Nanobody Nb5 and its encoding gene, recombinant vector, recombinant strain, bacterial agent, and their applications

Abstract

The present invention relates to the field of biomedical engineering technology, and discloses a nanobody Nb5, its encoding gene, recombinant vector, recombinant strain, bacterial agent, and their applications. The nanobody Nb5 includes: (1) a protein with an amino acid sequence as shown in SEQ ID NO:1; (2) a derivative protein obtained by modifying the protein with an amino acid sequence as shown in SEQ ID NO:1 and having the same activity as before the modification. The nanobody provided by the present invention can specifically bind to the PRRSV virus and has good neutralizing activity against the PRRSV virus, indicating that the nanobody can be used alone or in combination with other antibodies as an active component to play a role in preventing and treating the PRRSV virus; further transformed into probiotics to achieve the effect of delivering the nanobody into pigs based on probiotics to prevent and / or treat porcine reproductive and respiratory syndrome.

Description

Technical Field

[0001] The present invention relates to biomedical engineering technology, and in particular to a nano antibody Nb5 and its encoding gene, recombinant vector, recombinant strain and bacterial agent, and applications thereof. Background Art

[0002] Pathogenic blue ear disease, also known as porcine reproductive and respiratory syndrome (PRRS), is an animal disease characterized by respiratory symptoms and reproductive impairment caused by the porcine reproductive and respiratory syndrome virus (PRRSV). Infected pigs develop a temporary bluish-purple discoloration of their ears, leading to miscarriage, weak piglets, and respiratory distress. Pigs of all ages, breeds, and sexes are susceptible to PRRSV, with piglets and pregnant sows being particularly susceptible. Acute cases of the disease result in a high mortality rate for both sows and piglets, causing significant economic losses to the pig industry.

[0003] Animals infected with PRRSV, including sick and infected pigs, are the primary source of infection. PRRSV is mostly transmitted through contact, with the respiratory tract being the primary route of infection, though vertical transmission is also possible. Currently, various approaches are being implemented to control PRRSV infection on farms, including testing boar semen and gilts for PRRSV, removing seropositive animals, reducing and restocking herds, and confining herds. However, controlling and eliminating PRRSV over larger areas is much more complex, and these measures are cumbersome and inefficient.

[0004] Nanobodies have a small molecular weight, strong specificity and affinity, and are comparable in flexibility to monoclonal antibodies. They can be efficiently expressed in bacterial expression systems, are simple to prepare, and are inexpensive. Therefore, they have been widely used in the treatment of infectious diseases. However, the screening of nanobodies targeting PRRSV is limited, and the delivery method of nanobodies is inconvenient and the duration of efficacy is unsatisfactory, which severely restricts the application and development of nanobody technology in the prevention and treatment of PRRSV. Summary of the Invention

[0005] The purpose of the present invention is to overcome the problems of limited screening of PRRSV nanoantibodies, inconvenient delivery methods, and unsatisfactory duration of efficacy in the prior art, and to provide a nanoantibody Nb5 and its encoding gene, recombinant vector, recombinant strain and bacterial agent, and their applications. The nanoantibody can specifically bind to porcine reproductive and respiratory syndrome virus (PRRSV), has good neutralizing activity against PRRSV virus, and is suitable for the prevention and treatment of blue ear disease in pigs.

[0006] In order to achieve the above objectives, the present invention provides a first aspect of a Nanobody Nb5, wherein the Nanobody Nb5 comprises:

[0007] (1) a protein whose amino acid sequence is shown in SEQ ID NO: 1;

[0008] (2) A derivative protein obtained by modifying the protein with the amino acid sequence shown in SEQ ID NO: 1 and having the same activity as the protein before modification.

[0009] Preferably, the transformation includes:

[0010] i. at least one of substitution, deletion and addition of one or more amino acid residues in the amino acid sequence of SEQ ID NO: 1; and / or

[0011] ii. A tag for facilitating purification is connected to the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO: 1; and / or

[0012] iii. A signal peptide sequence that is beneficial to protein secretion expression is connected to the amino terminus of the amino acid sequence shown in SEQ ID NO: 1.

[0013] Preferably, the tag facilitating purification is at least one selected from the group consisting of His, Poly-Arg, Poly-His, FLAG, Strep-tag II and c-myc, more preferably His.

[0014] The second aspect of the present invention provides a gene encoding a nanobody, which has a nucleotide sequence encoding the aforementioned nanobody Nb5.

[0015] Preferably, the gene has a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1.

[0016] Preferably, the gene has the nucleotide sequence shown in SEQ ID NO: 2.

[0017] The third aspect of the present invention provides a recombinant vector comprising the aforementioned gene.

[0018] Preferably, the expression vector of the recombinant vector is a PHSP02 vector.

[0019] A fourth aspect of the present invention provides a recombinant strain containing the aforementioned gene or the aforementioned recombinant vector.

[0020] Preferably, the recombinant strain is a probiotic, more preferably at least one selected from plant lactic acid bacteria, Escherichia coli, yeast and Bacillus subtilis.

[0021] Further preferably, the recombinant strain is plant lactic acid bacteria WCFS1.

[0022] A fifth aspect of the present invention provides a bacterial agent comprising the aforementioned recombinant strain.

[0023] Preferably, the bacterial agent is a liquid bacterial agent and / or a solid bacterial agent.

[0024] In a sixth aspect, the present invention provides the use of the aforementioned nanoantibody Nb5, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain or the aforementioned bacterial agent in the preparation of a drug for preventing and / or treating porcine blue ear disease.

[0025] Through the above technical solution, the beneficial effects of the present invention are:

[0026] The present invention provides an endogenously expressed nanoantibody Nb5 constructed by molecular biological methods. Experimental verification shows that it can specifically bind to porcine reproductive and respiratory syndrome virus (PRRSV) and has good neutralizing activity against PRRSV virus. This indicates that nanoantibody Nb5 can be used alone or in combination with other antibodies as an active component to play a preventive and therapeutic role against PRRSV virus.

