A method and use of gene editing
Targeting the VPF gene through the base editing system, introducing stop codon or start codon mutations is solved, and the global disruption of CRISPR/Cas9 technology and the defects of antibody drugs are achieved, safe and efficient VPF silencing is provided, and safe gene therapy is provided.
Patent Information
- Application Number
- CN202210814386.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-11
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2042-07-11
AI Technical Summary
Existing gene editing technologies such as CRISPR/Cas9 have global disruption and cancer risk caused by DNA double-strand breakage when treating wet AMD, and there are problems with frequent injections and economic burden on antibody drug treatment.
Using a base editing system, a stop codon or point mutation start codon is introduced by targeting the target C base and/or target A base of the VPF gene, and editing is performed using fusion proteins or their variants and guide nucleotides to avoid DNA double-strand breakage, including fusion proteins of Cas9 fragments and deaminase fragments, and delivered to cells using liposome transfection, electroporation and other methods.
It has achieved safe and efficient silencing of VPF expression, reduced the risk of cancer, provided a high-safe gene therapy option, and laid a technical foundation for the treatment of genetic diseases and related diseases.
Smart Images

Figure BDA0003740488740000101 
Figure HDA0003740488750000011 
Figure HDA0003740488750000012
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine, and particularly to a method and use of gene editing. Background Art
[0002] Gene sequencing technology enables us to read out the genomic sequence, while gene editing technology, especially CRISRP / Cas9 technology, makes it easier for us to modify the genomic sequence. The 2020 Nobel Prize in Chemistry was awarded to Emmanuelle Charpentier and Jennifer A. Doudna for their development of a method for genome editing. After more than a decade of development, gene editing technology has demonstrated great value in multiple fields such as gene function research, genetic disease treatment, and cancer treatment.
[0003] Age-related macular degeneration (AMD) is the main factor leading to irreversible blindness in the elderly population. It is predicted that by 2040, AMD will affect nearly 300 million people. AMD is clinically divided into two types: dry and wet. The clinical progression of wet AMD is characterized by choroidal neovascularization (CNV), and the occurrence of CNV is the main cause of rapid blindness in patients. Research has shown that vascular endothelial growth factor (VEGF) plays an important role in the process of CNV. Nozaki et al. examined the retinal and choroidal tissues of AMD patients and found that activated complement can up-regulate the expression of VEGF in local tissues. Targeting VEGF has become a method for treating wet AMD. Currently, drugs targeting VEGF include bevacizumab, ranibizumab, aflibercept, brolucizumab, etc., and these drugs all target the VEGF protein. However, antibody drugs have certain defects. For example, they need to be injected frequently, which not only increases the risk of complications, but also is not friendly to patients and increases the economic burden on patients. Using gene therapy to directly disrupt the expression of VEGF will be a potentially highly effective treatment method.
[0004] The CRISPR / Cas9 gene editing technology cuts double-stranded DNA based on the Cas9 protein. When the broken double-stranded DNA is repaired, insertions or deletions can be introduced, thereby knocking out the target gene. However, research has shown that this genetic operation based on DNA double-strand breaks (DSBs) has major defects, which may lead to chromosomal deletions at the megabase level and cause global damage to the human cell genome. In addition, double-strand breaks can trigger p53-induced apoptosis, and positively edited cells are more likely to enrich cells with p53 mutations. Injecting such edited cells into the body undoubtedly increases the risk of cancer. Base editing technology incorporates deaminases into the CRISPR / Cas technology to achieve base editing in situ by deaminating bases. This editing method does not require the introduction of DNA double-strand breaks and is theoretically safer. Currently, the most widely used are cytosine base editing (CBE) and adenine base editing (ABE), which can achieve the conversion of C to T or A to G, respectively. In addition, some types of base transversion editors can also achieve the transversion of C to G (C:G to G:C Base Editors, CGBE) or A to C, which undoubtedly increases the types of base editing. The proposal of base editing technology has quickly become a popular tool in the field of gene editing. Cytosine base editing can act on the coding sequence (CDS) of the expressed gene, and by targeting CAA, CAG, CGA or TGG, a stop codon is generated to achieve the purpose of knocking out the gene. CGBE can generate a stop codon by targeting TAC or TCA. In addition, cytosine base editing, adenine base editing and CGBE editors can all achieve the purpose of knocking out the gene by targeting the start codons ATG or CTG. Summary of the Invention
[0005] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide a method and use for editing the VPF gene to solve the problems in the prior art.
[0006] To achieve the above object and other related objects, the present invention provides a method for editing the VPF gene, the method comprising deaminating a target C base and / or a target A base on the VPF polynucleotide using a base editing system to introduce a stop codon or a point mutation start codon into the coding region of the VPF gene; the base editing system comprises:
[0007] (a) a fusion protein or a variant thereof or a polynucleotide encoding the same, the fusion protein comprising a Cas9 fragment and a deaminase fragment;
[0008] (b) A guiding nucleotide or its encoding polynucleotide that targets the fusion protein or its variant described in (a) to the target C base and / or target A base.
[0009] The present invention also provides cells obtained by the method of editing the VPF gene.
[0010] The cells are somatic cells or germ cells. The cells are, for example, RPE cells or Muller cells.
[0011] The present invention also provides the use of the cells in the preparation of products for preventing or treating diseases related to VPF overexpression.
