A nasturtium R2R3-MYB transcription factor gene TmPAP and its application

Abstract

The present invention provides a nasturtium R2R3-MYB transcription factor gene TmPAP and its application, belonging to the technical field of plant genetic engineering. The nasturtium R2R3-MYB transcription factor gene TmPAP provided by the present invention has the function of regulating the synthesis of plant anthocyanins. Through protoplast transfection, it is found that TmPAP is located in the cell nucleus and has transcriptional activation activity. The present invention overexpresses TmPAP in Arabidopsis thaliana, and the results show that overexpression can promote the accumulation of anthocyanins, indicating that the TmPAP gene of the present invention can be used for the construction of transgenic plants with high anthocyanin content.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a nasturtium R2R3-MYB transcription factor gene TmPAP and an application thereof. Background Art

[0002] Anthocyanins are soluble natural food pigments widely found in plants. Anthocyanins are secondary metabolites. Anthocyanins generally appear in red, purple and other colors, making plants colorful and helping to attract insects to help pollinate plants. Anthocyanins can also enhance the ability of plants to resist ultraviolet rays and strong light, as well as adverse conditions such as low temperature stress. Anthocyanins not only play an important role in plants themselves, but also have application value in food and medicine. For example, anthocyanins can be made into health products due to their antioxidant effects. Anthocyanins can also be used to prevent cardiovascular and cerebrovascular diseases and even cancer.

[0003] R2R3-MYB is one of the largest transcription factor families in the plant genome, and is widely involved in the entire process of plant growth and development, such as secondary metabolism regulation, response to environmental factors, development and cell differentiation, etc. However, there is no report on the regulation of anthocyanin synthesis by the nasturtium R2R3-MYB transcription factor gene. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a nasturtium R2R3-MYB transcription factor gene TmPAP, which can regulate the synthesis of plant anthocyanins and can be used for the construction of transgenic plants with high anthocyanin content.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a nasturtium R2R3-MYB transcription factor gene TmPAP, and the nucleotide sequence of the nasturtium R2R3-MYB transcription factor gene TmPAP is shown in SEQ ID NO.1.

[0007] The present invention also provides a protein encoded by the nasturtium R2R3-MYB transcription factor gene TmPAP, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0008] The present invention also provides an application of the nasturtium R2R3-MYB transcription factor gene TmPAP in regulating plant anthocyanin synthesis or in constructing high-content anthocyanin transgenic plants.

[0009] Preferably, the plant species includes Arabidopsis thaliana.

[0010] The present invention also provides a method for increasing the anthocyanin content of a plant, which comprises over-expressing the nasturtium R2R3-MYB transcription factor gene TmPAP in the plant.

[0011] Preferably, the overexpression includes introducing the nasturtium R2R3-MYB transcription factor gene TmPAP into the target plant via a recombinant plasmid.

[0012] Preferably, the recombinant plasmid is a plant overexpression vector containing the nasturtium R2R3-MYB transcription factor gene TmPAP, and the plant overexpression vector is pPZP-35S:TmPAP.

[0013] The present invention also provides an application of a recombinant vector containing the nasturtium R2R3-MYB transcription factor gene TmPAP in increasing the anthocyanin content of plants.

[0014] The present invention also provides an application of a nasturtium R2R3-MYB transcription factor gene TmPAP and a recombinant vector thereof in plant breeding and cultivation.

[0015] Beneficial effects of the present invention:

[0016] The present invention clones and obtains a full-length coding sequence of a nasturtium R2R3-MYB transcription factor gene TmPAP. The nasturtium R2R3-MYB transcription factor gene TmPAP provided by the present invention has the function of regulating the synthesis of plant anthocyanins. Through protoplast transfection, it is found that TmPAP is located in the cell nucleus and has transcriptional activation activity. The present invention overexpresses TmPAP in Arabidopsis thaliana, and the results show that overexpression can promote the accumulation of anthocyanins, indicating that the TmPAP gene of the present invention can be used for the construction of transgenic plants with high anthocyanin content. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The difference in anthocyanin content between the two nasturtium varieties. Figure A shows the phenotypic difference, and Figure B shows the content difference.

[0018] Figure 2 is the expression of TmPAP in different nasturtium varieties;

[0019] Figure 3 The experimental results of the present invention that TmPAP is a transcription activator, wherein A is the subcellular localization of TmPAP, and B is the transcription activity of TmPAP;

[0020] Figure 4 The phenotypic differences of transgenic Arabidopsis overexpressing TmPAP, where the upper figure shows the leaf phenotypic differences and the lower figure shows the seed phenotypic differences. DETAILED DESCRIPTION

[0021] The invention provides a nasturtium R2R3-MYB transcription factor gene TmPAP, the nucleotide sequence of the gene TmPAP is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the nasturtium R2R3-MYB transcription factor gene TmPAP is shown as SEQ ID NO.2.