[0027] The present invention further provides a recombinant strain, which uses the probiotic plant lactic acid bacteria WCFS1 as the starting strain, and uses CRISPR-Cas9 and RecET technology to enable the plant lactic acid bacteria WCFS1 to endogenously express the nanoantibody Nb5. The probiotics colonize in the intestine, so that the nanoantibody Nb5 can be continuously produced in the body to neutralize the target virus, thereby achieving the probiotic-based delivery of the nanoantibody Nb5 against porcine blue ear disease into the pig's body, thereby achieving the effect of preventing porcine blue ear disease, and there will be no situation where the nanoantibody dose is too low, too high, or the residence time is too short to fail to work; due to the adhesion effect of the probiotics, it can establish the first line of defense at the mucosal invasion point, preventing the PRRSV virus from invading the body, and effectively solving the problems of inconvenient administration of ordinary vaccines and unsatisfactory duration of efficacy.

[0028] The nanoantibody Nb5 provided by the present invention and the recombinant strain containing the nanoantibody are expected to be used to simply, efficiently and cheaply produce vaccines or special medicines for porcine blue ear disease, which can serve the majority of breeders, enhance the rural economy and promote rural revitalization, and have important economic and social significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is a map of the recombinant vector PHSP02-Nb5-slp in Example 1;

[0030] Figure 2 is a map of the helper plasmid PLH01 used for cleavage in the CRISPR system in Example 2;

[0031] Figure 3 This is an agarose gel electrophoresis verification analysis of a single colony of the recombinant strain PHSP02-Nb5-slp-PLH01-WCFS1 in Example 2;

[0032] Figure 4 : This is an SDS-PAGE gel image of the Nb5 protein expressed by the recombinant strains in Example 2 and Example 3, wherein M is a marker, 1 is the blank supernatant of plant lactic acid bacteria WCFS1, 2 is the blank precipitate of plant lactic acid bacteria WCFS1, 3 is the supernatant of the recombinant strain Nb5-slp-WCFS1, and 4 is the crushed precipitate of the recombinant strain Nb5-slp-WCFS1;

[0033] Figure 5 It is a WB image of the Nb5 protein expressed by the recombinant strains in Example 2 and Example 3, wherein M is a marker, 1 is the blank supernatant of plant lactic acid bacteria WCFS1, 2 is the blank precipitate of plant lactic acid bacteria WCFS1, 3 is the supernatant of the recombinant strain Nb5-slp-WCFS1, and 4 is the crushed precipitate of the recombinant strain Nb5-slp-WCFS1. DETAILED DESCRIPTION

[0034] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0035] The first aspect of the present invention provides a Nanobody Nb5, which comprises:

[0036] (1) a protein whose amino acid sequence is shown in SEQ ID NO: 1;

[0037] (2) A derivative protein obtained by modifying the protein with the amino acid sequence shown in SEQ ID NO: 1 and having the same activity as the protein before modification.

[0038] The nanobody Nb5 provided by the present invention can be a derivative protein obtained by modifying the above protein (1) in any manner available in the art while maintaining the same activity. There is no particular limitation on the modification method and the specific sequence and properties of the modified derivative protein.

[0039] According to a preferred embodiment of the present invention, the transformation may include:

[0040] i. at least one of substitution, deletion and addition of one or more amino acid residues in the amino acid sequence of SEQ ID NO: 1; and / or

[0041] ii. A tag for facilitating purification is connected to the amino terminus and / or carboxyl terminus of the amino acid sequence shown in SEQ ID NO: 1; and / or

[0042] A signal peptide sequence that is beneficial to protein secretion expression is connected to the amino terminus of the amino acid sequence shown in SEQ ID NO: 1.

[0043] The Nanobody Nb5 provided by the present invention can be obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 to any one or a combination of the above-mentioned transformation methods i, ii and iii, as long as the modified derivative protein has the same activity as the amino acid sequence shown in SEQ ID NO: 1.

[0044] Any existing tag in the art that facilitates protein purification can be applied to the Nanobody Nb5 provided by the present invention. Preferably, the tag that facilitates purification is selected from at least one of His, Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc. The specific amino acid sequence of the above-mentioned tag is not particularly limited, and for example, it can be the sequence shown in Table 1 below.

[0045] Table 1 Tag sequences for easy purification

[0046] Label Number of residues sequence Poly-Arg 5* RRRRR (SEQ ID NO: 8) Poly-His 6** HHHHHH (SEQ ID NO: 9) FLAG 8 DYKDDDDK (SEQ ID NO: 10) Strep-tag II 8 WSHPQFEK (SEQ ID NO: 11) c-myc 10 EQKLISEEDL (SEQ ID NO: 12)

[0047] *Poly-Arg can be composed of 5-6 arginine residues. Table 1 only lists the commonly used Poly-Arg tags composed of 5 arginine residues, but Poly-Arg tags composed of 6 arginine residues are also applicable to the present invention.

[0048] **Poly-His can be composed of 2-10 histidine residues. Table 1 lists only the commonly used Poly-His tags composed of 6 histidine residues, but any Poly-His tag composed of 2-10 histidine residues is suitable for the present invention. Further preferably, the tag attached to Nanobody Nb5 to facilitate purification is a His tag.

[0049] Any signal peptide sequence currently available in the art that can facilitate protein secretion expression can be applied to the Nanobody Nb5 provided by the present invention.

[0050] The second aspect of the present invention provides a gene encoding a nanobody, which has a nucleotide sequence encoding the aforementioned nanobody Nb5.

[0051] In the present invention, any gene capable of encoding the Nanobody Nb5 as described above belongs to the content of the present invention. Preferably, the gene has a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1.

[0052] According to the present invention, preferably, the gene has the nucleotide sequence shown in SEQ ID NO: 2. In the present invention, the gene may comprise only the sequence shown in SEQ ID NO: 2, or may be a DNA molecule comprising the sequence shown in SEQ ID NO: 2 as the coding region and additionally comprising other components. The additional components may include any components required in the art for artificially synthesizing gene sequences and expressing them via expression vectors, such as promoters, enhancers, and the like.

[0053] The nucleotide sequences provided by the present invention can generally be obtained using polymerase chain reaction (PCR) amplification, recombinant methods, or synthetic methods. For example, those skilled in the art can easily obtain templates and primers based on the nucleotide sequences provided by the present invention and amplify the sequences using PCR. Once the nucleotide sequences are obtained, the amino acid sequences can be obtained in large quantities using recombinant methods. The resulting nucleotide sequences are typically cloned into vectors, which are then transferred into genetically engineered bacteria, and then the nucleotide sequences are isolated from the propagated host cells using conventional methods.