[0012] As described above, the method and use of editing the VPF gene of the present invention have the following beneficial effects: By using base editing technology, the expression of VPF is silenced by point mutation to achieve the purpose of treating diseases, overcoming the harmful effects caused by DNA double strands by CRISPR / Cas technology. The base editing system preferably used in the present invention, which embeds deaminase into the middle of the Cas9 protein, has no obvious difference in off-target at the DNA and RNA levels compared with wild-type cells, indicating the safety of this method for gene therapy products. Through this method, new options can be provided for the establishment of base editing technology for treating genetic diseases and gene abnormality diseases, support can also be provided for the research of new effective gene targets, and a solid technical foundation can be laid for the research of related disease treatments. Description of the Drawings
[0013] Figure 1 Shown are gene knockout pattern diagrams of different base editing systems. (A) Inducing the generation of a stop codon; (B) Disrupting the start codon.
[0014] Figure 2 Shown are the results of detecting the efficiency of inducing stop codon mutations in the RPE cell line.
[0015] Figure 3 Shown are the results of detecting the efficiency of inducing stop codon mutations in the Muller cell line.
[0016] Figure 4 Shown are the results of detecting the efficiency of start codon mutations (sites 14 and 15) in the RPE cell line.
[0017] Figure 5 Shown are the results of detecting the efficiency of mutating the start codon (site 16) using an adenine base editor in the RPE cell line.
[0018] Figure 6 Shown are the results of detecting the efficiency of start codon mutations (sites 14 and 15) in the Muller cell line.
[0019] Figure 7 Shown are the results of detecting the efficiency of mutating the start codon (16 sites) using an adenine base editor in the Müller cell line.
[0020] Figure 8 Shown are the VPF expression levels of different types of mutant cell lines.
[0021] Figure 9 Shown are the number of snps detected in different mutant cell lines. Detailed implementation
[0022] The present invention provides a method for editing the VPF gene, the method comprising deaminating a target C base and / or a target A base on the VPF polynucleotide using a base editing system to introduce a stop codon or a point-mutated start codon into the coding region of the VPF gene; the base editing system comprising:
[0023] (a) A fusion protein or a variant thereof or a polynucleotide encoding the same, the fusion protein comprising a Cas9 fragment and a deaminase fragment;
[0024] (b) A guide nucleotide or a polynucleotide encoding the same, which targets the fusion protein or a variant thereof in (a) to the target C base and / or the target A base.
[0025] The Gene ID of the VPF gene is 7422.
[0026] The VPF polynucleotide comprises a coding strand and a complementary strand; the polynucleotide encoding the VPF protein comprises a coding region and a non-coding region.
[0027] The VPF polynucleotide can be in the form of DNA or RNA. The DNA form is selected from cDNA, genomic DNA or synthetic DNA, and can be single-stranded or double-stranded; the DNA can be a coding strand or a non-coding strand.
[0028] Deamination of the target C base and / or target A base on the VPF polynucleotide results in the conversion of C to T, or A to G, or C to G in the VPF polynucleotide. In some embodiments, the C-to-T conversion, and / or A-to-G conversion, and / or C-to-G conversion occur in the coding sequence of the VPF polynucleotide. In some embodiments, the C-to-T conversion, and / or A-to-G conversion, and / or C-to-G conversion results in a mutation in the VPF protein; the mutation in the VPF protein is a loss-of-function mutation or a non-coding mutation. The loss-of-function mutation introduces a stop codon in the VPF coding sequence, resulting in the production of a truncated or non-functional VPF protein. The non-coding mutation is caused by mutating the start codon of the VPF coding sequence, which results in the elimination of VPF expression. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations are introduced into the VPF polynucleotide.
[0029] In some embodiments, the stop codon is TAA, TAG, or TGA. For example, the stop codon is generated by the deamination of the first C on the coding strand from CAA to TAA; the stop codon is generated by the deamination of the first C on the coding strand from CAG to TAG; the stop codon is generated by the deamination of the first C on the coding strand from CGA to TGA; the stop codon is generated by the deamination of the third C on the complementary strand from TGG to TGA; the stop codon is generated by the deamination of the third C on the complementary strand from TAC to TAG; the stop codon is generated by the deamination of the second C on the complementary strand from TCA to TGA.
[0030] The start codon is ATG or CTG. The start codon mutation is generated by the deamination of the third C on the complementary strand from ATG to ATA; the start codon mutation is generated by the deamination of the second A on the complementary strand from ATG to ACG; the start codon mutation is generated by the deamination of the first A on the coding strand from ATG to GTG. The start codon mutation is generated by the deamination of the third G on the coding strand from ATG to ATC.
[0031] In certain embodiments of the present invention, the fusion protein or its variant can be directly delivered to an object to be edited, such as a host cell; or delivered in the form of a messenger RNA (mRNA) molecule, which is translated into the fusion protein or its variant after being delivered into the host cell; or delivered in the form of an expression vector, which contains a deoxyribonucleic acid (DNA) sequence encoding one or more genes to express the fusion protein or its variant.
[0032] In some embodiments of the present invention, the guide nucleotide can be directly delivered to an object to be edited, such as a host cell.
[0033] In some embodiments, the guide nucleotide can be delivered in the form of an expression vector, and the expression vector contains one or more copies of the guide nucleotide encoded thereon.
[0034] In certain embodiments of the present invention, the fusion protein is selected from one or more of a cytosine fusion protein, an adenine fusion protein, or a cytosine transversion fusion protein. Correspondingly, the base editing system is a cytosine base editing system, an adenine base editing system, or a CGBE base editing system. The deaminase fragment can be a cytosine deaminase or an adenine deaminase.
[0035] The cytosine deaminase is selected from one or more of the following: APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, activation-induced deaminase (AID), or pmCDA1.