[0022] The nasturtium R2R3-MYB transcription factor gene TmPAP of the present invention is cloned from the nasturtium chromatin high content variety Empress of India. The present invention has no special limitation on the specific cloning method, and any conventional cloning method in the art can be used.

[0023] The present invention also provides an application of the above-mentioned nasturtium R2R3-MYB transcription factor gene TmPAP in regulating plant anthocyanin synthesis or in constructing high-content anthocyanin transgenic plants. In the present invention, the plant species include Arabidopsis thaliana.

[0024] The present invention also provides a method for increasing the anthocyanin content of a plant, which comprises over-expressing the nasturtium R2R3-MYB transcription factor gene TmPAP in the plant.

[0025] In the present invention, the overexpression is preferably to introduce the nasturtium R2R3-MYB transcription factor gene TmPAP into the target plant by constructing a recombinant plasmid for plant transformation. The recombinant plasmid is preferably a plant overexpression vector containing the nasturtium R2R3-MYB transcription factor gene TmPAP, and the plant overexpression vector is preferably pPZP-35S:TmPAP. The present invention has no special restrictions on the specific method of overexpression, and any conventional overexpression method in the art can be used.

[0026] The present invention also provides an application of a recombinant vector containing the above-mentioned nasturtium R2R3-MYB transcription factor gene TmPAP in increasing the anthocyanin content of plants, and provides an application of the nasturtium R2R3-MYB transcription factor gene TmPAP and its recombinant vector in plant breeding and cultivation.

[0027] The present invention has no particular limitation on the specific types of recombinant vectors and bacteria used for transformation, and any conventional recombinant vectors and bacteria in the art may be used.

[0028] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0029] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] Example 1

[0032] The nasturtium varieties Empress of India and Buttercream were purchased from RENEE'S GARDEN LLC in the United States. The pictures of Empress of India and Buttercream nasturtium seedlings are as follows: Figure 1 As shown in A, it shows that the anthocyanin content varies greatly.

[0033] The anthocyanin content in Empress of India and Buttercream nasturtium seedlings was determined respectively. The specific determination method is as follows:

[0034] Place the stems and leaves of nasturtium in a 2ml centrifuge tube, add 2 small steel balls, place in liquid nitrogen, freeze, and crush in a plant tissue crusher. Prepare anthocyanin extract according to the volume ratio of water: methanol: hydrochloric acid = 24:75:1, add the extract to the powder, and the concentration is 1g / ml. Protect from light, store at 4℃ for 10-12h, then centrifuge at 14,200rpm for 10min, and retain the supernatant.

[0035] The content of anthocyanin was determined by fluorescence analyzer, and OD530 and OD657 were measured respectively. The relative content of anthocyanin was calculated using the formula: OD530-(0.25×OD657)×1ml / 0.1g. The results were repeated three times and the data were expressed as mean ± standard deviation. Figure 1 As shown in B. There is a huge difference in anthocyanin content between Empress of India and Buttercream nasturtium varieties. The anthocyanin content in Empress of India is significantly higher than that in Buttercream nasturtium variety.

[0036] Then we determined that the nasturtium R2R3-MYB transcription factor gene TmPAP was cloned from the nasturtium variety Empress of India.

[0037] Example 2

[0038] RNA was extracted from seedlings of nasturtium varieties Empress of India and Buttercream, and the expression level of TmPAP was detected by RT-PCR, with the expression level of TmACT2 as the control. The specific method is as follows:

[0039] Plant the seeds from which RNA is to be extracted in the soil. When the seedlings grow for about 10 days, use the EasyPure Plant RNAKit kit to extract RNA. The specific steps are as follows:

[0040] Freeze 100 mg of young leaves of Nasturtium in liquid nitrogen, grind them into powder quickly, then add the corresponding amount of BB6 (add 10 μl of β-mercaptoethanol for every 1 ml of BB6, prepare it immediately before use), and vortex to mix. Incubate at room temperature for 3 minutes. Centrifuge for 2-5 minutes at a speed of 12,000×g, and aspirate the supernatant into an RNase-free centrifuge tube. Add 0.5 times the volume of anhydrous ethanol to the above supernatant and vortex to mix. Vortex to mix and disperse the precipitate in the centrifuge tube. Transfer the mixture to a centrifuge column, centrifuge at a speed of 12,000×g for 30 seconds, and discard the effluent. Add 500μl of CB6, centrifuge at room temperature at a speed of 12,000×g for 30 seconds, and discard the effluent. Add 80μl of DNase I working solution, let stand for 15 minutes, add 500μl CB6, centrifuge at 12,000×g for 30 seconds, and finally discard the effluent. Add 500μl WB6, centrifuge at 12,000×g for 30 seconds, and discard the effluent. Repeat the previous step. Centrifuge at 12,000×g for 2 minutes, and let it dry at room temperature for several minutes to completely remove the ethanol. Add 30-300μl RNase-free H2O to the center of the centrifuge column and let it stand at room temperature for 1 minute. Centrifuge at 12,000×g for 2 minutes at room temperature to elute the RNA. Store the eluted RNA at -80℃.

[0041] The obtained RNA was reverse transcribed to obtain cDNA. The specific reverse transcription system is shown in Table 1. The solution was mixed, incubated at 42°C for 30 minutes, and then heated at 85°C for 5 minutes to inactivate EasyScript RT. PCR amplification was performed using cDNA as a template. The primer sequences used for amplification were:

[0042] TmPAP-F: ATGGAAAGCTTGCTTGGTAGG (SEQ ID NO.3),

[0043] TmPAP-R: CTTAAATGATGATTTAGATTGA (SEQ ID NO. 4),

[0044] TmACT2-F: GTTTGGGATGGGCCAAAAGGA (SEQ ID NO.5),

[0045] TmACT2-R: CGACCACTGGCATAAAGGGA (SEQ ID NO. 6). The reaction system for PCR amplification is shown in Table 2.

[0046] Table 1 Reverse transcription system

[0047]

[0048] Table 2 PCR amplification reaction system

[0049]

[0050] The reaction procedure for PCR amplification is:

[0051]

[0052] The results are as follows Figure 2 The expression levels of the TmPAP gene of the present invention in the Empress of India, a variety with high nasturtium cyanidin content, and the Buttercream, a variety with low cyanidin content, have great differences.

[0053] Example 3

[0054] Arabidopsis protoplasts were co-transfected with GFP-TmPAP and NLS-RFP nuclear localization plasmids. After transfection, the cells were cultured in the dark at room temperature for 20 to 22 hours, and GFP and RFP fluorescence were observed under a fluorescence microscope. Figure 3 As shown in A. The reporter gene Gal4:GUS and the effector gene GD-TmPAP plasmid were co-transfected into Arabidopsis protoplasts. After transfection, the cells were cultured in the dark at room temperature for 20 to 22 hours, and the GUS enzyme activity was measured by an ELISA instrument. GD co-transfection was used as a control. The data represent the mean ± standard deviation of three replicates. Figure 3 As shown in B. It shows that the TmPAP of the present invention is localized in the cell nucleus and has transcriptional activation activity.

[0055] Example 4

[0056] Cloning of target gene

[0057] TmPAP was amplified using a high-fidelity enzyme (Phusion), and the reaction system was the same as in Table 2. The total volume was 50 μl, and the amount of Phusion Buffer used was 10 μl.

[0058] The PCR reaction conditions were:

[0059]

[0060] PCR product recovery:

[0061] Under UV light, cut the gel block containing the target DNA band. Weigh the weight of the gel as one volume. Add 3 volumes of Buffer DE-A, mix them evenly, and heat at 75℃ until the gel is completely melted. Add 0.5 volumes of Buffer DE-B of Buffer DE-A and mix them evenly. Pipette the mixed solution into the DNA preparation tube, centrifuge at 12,000×g for 1min, and discard the filtrate. Return it to the 2ml centrifuge tube, add 500μl of Buffer W1, centrifuge at 12,000×g for 30s, and discard the filtrate. Add 700μl of Buffer W2, centrifuge at 12,000×g for 30s, discard the filtrate, wash again in the same way, and centrifuge at 12,000×g for 1min. Return the preparation tube to the 2ml centrifuge tube, empty it, and centrifuge at 12,000×g for 1min. Place the preparation tube in a new 1.5 ml centrifuge tube, add 25-30 μl of deionized water, let stand for 1 min, and centrifuge at 12,000 × g for 1 min to elute the DNA.

[0062] Double enzyme digestion reaction:

[0063] Select appropriate restriction sites according to the target gene and vector, and use restriction enzymes to cut the target gene and vector.

[0064] 1) Complete digestion

[0065] When the target gene and the vector are cut only once by the selected restriction site, complete restriction digestion can be achieved. The reaction system is shown in Table 3. After the reaction solution is mixed, it is placed in a dry incubator at 37°C for 1-2 hours, and then the DNA fragments are separated and purified.