[0054] In addition, the relevant nucleotide sequences can also be synthesized using known artificial chemical synthesis methods.

[0055] For example, the method for preparing the Nanobody Nb5 of the present invention may specifically include: introducing a recombinant vector containing the gene described above into a host cell to express the Nanobody Nb5. Any recombinant vector in the art capable of inserting the above gene and expressing the Nanobody Nb5 in a host cell may be suitable for use in the present invention. Preferably, the recombinant vector is a PHSP02 vector.

[0056] In the present invention, any host cell known in the art for expressing endogenous genes can be used in the present invention. Preferably, the host cell is selected from at least one of plant lactic acid bacteria, Escherichia coli, yeast, and Bacillus subtilis; more preferably, plant lactic acid bacteria; and even more preferably, plant lactic acid bacteria WCFS1.

[0057] In the present invention, the method for preparing Nanobody Nb5 also includes a process for purifying the expressed Nanobody Nb5. Any method in the art for purifying endogenous proteins expressed by host cells can be applied to the present invention. For example, purification can be performed using a tag (such as the tag in Table 1) in the vector or in the Nanobody Nb5 that facilitates purification.

[0058] The third aspect of the present invention provides a recombinant vector comprising the aforementioned gene.

[0059] In the present invention, the "vector" used in the recombinant vector can be selected from various vectors known in the art, such as commercially available plasmids, cosmids, phages, and retroviruses. The preferred expression vector of the present invention is the PHSPO2 vector. Recombinant vectors can be constructed using various endonucleases that have cleavage sites within the vector's multiple cloning site (e.g., Apa I, Xba I, etc., for the PHSPO2 vector). Linearized plasmids are then ligated with gene fragments cleaved with the same endonucleases to obtain recombinant plasmids. The present invention preferably uses Apa I and Xba I to double-digest the PHSPO2 vector and the ligated gene fragment, followed by ligation, to construct the recombinant vector PHSPO2-Nb5-slp.

[0060] A fourth aspect of the present invention provides a recombinant strain containing the aforementioned gene or the aforementioned recombinant vector.

[0061] The present invention can transform, transduce or transfect the recombinant vector into a host cell (strain) by a conventional method in the art, such as calcium chloride chemical conversion, high-voltage electric shock conversion, preferably electric shock conversion. In the present invention, the host cell can adopt any one probiotic that can grow in an animal body and is beneficial to the body, preferably at least one of plant lactic acid bacteria (Lactobacillus plantarum), Escherichia coli (Escherichia coli), yeast (Saccharomyces) and Bacillus subtilis (Bacillus subtilis), more preferably, the host cell is plant lactic acid bacteria, more preferably plant lactic acid bacteria WCFS1.

[0062] When the present invention uses the probiotic plant lactic acid bacteria WCFS1 as the starting strain, CRISPR-Cas9 and RecET technologies are used to enable the plant lactic acid bacteria WCFS1 to endogenously express the nano antibody Nb5, thereby obtaining a recombinant strain. The probiotics are colonized in the intestine, thereby continuously generating the nano antibody Nb5 in the body, neutralizing the target virus, and realizing the probiotic-based delivery of the nano antibody Nb5 against blue ear disease into the pig's body, thereby achieving the effect of preventing and / or treating blue ear disease, and there will be no situation where the nano antibody dose is too low, too high, or the residence time is too short to fail to work; due to the adhesion effect of the probiotics, it can establish a first line of defense at the mucosal invasion point, prevent the PRRSV virus from invading the body, effectively prevent the infection of blue ear disease, and is particularly suitable for postpartum care of sows.

[0063] A fifth aspect of the present invention provides a bacterial agent comprising the aforementioned recombinant strain.

[0064] In the present invention, the bacterial agent can be in liquid form or solid form. The bacterial agent can contain auxiliary materials commonly added in the preparation of bacterial agents in the art, and those skilled in the art can select them as needed. Preferably, the content of the recombinant strain is 10 5 -10 10 CFU, more preferably 10 7 -10 9 CFU.

[0065] In a sixth aspect, the present invention provides the use of the aforementioned nanoantibody Nb5, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain or the aforementioned bacterial agent in the preparation of a drug for preventing and / or treating porcine blue ear disease.

[0066] In the present invention, the drug for preventing and / or treating porcine reproductive and respiratory syndrome (PRRS) can be a vaccine or a therapeutic drug, and is particularly suitable for postpartum care of sows to prevent infection with PRRS. Preferably, the drug also includes a pharmaceutically acceptable excipient, which can be any excipient currently available in the art for drug preparation, as long as the excipient does not affect the function and effect of the active component (i.e., the Nanobody Nb5, gene, recombinant vector or recombinant strain as described above).

[0067] The drug can use the aforementioned nanobody Nb5 (gene, recombinant vector or recombinant strain) alone as an active ingredient, or it can be combined with other antibodies (or pharmaceutical ingredients) as active ingredients. The other antibodies (or pharmaceutical ingredients) can be any anti-PRRSV virus antibody (or pharmaceutical ingredient) in the art, or any antibody (or pharmaceutical ingredient) in the art that can modulate the function of the aforementioned nanobody Nb5, or an antibody (or pharmaceutical ingredient) related to the prevention and treatment of PRRSV virus-related derivative diseases.

[0068] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to exemplarily explain and illustrate the content of the present invention, and are not used to limit the scope of the present invention.

[0069] In the following examples, the gene fragments used were synthesized by Beijing Qingke Biotechnology Co., Ltd. Unless otherwise specified, the reagents used were purchased from regular chemical or biological reagent suppliers and were of analytical grade.

[0070] In the following examples, the preparation process of 0.1M CaCl2 solution is as follows: 11.1g calcium chloride is added to 1L ddH2O, and sterilized by moist heat at 121°C for 20min.

[0071] The preparation process of 0.1M CaCl2+10% glycerol solution is as follows: take 11.1g calcium chloride and 100mL glycerol, add 1L ddH2O, and sterilize by high temperature and high pressure moist heat at 121℃ for 20min;

[0072] LB liquid medium was prepared as follows: 10 g tryptone, 10 g sodium chloride, and 5 g yeast extract were added to 1 L of ddH2O and sterilized by moist heat at 121°C for 20 min.

