TNIP1-E1-gRNA3): 1.08 μg plasmid pKG-GE3.

[0243] Fourth group: co-transfect plasmid pKG-U6gRNA(TNIP1-E1-gRNA4), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(TNIP1-E1-gRNA4): 1.08 μg plasmid pKG-GE3.

[0244] Fifth group: porcine primary fibroblasts, same electroporation parameters without plasmid.

[0245] Co-transfection uses electroporation, using mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse).

[0246] 2. After step 1, use complete culture solution to culture for 12-18 hours, then replace new complete culture solution to culture. The total culture time after electrotransformation is 48 hours.

[0247] 3. After step 2, use trypsin to digest and collect cells, lyse cells, extract genomic DNA, use primer pair composed of TNIP1-E1-JDF235 and TNIP1-E1-JDR601 to perform PCR amplification, then perform 1% agarose gel electrophoresis. Detect cell target gene mutation.

[0248] After cutting and recovering the target product, send it to a sequencing company for sequencing, then use the web-based Synthego ICE tool to analyze the sequencing peak chart to obtain the gene editing efficiency of different target points. The gene editing efficiency of the first group, the second group, the third group, the fourth group is 8%, 34%, 38%, 32% respectively, and the fifth group does not occur gene editing. The results show that the TNIP1-E1-gRNA2 target point and the TNIP1-E1-gRNA3 target point have higher editing efficiency.

[0249] Example 4, preparation of TNIP1 gene knockout Bama miniature pig single cell clone

[0250] Select two high-efficiency gRNA target points (TNIP1-E1-gRNA2 and TNIP1-E1-gRNA3) screened in Example 3.

[0251] I. Preparation of gRNA

[0252] 1. Preparation of TNIP1-T7-gRNA2 transcription template and TNIP1-T7-gRNA3 transcription template

[0253] The TNIP1-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.

[0254] The TNIP1-T7-gRNA3 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.

[0255] 2. In vitro transcription of gRNA

[0256] Take the TNIP1-T7-gRNA2 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TMTNIP1-gRNA2 was recovered and purified by Transcription Clean-Up Kit (Thermo, AM1908), and TNIP1-gRNA2 was single-stranded RNA, as shown in SEQ ID NO: 16.

[0257] TNIP1-T7-gRNA3 transcription template was taken, and Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) was used for in vitro transcription, and then MEGA clear TM TNIP1-gRNA3 was recovered and purified by Transcription Clean-Up Kit (Thermo, AM1908), and TNIP1-gRNA3 was single-stranded RNA, as shown in SEQ ID NO: 17. TNIP1-gRNA2 (SEQ ID NO: 16):

[0258] GGAUACCGGAUCUACGACCCCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUTNIP1-gRNA3 (SEQ ID NO: 17):

[0259] GGCGACUGAAGGAAAAGAUGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0260] II. Transfection of porcine primary fibroblasts

[0261] 1. TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TNIP1-gRNA2: 1 μg TNIP1-gRNA3: 4 μg NCN protein. Co-transfection was performed by electroporation, and mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TMtransfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse) were used.

[0262] 2. After step 1 was completed, complete culture solution was used for culture for 16-18 hours, and then new complete culture solution was used for culture. The total culture time after electroporation was 48 hours.

[0263] 3、After step 2 is completed, the cells are digested with trypsin and collected, then washed with complete culture medium, then resuspended with complete culture medium, then each single clone is picked and transferred into a 96-well plate (1 cell per well, each well contains 100 μl of complete culture medium), and cultured for 2 weeks (new complete culture medium is replaced every 2-3 days).

[0264] 4、After step 3 is completed, the cells are digested with trypsin and collected (about 2 / 3 of the cells obtained per well are inoculated into a 6-well plate containing complete culture medium, and the remaining 1 / 3 is collected in a 1.5 mL centrifuge tube).

[0265] 5、Take the 6-well plate of step 4, culture until the cells reach 80% confluence, digest the cells with trypsin and collect them, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, by volume).

[0266] 6、Take the centrifuge tube of step 4, take the cells, perform cell lysis and extract genomic DNA, perform PCR amplification using the primer pair consisting of TNIP1-E1-JDF235 and TNIP1-E1-JDR601, and then perform electrophoresis. Pig primary fibroblasts are used as wild type controls (WT).