[0036] The adenine deaminase is selected from wild-type tadA, mutant tadA, or a complex composed of both, wtTadA-TadA*. In certain preferred embodiments of the present invention, the adenine deaminase is wtTadA-TadA*.
[0037] In certain embodiments of the present invention, the Cas9 fragment and the deaminase fragment are linked by a linker peptide.
[0038] In certain embodiments of the present invention, the structure of the cytosine fusion protein is NH2-[nuclear localization signal]-[first nCas9 fragment]-[linker peptide]-[cytosine deaminase fragment]-[linker peptide]-[second nCas9 fragment]-[GS peptide segment]-[UGI peptide segment]-[UGI peptide segment]-[nuclear localization signal]-COOH; preferably, the amino acid sequence of the cytosine fusion protein is as shown in SEQ ID No.18.
[0039] In certain embodiments of the present invention, the structure of the adenine fusion protein is NH2-[nuclear localization signal]-[first nCas fragment]-[linker peptide]-[adenine deaminase fragment]-[linker peptide]-[second nCas9 fragment]-[GS peptide segment]-[nuclear localization signal]-COOH; preferably, the amino acid sequence of the adenine fusion protein is as shown in SEQ ID No.19.
[0040] In certain embodiments of the present invention, the cytosine transversion fusion protein sequentially includes a first Cas9 fragment, a chimeric insertion fragment, and a second nickase fragment from the N-terminus to the C-terminus, and the chimeric insertion fragment contains a deaminase fragment and a uracil DNA-binding protein fragment. Preferably, the amino acid sequence of the cytosine transversion fusion protein is as shown in SEQ ID No.20.
[0041] In certain embodiments of the present invention, variants of the fusion protein are fragments, derivatives, or analogs of the fusion protein, which may be (i) a protein in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a protein having a substituent group in one or more amino acid residues, or (iii) a protein formed by fusing an additional amino acid sequence to this protein sequence (such as a leader sequence or a secretion sequence or a sequence used to purify this protein or a proprotein sequence). According to the definition of the present invention, these fragments, derivatives, and analogs are within the scope well-known to those skilled in the art. In some embodiments, variants of the fusion protein refer to proteins having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the amino acid sequence of the fusion protein and having the same or similar function as the fusion protein. The above 75% or more identity can be 75%, 80%, 85%, 90%, or 95% or more identity; specifically, it can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%. The above 90% or more identity can be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity. The similar function means retaining 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher of the function of the original protein.
[0042] In certain embodiments of the present invention, the targeting sequence of the guiding nucleotide is a sequence within SEQ ID No.21 - SEQ ID No.62 that can utilize deaminase to form a stop codon and / or disrupt a start codon.
[0043] In the cytosine base editing system, the targeting sequence of the guide nucleotide is as shown in at least any one of SEQ ID NO.1-SEQ ID NO.10, SEQ ID NO.14, and SEQ ID NO.15. Preferably, the targeting sequence used is SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.14.
[0044] In the adenine base editing system, the targeting sequence of the guide nucleotide is as shown in SEQ ID NO.14, SEQ ID NO.15, and SEQ ID NO.16. Preferably, the targeting sequence used is SEQ ID NO.14, SEQ ID NO.16.
[0045] In the CGBE base editing system, the targeting sequence of the guide nucleotide is as shown in SEQ ID NO.11-SEQ ID NO.15. Preferably, the targeting sequence used is SEQ ID NO.12, SEQ ID NO.14.
[0046] In the method of the present invention, the mass ratio of the guide nucleotide sequence to the fusion protein is 1:(2-20); it can be 1:(2-4), 1:(2-6), 1:(2-8), 1:(2-10), 1:(2-12), 1:(2-14), 1:(2-16), 1:(2-18), 1:(2-20), (4-6), 1:(4-8), 1:(4-10), 1:(4-12), 1:(4-14), 1:(4-16), 1:(4-18), 1:(4-20), 1:(8-10), 1:(8-12), 1:(8-14), 1:(8-16), 1:(8-18), 1:(8-20), 1:(10-12), 1:(10-14), 1:(10-16), 1:(10-18), 1:(10-20), 1:(12-14), 1:(14-16), 1:(16-18), 1:(18-20); preferably, it is 1:(2-8).
[0047] In the method of the present invention, the VPF polynucleotide contacts (a) and (b) separately, or contacts the RNP complex formed by (a) and (b).
[0048] There is no particular limitation on the object of gene editing applicable to the method of the present invention, and it can be implemented in vitro or in vivo.
[0049] The steps of deaminating the target C base and / or target A base on the VPF polynucleotide using a base editing system are as follows: delivering an expression vector containing a polynucleotide encoding a fusion protein or a variant thereof and an expression vector containing a polynucleotide encoding a guide nucleotide into the object to be edited; preferably, delivering the expression vector into the object to be edited by one or more of liposome transfection, electroporation, viral transduction, microinjection, particle bombardment, gene gun transformation.
[0050] In some embodiments, the method is implemented in cultured cells, that is, the object to be edited is a cell, and the cell can be a somatic cell or a germ cell, and can be an animal cell or a human cell; further preferably, the cell is an RPE cell or a Muller cell.
[0051] In some embodiments, a gene delivery vehicle can be used to deliver the polynucleotides described herein to cells or tissues. As used herein, "gene delivery", "gene transfer", "transduction", etc. refer to the introduction of exogenous polynucleotides into host cells, such as vector-mediated gene transfer (by, for example, viral infection / transfection, or various other protein- or lipid-based gene delivery complexes) and techniques that assist in the delivery of "naked" polynucleotides (such as electroporation, "gene gun" delivery, and various other techniques for introducing polynucleotides). The introduced polynucleotides can be maintained stably or transiently in the host cell. Stable maintenance generally requires the introduced polynucleotide to contain an origin of replication compatible with the host cell or to be incorporated into the replicon of the host cell, such as an episomal replicon (e.g., plasmid) or a nuclear or mitochondrial chromosome. Many "vectors" are known to be capable of mediating the transfer of genes to mammalian cells, as known in the art and described herein.