[0073] LB solid medium was prepared by adding 10 g of tryptone, 10 g of sodium chloride, 5 g of yeast extract, and 17.5 g of agar to 1 L of ddH2O and sterilizing by autoclaving at 121°C for 20 min.

[0074] The preparation process of MRS liquid medium is as follows: 10g protein Chen, 10g beef extract, 5g yeast powder, 20g glucose, 1mL Tween 80, 2g dipotassium hydrogen phosphate, 5g sodium acetate, 2g diammonium hydrogen citrate, 0.58g magnesium sulfate, 0.25g manganese sulfate, add 1L ddH2O, and sterilize with moist heat at 121℃ for 20min.

[0075] The preparation process of MRS solid medium is as follows: 10g protein Chen, 10g beef extract, 5g yeast powder, 20g glucose, 1mL Tween 80, 2g dipotassium hydrogen phosphate, 5g sodium acetate, 2g diammonium hydrogen citrate, 0.58g magnesium sulfate, 0.25g manganese sulfate, 15g agar powder, add 1L ddH2O, and sterilize by moist heat at 121℃ for 20min.

[0076] The preparation process of SGMRS medium is as follows: 100 mL of MRS liquid medium, 13.65 g of sorbitol, and 3 g of glycine are mixed and sterilized by moist heat at 121°C for 20 min.

[0077] The preparation process of SM buffer is as follows: 32.5 g sucrose and 0.033 g magnesium chloride are added to 1100 mL ddH2O and sterilized by moist heat at 121°C for 20 min.

[0078] The incubation medium was prepared by mixing 50 mL of MRS liquid medium, 8.6 g of sucrose, and 0.475 g of magnesium chloride, and sterilized by moist heat at 121° C. for 20 min.

[0079] Example 1

[0080] This example is used to illustrate the acquisition of the recombinant vector PHSP02-Nb5-slp

[0081] 1. Primer design

[0082] The inventors designed the nucleotide sequence shown in SEQ ID NO: 2 as the coding gene for the nanobody Nb5 (amino acid sequence shown in SEQ ID NO: 1). Based on the nucleotide sequence of Nb5, Snapgene software was used to design and synthesize specific primer pairs Nb5-F (nucleotide sequence shown in SEQ ID NO: 3) and Nb5-R (nucleotide sequence shown in SEQ ID NO: 4), which were synthesized and identified by Beijing Qingke Biotechnology Co., Ltd.

[0083] Nb5-F (SEQ ID NO:3): ATGCAGTTGGATCCGGCCCA,

[0084] Nb5-R (SEQ ID NO:4): GGTAACCTGGGTACCCTGAC;

[0085] Synthetic primer pairs Slp-F (nucleotide sequence shown in SEQ ID NO: 13) and Slp-R (nucleotide sequence shown in SEQ ID NO: 14), AB1-F (nucleotide sequence shown in SEQ ID NO: 15) and AB1-R (nucleotide sequence shown in SEQ ID NO: 16), and AB2-F (nucleotide sequence shown in SEQ ID NO: 17) and AB2-R (nucleotide sequence shown in SEQ ID NO: 18) were designed for the slp adhesion protein gene and the upper and lower homology arms AB1 and AB2 of lactate dehydrogenase, respectively.

[0086] Slp-F (SEQ ID NO: 13): GTTCAGGCGGCGGCGGCTCAatgaagaaaaatttaagaatcgtta,

[0087] Slp-R (SEQ ID NO: 14):

[0088] CATTTAATCGTATGAAATGAcaccaccaccaccaccacttatctaaagtttgcaacct,

[0089] AB1-F (SEQ ID NO: 15): cacatctttttctaaactagggcccattagttgccgactacgc,

[0090] AB1-R (SEQ ID NO: 16):

[0091] GGGCCGGATCCAACTGCATAATAAGTCATCCTCTCGTAGTGA,

[0092] AB2-F (SEQ ID NO: 17):

[0093] aggttgcaaactttagataagtggtggtggtggtggtgTCATTTCATACGATTAAATG, AB2-R (SEQ ID NO: 18): tcaacttgaaaaagtggcaccgagtcggtgctttttctgagaattaggtcgtgagg.

[0094] 2. Construction of recombinant vector PHSP02-Nb5-slp

[0095] (1) PCR amplification was performed using primer pair Nb5-F and Nb5-R, and the PET28a-Nb5 plasmid sequence (nucleotide sequence shown in SEQ ID NO: 19) screened in the previous work as a DNA template. The PCR reaction system was: Premix (25 μL), ddH2O (22 μL), upstream and downstream primers (1 μL each), and DNA template (1 μL). The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min, 1 cycle. The PCR products were analyzed by agarose gel electrophoresis, and the target gene fragment Nb5 (411 bp) was recovered by gel excision.

[0096] PCR amplification was performed using the primer pair slp-F and slp-R with the genome of Lactobacillus acidophilus LA-G80 as a template. The PCR reaction system consisted of: Premix (25 μL), ddH2O (22 μL), upstream and downstream primers (1 μL each), and DNA template (1 μL). The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, and 72°C for 2 min, 30 cycles; and 72°C for 10 min, 1 cycle. The PCR products were analyzed by agarose gel electrophoresis, and the slp adhesion protein gene (1335 bp) was recovered from the gel.

[0097] Two sets of primers, AB1-F and AB1-R, and AB2-F and AB1-R, were used for PCR amplification using the genome of Lactobacillus plantarum WCFS1 as a template. The PCR reaction system was as follows: Premix (25 μL), ddH2O (22 μL), upstream and downstream primers (1 μL each), and DNA template (1 μL). The reaction conditions were as follows: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, 30 cycles; and 72°C for 10 min, 1 cycle. The PCR products were analyzed by agarose gel electrophoresis, and the upper and lower homologous arms of lactate dehydrogenase, AB1 (1000 bp) and AB2 (948 bp), were recovered from the gel.

[0098] The N20 sequence was designed using chopchop software (nucleotide sequence shown in SEQ ID NO: 20);

[0099] N20 sequence (SEQ ID NO: 20): GCTTACATCATGGGTGAACA.