[0066] Table 3 Double enzyme digestion reaction system

[0067]

[0068] 2) Partial digestion

[0069] When there are multiple restriction sites for the target gene or vector, partial restriction digestion is required. The reaction system is similar to complete restriction digestion, but the amount of enzyme used for partial restriction digestion needs to be reduced to 0.3-0.5μl, and the reaction time needs to be shortened to 5-8min. The partial restriction digestion product cannot be directly purified for DNA, and the target band needs to be cut out by gel electrophoresis.

[0070] DNA purification

[0071] Add 3 volumes of Buffer PCR-A to the PCR double digestion product; after mixing, transfer to the preparation tube placed in a 2ml centrifuge tube, centrifuge at 12,000×g for 1min, and discard the filtrate. Add 700μl of Buffer W2, centrifuge at 12,000×g for 1min, and discard the filtrate. Put the preparation tube back into the 2ml centrifuge tube, add 400μl of Buffer W2, centrifuge at 12,000×g for 1min. Put the preparation tube in a 1.5ml centrifuge tube, add 25-30μl of deionized water, and let it stand at room temperature for 1min. Centrifuge at 12,000×g for 1min to elute the DNA.

[0072] Ligation reaction:

[0073] Determine the ratio in the ligation reaction according to the concentration of the purified DNA product after double enzyme digestion and the vector, mix according to Table 4, and react at room temperature overnight.

[0074] Table 4 DNA ligation reaction system

[0075]

[0076] Transformation of competent E. coli

[0077] The ratio of E. coli DH5α competent cells to ligation product is 10:1, that is, 20μl of DH5α, add 2μl of ligation product. Place on ice for 30min. Heat shock at 42℃ for 30-90s, place on ice for 2min. Add 500μl of LB liquid culture medium. Adjust the full-temperature variable frequency shaker to 37℃ and shake for 1h. In the clean bench, evenly apply 500μl of transformation product on the LB solid culture medium containing the corresponding antibiotics in the culture dish. When there is no liquid flow, seal the culture dish with sealing film. Invert the culture dish in a 37℃ constant temperature incubator and culture for 12-16h.

[0078] Small amount of plasmid DNA extraction

[0079] From each culture medium after transformation of E. coli, pick 3 single clones and inoculate them into 2 mL of LB liquid medium containing the corresponding antibiotics. Incubate in a shaker at 37°C at 220 rpm for 12-16 hours. Centrifuge 2 ml of the bacterial solution at 10,000 × g for 1 min to collect the bacteria. Discard the culture medium, add 250 μl Solution I / RNaseA, and vortex to suspend the cells. Add 250 μl Solution II to the mixture, mix gently, and invert 4-6 times. Add 350 μl Solution III and gently invert several times until a white flocculent precipitate appears. Centrifuge at ≥10,000 × g for 10 min at room temperature. Transfer the supernatant to a HiBind DNA binding column, centrifuge at 10,000 × g for 1 min at room temperature, and discard the filtrate in the collection tube. Add 500 μl HB Buffer to the column, centrifuge under the same conditions as above, and then discard the filtrate. Discard the filtrate and repeat the previous step. Discard the filtrate, put the column into the collection tube, and centrifuge the empty column at 10,000×g for 2 minutes to dry the column. Put the column in a new 1.5ml centrifuge tube, add an appropriate amount of sterile water to the column filter membrane, let it stand for 1-2 minutes, and centrifuge at 10,000×g for 1 minute to elute the DNA.

[0080] Detection of plasmid DNA

[0081] The plasmid DNA obtained by small extraction was tested by selecting restriction enzymes according to the distribution of restriction sites on the plasmid. The specific reaction system is shown in Table 3. The reaction system is 10 μl and placed in a 37°C incubator for about 1 hour. The size of the fragment obtained by gel electrophoresis is then used to determine whether the target gene is connected to the vector.

[0082] Preparation and transformation of Agrobacterium tumefaciens competent cells

[0083] Preparation of Agrobacterium tumefaciens competent cells

[0084] Streak GV3101 Agrobacterium tumefaciens competent cells on LB medium and incubate at 30°C overnight. Pick a single clone and incubate in a medium containing 5ml LB and 50μl 2mg / ml rifampicin at 30°C overnight. Pour the bacterial solution into a liquid medium containing 250ml LB and 1.25g glucose and incubate at 30°C overnight. Pour the bacterial solution into a centrifuge bottle, centrifuge at 4°C, 4700rmp, and centrifuge for 7min, and discard the supernatant. Pour 25ml 0.15M NaCl (sterilized, ice bath) solution into the centrifuge bottle in the previous step, suspend the cells, ice bath for 15min, and finally pour into a new 50ml centrifuge tube. Centrifuge at 4°C, 4700rmp for 10min, and discard the supernatant. Suspend the cells with 20mM, 2.5ml CaCl2 solution (sterilized, ice bath). Aliquot into 1.5ml centrifuge tubes and store at -80°C.