[0052] The method described in the present invention is implemented in vivo and can act on somatic cells or germ cells. Preferably, the method is implemented in mammals; further preferably, the mammal is a rodent; more preferably, the mammal is a human. Further preferably, the method targets cells related to age-related macular degeneration disease in mammals.
[0053] The present invention also provides cells obtained by the method of editing the VPF gene.
[0054] The cells are somatic cells or germ cells. The cells are, for example, RPE cells or Muller cells.
[0055] The present invention also provides the use of the cells in the preparation of products for preventing or treating diseases related to VPF overexpression.
[0056] The VPF overexpression-related diseases are, for example, cancer or ophthalmic diseases. The cancer is, for example, lung cancer, thyroid cancer, breast cancer, hemangioma. The ophthalmic disease is, for example, macular degeneration. In one embodiment, the macular degeneration is age-related macular degeneration.
[0057] The present invention also provides a method for preventing or treating VPF overexpression-related diseases, the method comprising administering to a subject in need thereof a therapeutically effective amount of the base editing system or the cell as described in the above method.
[0058] The VPF overexpression-related diseases are, for example, cancer or ophthalmic diseases. The cancer is, for example, lung cancer, thyroid cancer, breast cancer, hemangioma. The ophthalmic disease is, for example, macular degeneration. In one embodiment, the macular degeneration is age-related macular degeneration.
[0059] In the present invention, the base editing system or the cell may also be used in combination with other drugs.
[0060] In the use provided by the present invention, the base editing system may be a single active ingredient or may be combined with other active components to form a combined preparation. The content of the active component in the composition is usually a safe and effective amount, and the safe and effective amount should be adjustable for those skilled in the art. For example, the dosage of the active ingredient usually depends on the weight of the patient, the type of application, the condition and severity of the disease.
[0061] The following specific examples illustrate the embodiments of the present invention, and those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0062] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for the purpose of describing specific embodiments, rather than limiting the protection scope of the present invention; in the specification and claims of the present invention, unless otherwise clearly indicated in the text, the singular forms "a", "an" and "the" include the plural forms.
[0063] When numerical ranges are given in the embodiments, it should be understood that unless otherwise specified in the present invention, both endpoints of each numerical range and any value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of this technology and the description of the present invention, any methods, devices, and materials of the prior art similar or equivalent to those described in the embodiments of the present invention can also be used to implement the present invention. Example 1: Base editing system mutates VPF to generate a stop codon
[0064] 1. sgRNA design and vector construction
[0065] When designing sgRNA for knocking out genes using base editing, multiple factors need to be considered: First, the nucleotides CAA, CAG, CGA, TGG, TCA, and TAC that can form a stop codon must be located in the same triplet codon; second, the edited base should be within the window of the editing system; third, the protospacer adjacent motif (PAM) recognized by the nuclease is different. Table 1 lists the sequences where stop codons or / and mutated start codons can be induced. Subsequent sgRNA designs are all obtained with reference to these 42 sequences. Only the nuclease targeting the PAM sequence of NGG is shown here ( Figure 1 shown). For the cytosine base editing system, there are a total of 10 target sites that can induce stop codons, and the corresponding sequence numbers are SEQ ID NO.1 - SEQ ID NO.10 respectively. For the CGBE system, there are a total of 3 target sites that can induce stop codons, and the corresponding sequences are named SEQ ID NO.11 - SEQ ID NO.13 respectively. The sgRNAs designed for knocking out VPF using different base editing systems are shown in Table 2.
[0066] Table 1 Sequences where stop codons or / and mutated start codons can be induced