[0100] (2) The PHSP02 vector (deposited and provided by the Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) was double-digested with ApaI and XbaI (both purchased from TAKARA, with brands 1604 and 1634, respectively). The digested product was ligated with the target gene Nb5, slp, the upstream and downstream homology arms AB1 and AB2 of lactate dehydrogenase, and the N20 sequence of lactate dehydrogenase obtained in step (1) (the ligation reaction system was: 10 μL of the vector, 1.25 μL each of Nb5, slp, and the upstream and downstream homology arm fragments, and 15 μL of Gibson one-step cloning enzyme) to obtain the recombinant vector PHSP02-Nb5-slp (nucleotide sequence shown in SEQ ID NO: 7), the map of which is shown in FIG. Figure 1 shown.

[0101] (3) Transformation verification of the recombinant plasmid PHSP02-Nb5-slp

[0102] Take the preserved glycerol strain of Escherichia coli DH5α (purchased from Qingke Biotechnology Co., Ltd., brand TSC-C14) and inoculate it into 2 mL of LB liquid culture medium at an inoculum volume of 1% by volume, and culture it at 37°C and 220 rpm for 12 h to obtain culture I; inoculate the obtained culture I into 100 mL of LB liquid culture medium at an inoculum volume of 1% by volume, and culture it at 37°C for 2 h to OD = 0.6-0.7 to obtain bacterial solution I; use 50 mL centrifuge tubes to pack the bacterial solution I, place it on ice to cool and stand for 30 min to stop the growth of the bacteria, centrifuge it at 4°C and 4000 rpm for 10 min, discard the supernatant, and collect the bacterial precipitate I; add 30 mL of pre-cooled 0.1 M CaCl2 solution to the centrifuge tubes to resuspend the bacterial precipitate I, centrifuge it at 4°C and 4000 r / min for 10 min, pour out the supernatant, and collect the bacterial precipitate II; add 50 mL of Add 0.1M CaCl2 solution, gently pipette to evenly mix the precipitate, let it stand on ice for 30 minutes, centrifuge at 4°C and 4000 rpm for 10 minutes, discard the supernatant, and collect the bacterial precipitate III; add 1% pre-cooled 0.1M CaCl2 + 10% glycerol solution to the centrifuge tube, gently pipette to evenly mix the precipitate, and aliquot 100 μL per tube to obtain DH5α competent cells, which are stored at -80°C for later use;

[0103] The DH5α competent cells and the recombinant vector PHSP02-Nb5-slp were melted on ice separately, and the internal cells were mixed by gently shaking. Then, 10 μL of the above-mentioned recombinant vector PHSP02-Nb5-slp was added to the competent cells DH5α, mixed gently, and allowed to stand in an ice bath for 30 minutes; the above-mentioned mixture was placed in a 42°C water bath for heat shock for 90 seconds, and then quickly transferred to an ice bath and allowed to stand for 3 minutes. Be careful not to shake the centrifuge tube during this process; 1 mL of the prepared sterile, antibiotic-free LB liquid medium was added to the centrifuge tube, and the culture was shaken at 220 rpm at 37°C for 50 minutes to allow the bacteria to recover; after centrifugation at 3000 rpm for 3 minutes, 1 mL of the supernatant was removed, and the remaining bacterial pellet was evenly spread on an MRS solid medium plate with kanamycin (50 μg / mL) by pipetting, and cultured in a 37°C incubator overnight to grow pale white single colonies;

[0104] A certain number of single colonies were picked and PCR identification was performed using specific primer pairs Nb5s-PHSP02-Test-F (nucleotide sequence shown in SEQ ID NO: 5) and Nb5-PHSP02-Test-R (nucleotide sequence shown in SEQ ID NO: 6) (the PCR system is shown in the colony PCR verification system in Table 2). The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, 1 cycle; the PCR product was analyzed by agarose gel electrophoresis, and a band of about 1500 bp appeared, indicating that the recombinant vector PHSP02-Nb5-slp was successfully transformed into the Escherichia coli Dh5α strain.

[0105] Nb5s-PHSP02-Test-F(SEQ ID NO:5):cacatctttttctaaactagggccc;

[0106] Nb5s-PHSP02-Test-R (SEQ ID NO:6):tgacagaatggacatactatgatatattctga;

[0107] Table 2

[0108]

[0109] (4) Extraction of recombinant plasmid PHSP02-Nb5-slp

[0110] The verified single colony was inoculated into 8 mL of MRS liquid culture medium containing 50 μg / mL ampicillin (Amp) and cultured overnight at 37°C in a shaker at 220 rpm for about 12-16 hours; the bacterial liquid was used to extract the plasmid PHSP02-Nb5-slp using a plasmid extraction kit (purchased from Axygen, brand AP-MN-P-50) to obtain the recombinant plasmid PHSP02-Nb5-slp.

[0111] Example 2

[0112] This example is used to illustrate the acquisition of the recombinant strain PHSP02-Nb5-slp-WCFS1

[0113] (1) The plant lactic acid bacteria WCFS1 (preserved and provided by the laboratory of the Institute of Plant Biology, Chinese Academy of Sciences) was taken and inoculated into 2 mL of MRS liquid medium at a 2% inoculum volume, and cultured at 37°C and 220 rpm for 12 h to obtain culture II; the obtained culture II was inoculated into 100 mL of SGMRS medium at a 1% inoculum volume, and cultured at 37°C for 2 h to OD = 0.5 to obtain bacterial liquid II; the obtained bacterial liquid II was transferred to 100 mL of SGMRS medium at a 2% inoculum volume and cultured for 3 h, and then 5 μL of ampicillin Amp was added and cultured for 1 h to obtain culture III, and culture III was rinsed twice with SM buffer, and the bacteria were suspended with 1% culture volume of SM buffer, and the cells were aliquoted in 100 μL per tube to obtain WCFS1 competent cells, which were stored at -80°C for later use;

[0114] (2) Thaw the WCFS1 competent cells on ice and take 1.5 μg of PLH01 plasmid (a helper plasmid used for cutting in the CRISPR system, the nucleotide sequence is shown in SEQ ID NO: 21, and its map is shown in Figure 2 ) was mixed with 100 μL of Lactobacillus plantarum WCFS1 competent cells, the precipitate was gently pipetted and evenly mixed, and the precipitate was transferred to an ice-bathed electroporation cup and allowed to stand on ice for 30 min to fully mix the PLH01 plasmid and the bacteria. The electroporation cup was placed in an electroporator and electroporated at 2.0 KV and 5 ms. 1 mL of sterile incubation medium was added to the centrifuge tube and the tube was incubated at 37° C. for 3 h to allow the bacteria to resume growth. After centrifugation at 3000 rpm for 3 min, 1 mL of supernatant was removed and the remaining bacterial precipitate was evenly spread on an MRS solid culture medium plate, and the plate was placed in a 37° C. incubator overnight to grow white single colonies.