[0267] 7、After step 6 is completed, the PCR amplification product is recovered and sequenced.

[0268] The sequencing result of the pig primary fibroblasts is only one, and the genotype is wild type (also referred to as homozygous wild type). If the sequencing result of a single cell clone has two, one is consistent with the sequencing result of the pig primary fibroblasts, and the other has a mutation (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblasts, the genotype of the single cell clone is heterozygous; if the sequencing result of a single cell clone is two, both have a mutation (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblasts, the genotype of the single cell clone is double allele different mutant; if the sequencing result of a single cell clone is one, and has a mutation (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the pig primary fibroblasts, the genotype of the single cell clone is double allele same mutant; if the sequencing result of a single cell clone is one, and is consistent with the sequencing result of the pig primary fibroblasts, the genotype of the single cell clone is wild type (also referred to as homozygous wild type).

[0269] The results are shown in Table 1. The genotypes of the single-cell clones numbered 4, 9, 13, and 27 are wild type. The genotypes of the single-cell clones numbered 1, 2, 5, 6, 7, 10, 11, 12, 17, 18, 20, 21, 22, 26, and 29 are heterozygous. The genotypes of the single-cell clones numbered 3, 15, 19, 23, 24, 25, and 28 are double-allele different mutant types. The genotypes of the single-cell clones numbered 8, 14, and 16 are double-allele same mutant types. The ratio of the single-cell clones of TNIP1 gene editing is 86.2%.

[0270] An exemplary sequencing alignment result is shown in Figure 7 to Figure 10 . Figure 7 is the alignment result of the forward sequencing of the single-cell clone numbered 4 with the wild-type sequence, and is determined as wild type. Figure 8 is the alignment result of the forward sequencing of the single-cell clone numbered 2 with the wild-type sequence, and is determined as heterozygous. Figure 9 is the alignment result of the forward sequencing of the single-cell clone numbered 15 with the wild-type sequence, and is a double-allele different mutant type. Figure 10 is the alignment result of the forward sequencing of the single-cell clone numbered 8 with the wild-type sequence, and is a double-allele same mutant type.

[0271] Table 1: Genotype determination results of the single-cell clones of TNIP1 gene editing

[0272]

[0273]

[0274] The single-cell clones of the above-mentioned heterozygous type, double-allele same mutant type, and double-allele different mutant type are all target single-cell clones. The cells are used as nuclear transfer donor cells for somatic cloning, and a cloned pig, i.e., a psoriasis model pig, can be obtained.

[0275] The present application has been described in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under equivalent parameters, concentrations, and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In summary, according to the principle of the present application, the present application intends to include any changes, uses, or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. A kit comprising TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein; The TNIP1-gRNA2 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16; the TNIP1-gRNA3 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17; the NCN protein is shown as in SEQ ID NO: 3; The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected. (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 is shown in SEQ ID NO: 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine cells; (b) to prepare psoriasis model pigs; (c) to prepare psoriasis cell models, psoriasis tissue models, or psoriasis organ models.

2. Application of TNIP1-gRNA2, TNIP1-gRNA3, and NCN proteins in the preparation of the kit; TNIP1-gRNA2 is the TNIP1-gRNA2 described in claim 1; TNIP1-gRNA3 is the TNIP1-gRNA3 described in claim 1; NCN protein is the NCN protein described in claim 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine cells; (b) to prepare psoriasis model pigs; (c) to prepare psoriasis cell models, psoriasis tissue models, or psoriasis organ models.

3. A method for preparing recombinant porcine cells, comprising the following steps: co-transfecting porcine cells with TNIP1-gRNA2, TNIP1-gRNA3 and NCN protein to obtain recombinant porcine cells; TNIP1-gRNA2 is the TNIP1-gRNA2 described in claim 1; TNIP1-gRNA3 is the TNIP1-gRNA3 described in claim 1; and NCN protein is the NCN protein described in claim 1.

Citation Information

Patent Citations

  • CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects

    CN112522255A

  • Application of gRNA target combinations in construction of hemophilia model pig cell line

    CN112442515A