[0067] Sequence positions of the inducible stop codon and the start codon (5′-3′) Final goal Sequence number <![CDATA[Tcgcactgaaacttttcgtc caa cttctgggctgttctcgctt*]]> Generate a stop codon SEQ ID NO.21 <![CDATA[ttatgcggatcaaacctcac caa ggccagcacataggagagat]]> Generate a stop codon SEQ ID NO.22 <![CDATA[caaagaaagatagagcaaga caa gaaaagtaagtggccctgac]]> Generate a stop codon SEQ ID NO.23 <![CDATA[ttcgaggaaagggaaagggg caa aaacgaaagcgcaagaaatc]]> Generate a stop codon SEQ ID NO.24 <![CDATA[ggagaaagcatttgtttgta caa gatccgcagacgtgtaaatg]]> Generate a stop codon SEQ ID NO.25 <![CDATA[cagtcgcgctgacggacaga cag acagacaccgcccccagccc]]> Generate a stop codon SEQ ID NO.26 <![CDATA[acgcggcggcgagccgcggg cag gggccggagcccgcgcccgg]]> Generate a stop codon SEQ ID NO.27 <![CDATA[gctcgggccgggaggagccg cag ccggaggagggggaggagga]]> Generate a stop codon SEQ ID NO.28 <![CDATA[aggaagaggagagggggccg cag tggcgactcggcgctcggaa]]> Generate a stop codon SEQ ID NO.29 <![CDATA[ctccagccgcgcgcgctccc cag gccctggcccgggcctcggg]]> Generate a stop codon SEQ ID NO.30 <![CDATA[ctttctgtcctcagtggtcc cag gctgcacccatggcagaagg]]> Generate a stop codon SEQ ID NO.31 <![CDATA[ccatggcagaaggaggaggg cag aatcatcacgaaggtgagtc]]> Generate a stop codon SEQ ID NO.32 <![CDATA[tgaagttcatggatgtctat cag cgcagctactgccatccaat]]> Generate a stop codon SEQ ID NO.33 <![CDATA[agaccctggtggacatcttc cag gagtaccctgatgagatcga]]> Generate a stop codon SEQ ID NO.34 <![CDATA[aggagtccaacatcaccatg cag gtgggcatctttgggaagtg]]> Generate a stop codon SEQ ID NO.35 <![CDATA[ggatcaaacctcaccaaggc cag cacataggagagatgagctt]]> Generate a stop codon SEQ ID NO.36 <![CDATA[taggagagatgagcttccta cag cacaacaaatgtgaatgcag]]> Generate a stop codon SEQ ID NO.37 <![CDATA[atttgtttgtacaagatccg cag acgtgtaaatgttcctgcaa]]> Generate a stop codon SEQ ID NO.38 <![CDATA[actcgcgttgcaaggcgagg cag cttgagttaaacgaacgtac]]> Generate a stop codon SEQ ID NO.39 <![CDATA[aggagagggggccgcagtgg cga ctcggcgctcggaagccggg]]> Generate a stop codon SEQ ID NO.40 <![CDATA[ggggaggaagagtagctcgc cga ggcgccgaggagagcgggcc]]> Generate a stop codon SEQ ID NO.41 <![CDATA[catcctgtgtgcccctgatg cga tgcgggggctgctgcaatga]]> Generate a stop codon SEQ ID NO.42 <![CDATA[gacaagaaaaaaaatcagtt cga ggaaagggaaaggggcaaaa]]> Generate a stop codon SEQ ID NO.43 <![CDATA[gaaagggaaaggggcaaaaa cga aagcgcaagaaatcccggta]]> Generate a stop codon SEQ ID NO.44 <![CDATA[aagaggagagggggccgcag tgg cgactcggcgctcggaagcc]]> Generate a stop codon SEQ ID NO.45 <![CDATA[gcgctcggaagccgggctca tgg acgggtgaggcggcggtgtg]]> Generate a stop codon SEQ ID NO.46 <![CDATA[ccatgaactttctgctgtct tgg gtgcattggagccttgcctt]]> Generate a stop codon SEQ ID NO.47 <![CDATA[ttctgctgtcttgggtgcat tgg agccttgccttgctgctcta]]> Generate a stop codon SEQ ID NO.48 <![CDATA[tgctctctttctgtcctcag tgg tcccaggctgcacccatggc]]> Generate a stop codon SEQ ID NO.49 <![CDATA[agaaatcccggtataagtcc tgg agcgtgtacgttggtgcccg]]> Generate a stop codon SEQ ID NO.50 <![CDATA[cccgctgctgtctaatgccc tgg agcctccctggcccccagta]]> Generate a stop codon SEQ ID NO.51 <![CDATA[tcggcgctcggaagccgggc tca tggacgggtgaggcggcggt]]> Generate a stop codon SEQ ID NO.52 <![CDATA[tttttttattttccagaaaa tca gttcgaggaaagggaaaggg]]> Generate a stop codon SEQ ID NO.53 <![CDATA[gcagtccctgtgggccttgc tca gagcggagaaagcatttgtt]]> Generate a stop codon SEQ ID NO.54 <![CDATA[acaccgcccccagccccagc tac cacctcctccccggccggcg]]> Generate a stop codon SEQ ID NO.55 <![CDATA[ggagccttgccttgctgctc tac ctccaccatgccaaggtaag]]> Generate a stop codon SEQ ID NO.56 <![CDATA[tggatgtctatcagcgcagc tac tgccatccaatcgagaccct]]> Generate a stop codon SEQ ID NO.57 <![CDATA[tggtggacatcttccaggag tac cctgatgagatcgagtacat]]> Generate a stop codon SEQ ID NO.58 <![CDATA[agtaccctgatgagatcgag tac atcttcaagccatcctgtgt]]> Generate a stop codon SEQ ID NO.59 <![CDATA[Ggtataagtcctggagcgtg tac gttggtgcccgctgctgtct]]> Generate a stop codon SEQ ID NO.60 <![CDATA[Cccgcagctgaccagtcgcg ctg acggacagacagacagacac]]> Disrupt the start codon SEQ ID NO.61 <![CDATA[ccggtcgggcctccgaaacc atg aactttctgctgtcttgggt]]> Disrupt the start codon SEQ ID NO.62
[0068] Note: The underlines in Table 1 represent the triplet codons or start codons that can form stop codons
[0069] Table 2 sgRNAs designed for knocking out the VPF gene using different base editing systems
[0070]
[0071] Synthesize the corresponding oligo sequences for the designed target sites. The upstream and downstream sequences are annealed by a program (95°C, 5 min; 95°C - 85°C at -2°C / s; 85°C - 25°C at -0.1°C / s; hold at 4°C) and ligated to the PGL3-U6-sgRNA-GFP vector linearized by BsaI (NEB: R0539L). The ligation system is as follows: 1 μL of T4 ligation buffer (NEB: M0202L), 20 ng of linearized vector, 5 μL of annealed oligo fragment (10 μM), 0.5 μL of T4 ligase (NEB: M0202L), and ddH2O is added to make up to 10 μL. Ligate overnight at 16°C. The ligated vector is transformed, colonies are picked, and identified. The identification primers are: for the U6 vector, the upstream sequence is 5’-TTTCCCATGATTCCTTCATA-3’ (SEQ ID NO.17), and the downstream sequence is the downstream sequence of the corresponding oligo. Shake the positive clones to extract plasmids (Axygene: AP-MN-P-250G) and measure the concentration for standby.