[0115] (3) A certain number of single colonies were picked and PCR identification was performed using specific primer pairs PLH01-Test-F (nucleotide sequence shown in SEQ ID NO: 22) and PLH01-Test-R (nucleotide sequence shown in SEQ ID NO: 23) (the PCR system is shown in Table 2 for 20 μL PCR reaction system). The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 1 cycle. The PCR products were analyzed by agarose gel electrophoresis, and a band of about 650 bp appeared, indicating that the PLH01 plasmid was successfully transferred into the plant lactic acid bacteria WCFS1, and the recombinant strain PLH01-WCFS1 was obtained.

[0116] PLH01-Test-F (SEQ ID NO:22): catgcagtttaaattcggtc;

[0117] PLH01-Test-R (SEQ ID NO:23): atatttaagttaaacccagtaaatg;

[0118] (4) The selected PLH01-WCFS1 strain was inoculated into 2 mL of MRS liquid medium containing chloramphenicol (50 μg / mL), and cultured at 37°C and 220 rpm for 12 h to obtain culture IV; the obtained culture IV was inoculated into 100 mL of SGMRS medium according to an inoculum size of 2 volume%, and cultured at 37°C for 2 h to OD = 0.2-0.3 to obtain bacterial solution III; an inducing peptide was added to the bacterial solution III to make its final concentration 10 mM to induce λ-Red protein for homologous recombination, and then 5 μL of ampicillin (Amp) was added and cultured at 37°C for another 1 h to OD = 0.5 to obtain bacterial solution IV; the bacterial solution IV was washed twice with SM buffer, and the bacteria were suspended with 1% culture volume of SM buffer, and the cells were aliquoted in an amount of 100 μL per tube to obtain PLH01-WCFS1 competent cells, which were stored at -80°C for later use;

[0119] (5) The prepared PLH01-WCFS1 competent cells and the recombinant plasmid PHSP02-Nb5-slp obtained in Example 1 were melted on ice, and the internal cells were mixed by gently shaking. Then 1.5 μg of the recombinant plasmid PHSP02-Nb5-slp was added to the PLH01-WCFS1 competent cells, and after gently mixing, the cells were transferred to an ice-bathed electroporation cup and allowed to stand in the ice bath for 30 minutes to allow the recombinant plasmid PHSP02-Nb5-slp and PLH01-WCFS1 to react. 1. Mix the bacteria thoroughly, place the electroporation cup in an electroporator at 2.0KV and 5ms, add 1mL of sterile incubation medium to the centrifuge tube, and incubate at 37℃ for 3h to allow the bacteria to resume growth; centrifuge at 3000rpm for 3min, remove 1mL of supernatant, and evenly spread the remaining bacterial pellet on an MRS solid medium plate containing chloramphenicol (50μg / μL) and erythromycin (50μg / μL), and incubate in a 37℃ incubator overnight to grow single white colonies;

[0120] (6) A certain number of single colonies were picked and PCR identification was performed using specific primer pairs Nb5s-PHSP02-Test-F (nucleotide sequence as shown in SEQ ID NO: 5) and Nb5s-PHSP02-Test-R (nucleotide sequence as shown in SEQ ID NO: 6) (the PCR system is shown in the colony PCR verification system in Table 2). The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 1 cycle; the PCR products were analyzed by agarose gel electrophoresis, and a band of about 1500p appeared, indicating that the recombinant plasmid PHSP02-Nb5-slp was successfully transferred into Lactobacillus plantarum PLH01-WCFS1, and the recombinant strain PHSP02-Nb5-slp-PLH01-WCFS1 was obtained;

[0121] (7) The selected recombinant strain PHSP02-Nb5-slp-PLH01-WCFS1 was subjected to PCR identification of the genome of the recombinant strain using the specific primer pair slpA-F (nucleotide sequence shown in SEQ ID NO: 24) and WCFS1-Gene-R (nucleotide sequence shown in SEQ ID NO: 25) (the PCR system is shown in Table 3 for verifying the genome integration system). The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 1 cycle; the PCR products were analyzed by agarose gel electrophoresis. Figure 3As shown, a band of about 1500 bp appeared; among them, since lactic acid bacteria are Gram-positive bacteria with thick cell walls, the freeze-thaw method was used to obtain DNA from a single colony. The single colony was picked into 20 μL of sterile water, boiled for 5 minutes, and placed in a -20°C refrigerator for 5 minutes. This was repeated 4 times, and the supernatant was centrifuged to obtain a single colony genome template of the recombinant strain. The above-mentioned PCR reaction was performed, and gel electrophoresis was performed. A 1500 bp target band appeared, indicating that the target gene Nb5 may have been integrated into the genome of the recombinant strain. For further verification, the PCR-corrected colony template was used to perform PCR on the complete integration site using primers PLH01-Test-F and PLH01-Test-R. The results were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing confirmation, confirming that the L-LDH (KEGG: lp-0537) gene was successfully knocked out of the genome of the recombinant strain and that Nb5-slp was integrated.