[0085] Agrobacterium tumefaciens competent cell transformation

[0086] The ratio of Agrobacterium tumefaciens to ligation product is 10:1. Place on ice for 30 minutes. Heat shock at 42℃ for 90 seconds, place on ice for 2 minutes. Add 500μl of LB liquid culture medium. Shake the culture medium at 30℃ for 1 hour. In the clean bench, evenly apply 500μl of solution on the solid culture medium in the culture dish. The culture medium is LB containing the corresponding antibiotics. When the surface is dry, seal the culture dish with sealing film. Invert the culture dish in a 30℃ incubator and culture for 30 hours.

[0087] Plant transformation and homozygous screening

[0088] Plant transformation

[0089] Inoculate the plasmid-containing Agrobacterium tumefaciens from the culture medium into a liquid culture medium, which is 250ml LB with antibiotics, 30℃, 220rpm, and shake for 24h. Pour the bacterial solution into the collection bottle, centrifuge at 4700rpm for 15min. Prepare a 5% sucrose solution for later use. Pour out the supernatant in the collection bottle, pour the prepared 5% sucrose solution into the collection bottle, and vortex until the cells are completely suspended. Pour the vortexed bacterial solution into a beaker and add Silwet L-77 surfactant 0.02%. Put the beaker on a stirrer and mix well. Immerse the inflorescence and leaves of Arabidopsis thaliana that have bolted and only a few flowers on the main flower stem are fully open in the bacterial solution for 3min. Put the infected plants upside down in the seedling tray, add a small amount of water at the bottom of the seedling tray, and place it in the dark for 24h. Then put it in the plant culture room for normal culture.

[0090] Screening for homozygotes

[0091] The seeds obtained from Arabidopsis infected with Agrobacterium are T1. The seeds of T1 are sterilized and planted in large quantities on T11 / 2MS medium (Kana 50μg / ml and Carben 100μg / ml) containing the corresponding antibiotics. The resistant plants are selected and transplanted into soil for cultivation. The seeds are collected from individual T1 resistant plants and are called T2. T2 is screened in 1 / 2MS resistant medium (Kana 25μg / ml) according to the ratio of normal seedlings: yellow seedlings = 3:1, and transferred to soil. Each line has 6 plants. The seeds obtained from T2 plants are T3. The seeds are collected by ramets, marked, and T3 is planted in a medium containing antibiotics. The plants with all surviving seedlings are homozygous plants.

[0092] According to the above specific description, the pPZP-35S:TmPAP plasmid was transferred into Agrobacterium GV3101 and transformed into Arabidopsis Col wild-type plants. After two generations of separation and screening, a homozygous strain was finally obtained. The leaves and seeds of the homozygous strain overexpressing the TmPAP gene were compared with those of Arabidopsis Col wild-type plants. The results are as follows: Figure 4 As shown, phenotypic observation revealed that the anthocyanin content of transgenic plants overexpressing the TmPAP gene was significantly increased.

[0093] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of the nasturtium R2R3-MYB transcription factor gene TmPAP in the construction of high-content anthocyanin transgenic plants, characterized in that: The nucleotide sequence of the nasturtium R2R3-MYB transcription factor gene TmPAP is shown in SEQ ID NO.1, and the plant species is Arabidopsis thaliana.

2. A method for increasing the anthocyanin content of a plant, characterized in that: The method is to over-express the nasturtium R2R3-MYB transcription factor gene TmPAP in plants, characterized in that the nucleotide sequence of the nasturtium R2R3-MYB transcription factor gene TmPAP is shown in SEQ ID NO.1; and the plant species is Arabidopsis thaliana.

3. The method according to claim 2, characterized in that The overexpression includes introducing the nasturtium R2R3-MYB transcription factor gene TmPAP into the target plant by plant transformation using a recombinant plasmid.

4. Use of a recombinant vector containing the nasturtium R2R3-MYB transcription factor gene TmPAP in increasing the anthocyanin content of plants, characterized in that: The nucleotide sequence of the nasturtium R2R3-MYB transcription factor gene TmPAP is shown in SEQ ID NO.1; the plant species is Arabidopsis thaliana.

Images