[0072] 2. Culture and transfection of RPE cell line or Muller cell line
[0073] Commercially available RPE cells (ARPE-19) and Muller cells (MIO-M1) are inoculated and cultured in high-glucose DMEM medium supplemented with 10% FBS (HyClone, SH30022.01B), which contains penicillin (100 U / ml) and streptomycin (100 μg / ml). Before transfection, they are sub-cultured into 6-well plates and transfected when the density reaches 70% - 80%. Two hours before transfection, change to an antibiotic-free medium. Taking liposome transfection as an example, according to Lipofectamine TMOperation manual of 2000 Transfection Reagent (Invitrogen, 11668-019). Mix 2 μg of base editing plasmid (i.e., cytosine fusion plasmid or CGBE fusion plasmid) with 1 μg of pGL3-U6-sgRNA-GFP plasmid and co-transfect into each well of cells. Replace the medium 6-8 hours later and perform flow sorting of positive cells 72 hours later. Select two of each type of base editor. One is the conventionally designed cytosine fusion plasmid A3A-BE4max (addgene: #157943) and the conventionally designed CGBE fusion plasmid CGBE-A3A (sequence refers to SEQ ID NO.18 in the patent with application number 202210415558.0); the other option is to significantly reduce off-target. The editor with the deaminase chimerized into the middle position of Cas9. The cytosine fusion plasmid is: CE-A3A-BE4max (amino acid sequence as shown in SEQ ID No.18), and the CGBE fusion plasmid CE-CGBE-A3A (amino acid sequence as shown in SEQ ID NO.20).
[0074] 3. Determination of editing efficiency
[0075] Identify the genotype of the collected cells by lysis. The components of the lysis buffer are 50 mM KCl, 1.5 mM MgCl2, 10 mM Tris pH 8.0, 0.5% Nonidet P-40, 0.5% Tween 20, 100 μg / ml protease K. After PCR amplification of the fragment containing the target site, perform deep sequencing.
[0076] Through the analysis of sequencing data, it was found that for 13 sites that can induce stop codons in the RPE cell line, both types of cytosine base editors can effectively achieve editing. At the same time, it was found that the editing efficiency of 5 sites, namely VPF_1, VPF_3, VPF_7, VPF_10, and VPF_12, reached more than 50% ( Figure 2 as shown).
[0077] In the Muller cell line, for 13 sites that can induce stop codons, both types of cytosine base editors can also effectively achieve editing. Compared with the RPE cell line, the editing efficiency in the Muller cell line is reduced, and the efficiency of the same 5 sites, namely VPF_1, VPF_3, VPF_7, VPF_10, and VPF_12, is also relatively high.
[0078] Example 2: Base editing system mutates VPF to disrupt the start codon
[0079] 1. sgRNA design and vector construction
[0080] The start codon position is fixed, and the number of designed sgRNAs is limited. Among them, the sgRNA names VPF_14 and VPF_15 are suitable for cytosine base editing system, adenine base editing system, and CGBE base editing system, and the corresponding sequences are SEQ ID NO.14 - SEQ ID NO.15. VPF_16 is only suitable for the adenine base editing system, and the sequence is SEQ ID NO.16. The schematic diagram of knocking out the VPFA gene by different editing systems is as Figure 1 shown.
[0081] Synthesize the corresponding oligo sequences for the designed target sites. The upstream and downstream sequences are annealed by a program (95°C, 5 min; 95°C - 85°C at -2°C / s; 85°C - 25°C at -0.1°C / s; hold at 4°C), and then ligated to the PGL3-U6-sgRN-GFP vector linearized by BsaI (NEB: R0539L). The ligation system is as follows: 1 μL of T4 ligation buffer (NEB: M0202L), 20 ng of linearized vector, 5 μL of annealed oligo fragment (10 μM), 0.5 μL of T4 ligase (NEB: M0202L), and supplemented with ddH2O to 10 μL. Ligate overnight at 16°C. The ligated vector is transformed, bacteria are picked, and identified. The identification primers are: for the U6 vector, the upstream sequence is 5’-TTTCCCATGATTCCTTCATA-3’ (SEQ ID NO.17), and the downstream sequence is the downstream sequence of the corresponding oligo. Shake the positive clones to extract plasmids (Axygene: AP-MN-P-250G) and measure the concentration for standby.
[0082] 2. Culture and transfection of RPE cell line or Muller cell line
[0083] Commercial RPE cells (ARPE-19) and Muller cells (MIO-M1) are inoculated and cultured in DMEM high-glucose culture medium supplemented with 10% FBS (HyClone, SH30022.01B), which contains penicillin (100 U / ml) and streptomycin (100 μg / ml). Before transfection, they are sub-cultured into 6-well plates and transfected when the density reaches 70% - 80%. Two hours before transfection, change to antibiotic-free medium. Taking liposome transfection as an example. According to Lipofectamine TMOperation manual of 2000 Transfection Reagent (Invitrogen, 11668 - 019). Mix 2 μg of base editing protein plasmid (i.e., cytosine fusion protein plasmid, adenine fusion protein plasmid, or CGBE fusion protein plasmid) with 1 μg of pGL3 - U6 - sgRNA - GFP plasmid, and co - transfect into each well of cells. Replace the medium 6 - 8 hours later, and sort positive cells by flow cytometry 72 hours later. For each type of base editor, select one conventionally designed and one that can significantly reduce off - target. The three conventionally designed ones are: A3A - BE4max (addgene: #157943), ABEmax (addgene: #164415), CGBE - A3A (sequence refers to SEQ ID NO.18 in the patent with application number 202210415558.0). Another type that can significantly reduce off - target, the editor with the deaminase embedded in the middle position of Cas9, are: CE - A3A - BE4max (amino acid sequence as SEQ ID NO.18), CE - ABE (amino acid sequence as SEQ ID NO.19), CE - CGBE - A3A (amino acid sequence as SEQ ID NO.20).