[0122] slpA-F (SEQ ID NO:24): actcagtaagcgtattgccaaaca,

[0123] WCFS1-Gene-R (SEQ ID NO:25): TAGCAAGGGCTTTTGGCCTCTG;

[0124] Table 3

[0125]

[0126] (8) The single colony that successfully integrated the target gene Nb5-slp into the genome confirmed in step (7) was inoculated with 2 mL of MRS liquid culture medium containing erythromycin (10 mM) and chloramphenicol (10 μM), and after shaking and culturing at 220 rpm overnight, the single colony was diluted to a concentration of 10 -7 The strain was spread on MRS solid medium containing erythromycin (10 μg / mL), cultured at 37°C overnight, and then inoculated into MRS solid medium containing chloramphenicol (10 μg / mL) and MRS solid medium containing erythromycin (10 μg / mL) and chloramphenicol (10 μg / mL) respectively to obtain a strain sensitive to chloramphenicol, indicating that the PLH01 plasmid had been eliminated to obtain the strain PHSP02-Nb5-slp-WCFS1; then the PHSP02-Nb5-slp plasmid in the strain PHSP02-Nb5-slp-WCFS1 was further eliminated: the above single colony PHSP02-Nb5-slp-WCFS1 was inoculated into MRS liquid medium without antibiotics and cultured at 37°C and 220 rpm shaking overnight, and diluted to a concentration of 10 -7Then 100 μL was spread on MRS solid culture medium without resistance and MRS solid culture medium with erythromycin (10 μg / mL). After culturing overnight at 37°C, the strain sensitive to erythromycin resistance successfully eliminated the PHSP02-Nb5-slp plasmid, and the recombinant Lactobacillus plantarum strain Nb5-slp-WCFS1 with the nanoantibody gene Nb5 integrated into the genome was obtained.

[0127] Example 3 Western-Blot verification of Nb5 protein expression in the recombinant strain Nb5-slp-WCFS1

[0128] The recombinant strain Nb5-slp-WCFS1 obtained in Example 2 was inoculated into LB liquid culture medium containing 100 μg / mL of ampicillin and cultured at 37°C and 220 rpm for 12 h to obtain a freshly cultured recombinant strain Nb5-slp-WCFS1 bacterial solution; the Nb5-slp-WCFS1 bacterial solution was inoculated into 100 mL The cells were cultured in MRS liquid medium at 37°C in a shaker for 12 h and 24 h, respectively. The bacterial solution was centrifuged at 8000 rpm in a 4°C centrifuge to remove the supernatant. The bacterial precipitate was washed twice with PBS buffer and then centrifuged. The cells were broken by freeze-thaw boiling method and further broken by ultrasonication to separate the supernatant and the precipitate. 30 μL of the supernatant and 30 μL of the precipitate (resuspended in an equal amount of PBS) were added to 10 μL of 4X protein loading buffer (purchased from Solebold Biotechnology Co., Ltd., brand P1015), respectively. After boiling and denaturing, the supernatant was centrifuged and the supernatant was run on SDS-PAGE protein. The results are as follows: Figure 4 As shown; Figure 4 The box marks indicate that the recombinant strain Nb5-slp-WCFS1 contains the Nb5-slp fusion protein at the target band position.

[0129] After electrophoresis, the protein gel was removed and cut into the required size and then immersed in electrophoresis transfer buffer for 20 minutes. According to the size of the protein gel, a suitable polyvinylidene fluoride membrane (PVDF membrane) and double-layer filter paper were selected, and the PVDF membrane was immersed in fresh methanol for activation. After activation for 30 seconds, it was transferred to the electrophoresis transfer buffer for immersion. At the same time, the filter paper and sponge were also soaked in the transfer buffer in advance. The PVDF membrane, protein gel and double-layer filter paper were stacked to form a sandwich structure. The bubbles between each other were removed with a roller. The transfer system was assembled in sequence according to the instructions of the Tianneng transfer electrophoresis tank. The electrophoresis instrument was set to a constant current of 100mA and electrophoresis was performed for 1 hour. After the transfer, the PVDF membrane was placed in 5% skim milk powder and blocked at room temperature for 1 hour. After the blocking, the PVDF membrane was washed twice with PBST buffer for 5 minutes each time. The rabbit anti-His tag monoclonal antibody was diluted at a ratio of 1:1000, and the PVDF membrane was placed in antibody diluent and incubated in a 4°C refrigerator overnight. After the primary antibody incubation, the PVDF membrane was washed with 0.05% Wash twice with Tween20 neutral PBS buffer (PBS'T), 5 minutes each time; dilute HRP-labeled goat anti-rabbit monoclonal antibody at a ratio of 1:5000, place the PVDF membrane in the antibody diluent, and incubate in a constant temperature shaker at 25°C for 1 hour; after the secondary antibody incubation, wash the PVDF membrane twice with PBS'T, 5 minutes each time; place the PVDF membrane in ECL supersensitive luminescent solution for 60 seconds, and then use the gel imaging system to take pictures. The results are shown in the figure. Figure 5 As shown (wherein, the Marker was purchased from Shanghai Biyuntian Biotechnology Co., Ltd. and is numbered p0075), thereby confirming that the nanobody Nb5 was successfully expressed in the recombinant strain Nb5-slp-WCFS1.

[0130] Example 4

[0131] 1. Perform ELISA enzyme-linked immunosorbent assay on the purified antibody protein to verify its effectiveness

[0132] Qualitative verification of antibody binding effectiveness was performed using the porcine blue ear virus antibody (PDCOV-Ab) ELISA kit (brand number YX-PG-L12365) produced by Shanghai Yuanxin Biotechnology Co., Ltd.:

[0133] Take out the required strips from the aluminum foil bag after equilibration at room temperature; set up negative control wells, positive control wells and sample wells, add 50 μL of negative control and positive control in the ELISA test kit to the negative control wells and positive control wells, and make three sets of parallel for each positive and negative sample; first add 10 μL of the sample to be tested (i.e., target protein Nb5) to the sample well to be tested, and then add 40 μL of the sample diluent in the ELISA test kit, using the target protein Nb5 concentration as gradient 1, set up three sample gradients of 1, 0.5, and 0.25, and make three sets of parallel for each; then negative control 100 μL of horseradish peroxidase (HRP)-labeled detection antigen was added to each well of the positive control well and the sample well, and the reaction wells were sealed with a sealing film. The wells were incubated in a 37°C water bath or in a constant temperature box for 60 min; the liquid was discarded, and the wells were patted dry on absorbent paper. The wash solution was filled in each well and allowed to stand for 1 min. The wash solution was discarded and the wells were patted dry on absorbent paper. The plate was washed 5 times; 50 μL of each chromogenic substrate A and B was added to each well and incubated at 37°C in the dark for 15 min; 50 μL of stop solution was added to each well, and the OD value of each well was measured at a wavelength of 450 nm within 15 min. The results are shown in Table 4.

[0134] Evaluation of test validity: average OD value of positive control wells ≥ 1.00;

[0135] The average OD value of the negative control wells was ≤0.15;

[0136] Calculation of cut-off value: cut-off value = average value of negative control wells + 0.15;

[0137] Negative judgment: if the sample OD value is less than the critical value (Cut off), the sample is negative;

[0138] Positive judgment: sample OD value > cut-off value (Cut off), the sample is positive.

[0139] Table 4

[0140] Parallel 1 Parallel 2 Parallel 3 mean Positive control 3.599 3.342 3.412 3.451 Negative control 0.062 0.058 0.042 0.054 Sample gradient 1 1.197 1.232 1.221 1.217 Sample gradient 0.5 1.152 1.124 1.098 1.125 Sample gradient 0.25 0.933 1.356 0.997 1.095

[0141] According to the data in Table 4, the average OD value of the positive control wells is 3.451, which is greater than 1.00, and the average OD value of the negative control wells is 0.054, which is less than 0.15. The experiment is valid; the critical value is 0.3, and the average OD value of each sample gradient is greater than 0.3, indicating that the target protein Nb5 antibody has good immunogenicity and binding ability to porcine blue ear virus.

[0142] 2. MTT toxicity test of recombinant strain Nb5-slp-WCFS1 on porcine small intestinal epithelial cells IPEC-J2

[0143] IPEC-J2 cells (preserved and provided by Professor Huang He's laboratory at Nanjing Normal University) were taken out of liquid nitrogen for cell recovery. The cryovials were taken out of the liquid nitrogen container, directly immersed in 37°C warm water, and shaken from time to time to melt as quickly as possible; the cryovials were taken out from the 37°C water bath, the lids were opened, the cell suspension was aspirated with a pipette, added to a centrifuge tube, and 10 times more culture medium was added dropwise to mix; the cells were centrifuged at 1000 rpm for 4 min; the supernatant was discarded, and the cells were resuspended in DMEM-F12 culture medium containing 10% calf serum (calf serum was purchased from Zhejiang Tianhang Biotechnology Co., Ltd., with the number 11011-8611 Sijiqing fetal bovine serum; DMED-F12 culture medium was purchased from Jiangsu KeyGen Biotechnology Co., Ltd., with the number KGM12500N-500), counted, and the cell density was adjusted. The cells were inoculated into culture flasks at 37°C, 5% The cells were cultured in a CO2 incubator. The culture medium was replaced the next day and culture was continued for another day. The logarithmic phase cells were digested with trypsin (purchased from Jiangsu KeyGen Biotech Co., Ltd., number KGY0012). After termination, the cells were collected by centrifugation to prepare a cell suspension. The cell count was adjusted to a concentration of 5 × 10 4 / mL; 100 μL of cells with adjusted concentration were inoculated into a 96-well cell culture plate and cultured for 24 h;

[0144] The inoculated cell culture plate was placed in an incubator and cultured for 24 h until the cell monolayer covered the bottom of the well (96-well flat-bottom plate). The metabolic supernatant of the recombinant strain Nb5-slp-WCFS1 and the metabolic supernatant of plant lactic acid bacteria WCFS1 at the same concentration gradient were added at 1 / 12.5, 1 / 25, 1 / 50, and 1 / 100, respectively. The cells were incubated in a 5% CO2, 37°C incubator for 24 h, and the effects of the drugs were observed under an inverted microscope.

[0145] 100 μL of MTT solution (0.5 mg / mL, i.e., 0.5% MTT, diluted with DMED-F12 basal medium) was added to each well and cultured for 4 h. The culture was terminated and the crystals were dissolved. MTT was removed by aspiration and 150 μL of DMSO was added to each well. The wells were shaken at low speed on a shaker for 10 min to fully dissolve the crystals. The OD value of the sample was measured on an enzyme-linked immunosorbent assay (ELISA) instrument. 570nm The absorbance of each well was measured and the cell viability was calculated to determine whether the recombinant strain Nb5-slp-WCFS1 obtained in Example 2 was toxic to the cells. The results are shown in Table 5. The experimental data shown in Table 5 show that the recombinant strain Nb5-slp-WCFS1 obtained in Example 2 had no active effect on cell growth.

[0146] Table 5 Cell viability

[0147] concentration gradient 1 / 12.5 1 / 25 1 / 50 1 / 100 Recombinant strain Nb5-slp-WCFS1 89.74％ 92.06％ 111.63％ 109.92％ Starting strain WCFS1 96.99％ 110.31％ 95.1％ 103.29％

[0148] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.

Claims

1. A nanobody Nb5, characterized in that, The nanobody Nb5 is a protein with an amino acid sequence as shown in SEQ ID NO:

1.

2. A gene encoding a nanobody, characterized in that, This gene is a polynucleotide encoding the nanobody Nb5 described in claim 1.

3. The gene according to claim 2, wherein The gene is a polynucleotide as shown in SEQ ID NO:

2.

4. A recombinant vector, characterized in that, The recombinant vector contains the gene described in claim 2 or 3.

5. The recombinant vector according to claim 4, wherein The recombinant vector is the PHSP02 vector.

6. A recombinant strain, characterized in that, The recombinant strain contains the gene described in claim 2 or 3 or the recombinant vector described in claim 4 or 5.

7. The recombinant strain according to claim 6, wherein The original strain of the recombinant strain is selected from at least one of Lactobacillus plantarum, Escherichia coli, Saccharomyces cerevisiae, and Bacillus subtilis.

8. The recombinant strain according to claim 7, wherein The original strain of the recombinant strain is Lactobacillus plantarum WCFS1.

9. A bacterial agent, characterized in that, The microbial agent contains the recombinant strain described in any one of claims 6 to 8.

10. The microbial agent according to claim 9, characterized in that, The microbial agent is a liquid microbial agent and / or a solid microbial agent.

11. Use of the nanobody Nb5 described in claim 1, the gene described in claim 2 or 3, the recombinant vector described in claim 4 or 5, the recombinant strain described in any one of claims 6 to 8, or the microbial agent described in claim 9 or 10 in the preparation of a drug for preventing porcine reproductive and respiratory syndrome.

Images