[0084] 3. Determination of editing efficiency
[0085] Lyse the collected cells to identify genotypes. The components of the lysis buffer are 50 mM KCl, 1.5 mM MgCl2, 10 mM Tris pH 8.0, 0.5% Nonidet P - 40, 0.5% Tween 20, 100 μg / ml protease K. PCR amplify the fragment containing the target site and send it for deep sequencing.
[0086] Through the analysis of sequencing data, it is found that in the RPE cell line, for the sites VPF_14 and VPF_15 that can be targeted by all 3 base editing systems, effective editing can be achieved, and the editing efficiency of the VPF_14 site is higher than that of VPF_15 ( Figure 4 as shown). For the VPF_16 site, both types of adenine base editors can achieve efficient editing ( Figure 5 as shown).
[0087] In the Muller cell line, for the sites VPF_14 and VPF_15 that can be targeted by all 3 systems, effective editing can be achieved, and the editing efficiency of the VPF_14 site is higher than that of VPF_15 ( Figure 6 as shown). For the VPF_16 site, both types of adenine base editors can achieve efficient editing ( Figure 7 as shown).
[0088] Example 3: Detection of the expression level of VPF after mutation by enzyme-linked immunosorbent assay
[0089] 1. Screening of monoclonal cells
[0090] As described in Examples 1 and 2, the transfected RPE cells were sorted for positive cells by flow cytometry, and single cells were seeded into 96-well plates. After two weeks, some cells were taken for genotype identification by lysis. The composition of the lysis buffer was 50 mM KCl, 1.5 mM MgCl2, 10 mM Tris pH 8.0, 0.5% Nonidet P-40, 0.5% Tween 20, and 100 μg / ml protease K. The homozygous mutant cell lines were selected for expansion culture. For the sites that induced stop codons, two sites, VPF_7 and VPF_12, were selected. For the mutant start codon, the VPF_16 site was selected.
[0091] 2. Detection of VPF expression by enzyme-linked immunosorbent assay
[0092] The selected homozygous knockout RPE cell lines were expanded in culture. The expression of VPF was detected by enzyme-linked immunosorbent assay (ELISA). The brief steps are as follows: Remove the strips required for the experiment from the sealed bag that has been equilibrated to room temperature. Put the unused strips and desiccant back into the aluminum foil bag, press the self-sealing strip, seal the bag, and return it to 4°C. Add the standard & specimen universal diluent to the blank wells, and add the specimens or different concentrations of standards (100 μl / well) to the remaining corresponding wells. Seal the reaction wells with sealing tape, incubate in a 37°C incubator in the dark for 90 minutes. Prepare the biotinylated antibody working solution 20 minutes in advance. Wash the plate 5 times. Add the biotinylated antibody diluent to the blank wells, and add the biotinylated antibody working solution (100 μl / well) to the remaining wells. Seal the reaction wells with new sealing tape, incubate in a 37°C incubator in the dark for 60 minutes. Prepare the enzyme conjugate working solution 20 minutes in advance. Place it at room temperature (22 - 25°C) in the dark. Wash the plate 5 times. Add the enzyme conjugate diluent to the blank wells, and add the enzyme conjugate working solution (100 μl / well) to the remaining wells. Seal the reaction wells with new sealing tape, incubate in a 37°C incubator in the dark for 30 minutes. Turn on the power of the microplate reader, preheat the instrument, and set up the detection program. Wash the plate 5 times. Add 100 μl / well of the chromogenic substrate (TMB), incubate in a 37°C incubator in the dark for 15 minutes. Add 100 μl / well of the reaction termination solution, mix well, and immediately measure the OD450 value (within 3 minutes). Save the reading results in the instrument and print a paper copy of the results. After the experiment, return the unused reagents to the refrigerator at the specified storage temperature until the expiration date. It is recommended to save the microplate frame for future use.
[0093] Through data analysis, it was found that VPF protein knockout was achieved in different types of base-edited cell lines ( Figure 8 as shown).
[0094] Example 4: Safety Analysis of Base Editing of VPF Gene
[0095] For the cell line obtained in Example 3, the genomic DNA of the homozygous mutant cell line was extracted using the Tiangen Blood / Cell / Tissue Genomic DNA Extraction Kit (DP304) and sent to Beijing Annoroad for whole-genome sequencing with a sequencing depth of 25 - 30x. The raw sequencing data was aligned to the human reference genome (GRCh38 / hg38) using BWA v0.7.16. SNP sites were analyzed using the GATK HaplotypeCaller software.
[0096] Through the analysis of the sequencing data, it was found that the SNPs generated using chimeric cytosine base editors (CE-A3A-BE4max, CE-CGBE-A3A) were close to those of the wild type and far lower than those of conventional base editors (A3A-BE4max, CGBE-A3A). This indicates that the use of chimeric editors has greater value for subsequent clinical applications. For adenine base editors, the number of SNPs generated by both types of editors was much lower than that of cytosine base editors, which is related to the less off-target effect of adenine base editors at the DNA level ( Figure 9 as shown).
[0097] In summary, it can be seen that: the method described in the present invention uses a guide nucleotide (sgRNA) and a base editing protein, and the sgRNA / BE protein complex (RNP) is introduced into the RPE cell line or Muller cell line by liposome transfection or electroporation transfection, which can efficiently knockout the VPF gene. At the same time, no obvious off-target was detected at the DNA and RNA levels using chimeric base editors, and the purpose of knockout can be achieved more safely. Therefore, the use of base editing technology to knockout the VPF gene described in the present invention, combined with methods such as viral vectors and injection, will provide a safe and effective treatment means for AMD diseases or is expected to be developed into a safe and effective anti-tumor biological agent, with obvious application prospects and clinical application value.
[0098] The above examples are intended to illustrate the embodiments disclosed in the present invention and should not be construed as limitations on the present invention. In addition, various modifications listed herein and changes in the methods of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.
Claims
1. A method for editing the VPF gene, the method being implemented in vitro, characterized in that, The method includes deaminating a target C base and / or a target A base on a VPF polynucleotide by using a base editing system to introduce a stop codon or a point mutation start codon into the VPF gene coding region; the base editing system includes: (a) A fusion protein or its coding polynucleotide, wherein the fusion protein includes a Cas9 fragment and a deaminase fragment; (b) A guide nucleotide or its coding polynucleotide that targets the fusion protein or its variant in (a) to the target C base and / or the target A base, and the sequence of the guide nucleotide is selected from SEQ ID No.1, SEQ ID No.3, SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.12 or SEQ ID NO.
14.
2. The method according to claim 1, wherein The introduced stop codon is TAA, TAG or TGA; and / or, the start codon is ATG or CTG.
3. The method according to claim 1, characterized in that The fusion protein is selected from one or more of a cytosine fusion protein, an adenine fusion protein or a cytosine transversion fusion protein; the corresponding base editing system for each fusion protein is a cytosine base editing system, an adenine base editing system, or a CGBE base editing system.
4. The method according to claim 1, wherein The deaminase fragment is a cytosine deaminase or an adenine deaminase.
5. The method according to claim 4, wherein The cytosine deaminase is selected from one or more of the following: APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, activation-induced deaminase or pmCDA1; and / or, the adenine deaminase is selected from wild-type tadA, mutant tadA, or a complex wtTadA–TadA composed of both.
6. The method according to claim 1, characterized in that, The Cas9 fragment and the deaminase fragment are linked by a linker peptide.
7. The method according to claim 3, characterized in that, It also includes any one or more of the following: 1) The structure of the cytosine fusion protein is NH2-[nuclear localization signal]-[first nCas9 fragment]-[linker peptide]-[cytosine deaminase fragment]-[linker peptide]-[second nCas9 fragment]-[GS peptide segment]-[UGI peptide segment]-[UGI peptide segment]-[nuclear localization signal]-COOH; 2) The structure of the adenine fusion protein is NH2-[nuclear localization signal]-[first nCas fragment]-[linker peptide]-[adenine deaminase fragment]-[linker peptide]-[second nCas9 fragment]-[GS peptide segment]-[nuclear localization signal]-COOH; 3) The cytosine transversion fusion protein sequentially includes a first Cas9 fragment, a chimeric insertion fragment, and a second nickase fragment from the N-terminus to the C-terminus, and the chimeric insertion fragment contains a deaminase fragment and a uracil DNA binding protein fragment.
8. The method according to claim 3, wherein It also includes any one or more of the following: 1) The amino acid sequence of the cytosine fusion protein is as shown in SEQ ID No.18; 2) The amino acid sequence of the adenine fusion protein is as shown in SEQ ID No.19; 3) The amino acid sequence of the cytosine transversion fusion protein is as shown in SEQ ID No.
20.
9. The method according to claim 3, wherein It further includes any one or more of the following: 1) In the cytosine base editing system, the guide nucleotide sequence is as shown in at least any one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.14; 2) In the adenine base editing system, the guide nucleotide sequence is as shown in SEQ ID NO.14; 3) In the CGBE base editing system, the sequence of the guide nucleotide is as shown in SEQ ID NO.
12.
10. The method according to claim 1, characterized in that, The step of deaminating the target C base and / or target A base on the VPF polynucleotide using the base editing system is: delivering an expression vector containing a polynucleotide encoding a fusion protein and an expression vector containing a polynucleotide encoding a guide nucleotide into the object to be edited.
11. The method according to claim 10, characterized in that, The expression vector is delivered into the object to be edited by one or more methods of liposome transfection, electroporation, virus transduction, microinjection, particle bombardment, gene gun transformation.
12. The method according to claim 10, characterized in that, The object to be edited is cultured cells.
13. The method according to claim 12, wherein The cells are RPE cells or Muller cells.
14. Cells obtained by the method for editing the VPF gene according to any one of claims 1-13.
15. Use of the base editing system according to claim 1 in the preparation of products for treating diseases related to VPF overexpression, wherein the diseases related to VPF overexpression are cancer or ophthalmic diseases, the cancer is lung cancer, thyroid cancer, breast cancer, hemangioma, and the ophthalmic disease is macular degeneration.
16. The use according to claim 15, characterized in that, The macular degeneration is age-related macular degeneration.
Citation Information
Patent Citations
Gene knockout method based on base editing and application thereof
CN107164377A
Method for realizing gene knockout based on base editing system mutation initiation codon and application thereof
CN109706185A
Base editing tool and use thereof
CN111172133A
GRNA for targeted editing of VEGFA gene exon region and application thereof
CN112662674A
Editing system and method for efficiently and specifically realizing base transversion and application
CN114835821A