A Simple Multiplex KASP Genotyping Method Based on SNP Loci and Its Application

By using a simple multiplex KASP genotyping method with conventional PCR instruments and agarose gel electrophoresis, the problem of KASP markers relying on expensive instruments and sequencing is solved, achieving high-throughput, low-cost genotyping that is suitable for small laboratory applications.

CN115820916BActive Publication Date: 2026-04-03GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-30
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing KASP marker methods rely on expensive fluorescent PCR instruments and sequencing technology, which limits their use in small laboratories and are complex to operate, making it difficult to achieve high-throughput genotyping.

Method used

A simple multiplex KASP genotyping method was adopted, using a conventional PCR instrument and agarose gel electrophoresis. Specific primer pairs were designed for multiplex PCR amplification, and agarose gel electrophoresis was used for genotyping to achieve high-throughput genotyping of individuals.

Benefits of technology

It reduces experimental costs, simplifies operating procedures, is suitable for small laboratories, enables simultaneous genotyping of multiple gene loci, and does not rely on expensive instruments and sequencing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003972859020000061
    Figure BDA0003972859020000061
  • Figure BDA0003972859020000062
    Figure BDA0003972859020000062
  • Figure BDA0003972859020000071
    Figure BDA0003972859020000071
Patent Text Reader

Abstract

This invention relates to the field of biotechnology, and particularly to a simple multiplex KASP genotyping method based on SNP loci. The method includes: designing two upstream primers based on the SNP locus Nk, and simultaneously designing a universal reverse primer downstream of each SNP locus Nk; preparing multiplex primer reaction systems X1 and X2 for parents P1 and P2 respectively; and finally preparing PCR reaction systems using X1 and X2 with templates from P1, P2, and progeny individuals; performing multiplex PCR verification using parents P1 and P2, and 10-20 progeny individuals derived from P1 and P2; and genotyping the progeny individuals obtained from hybridization of parents P1 and P2 using X1 and X2. This simple multiplex KASP genotyping method requires minimal equipment, eliminates the need for sequencing, and can be differentiated using ordinary agarose gel electrophoresis. It allows for simultaneous genotyping of multiple gene loci in a single step, and is cost-effective.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to a simple multiplex KASP genotyping method based on SNP sites and its application. Background Technology

[0002] With the development of sequencing technology, the cost of sequencing has decreased significantly. Sequencing can obtain a large number of single nucleotide polymorphism (SNP) sites and insertion-deletion (InDel) sites. SNP / InDel-based molecular markers offer a much higher quantity and density than conventional molecular markers such as SSRs, providing breeders with the possibility of developing molecular markers tightly linked to target traits and finely mapping target genes. However, common CAPS markers rely on enzyme digestion, and due to limitations in the digestion sites, dCAPS requires polyacrylamide gel genotyping. KASP can achieve high-throughput genotyping, but the required fluorescent primers are expensive to synthesize, and analysis requires specialized fluorescent PCR instruments, limiting its use by researchers with limited laboratory resources. Sequencing-based multiplex PCR technology allows for high-throughput SNP genotyping of multiple markers simultaneously, but it still requires sequencing. This study aims to combine the advantages of KASP markers and multiplex PCR technology to develop a simple multiplex KASP molecular marker: Multiplex Simple Kompetitive Allele Specific PCR (MSKASP). This method does not rely on expensive instruments or sequencing; it only requires a common PCR instrument and agarose gel electrophoresis to achieve individual genotyping. It is not only cost-effective but also simple and convenient to operate, making it more suitable for small laboratories, while also achieving high throughput. Summary of the Invention

[0003] The purpose of this invention is to provide a simple multiplex KASP genotyping method and its application based on SNP sites. This method does not require expensive instruments or sequencing; it only requires a common PCR instrument and agarose gel electrophoresis to achieve the purpose of individual genotyping.

[0004] To achieve the above objectives, this invention provides a simple multiplex KASP genotyping method based on SNP sites, comprising the following steps:

[0005] (1) Design upstream primers based on different SNP sites Nk. Design two upstream primers for each site. The end of one primer sequence is the same as the sequence of the dominant parent P1 site, denoted as PrimerNkF1; the end of the other primer sequence is the same as the sequence of the recessive parent P2 site, denoted as PrimerNkF2. At the same time, design a universal reverse primer downstream of each SNP site Nk, denoted as PrimerNkR. Primer pair PrimerNkF1 and PrimerNkR are used as primers to mark the genotype of the Nkth SNP site of parent P1, denoted as PriNkP1; Primer pair PrimerNkF2 and PrimerNkR are used as primers to mark the genotype of the Nkth SNP site of parent P2, denoted as PriNkP2.

[0006] (2) The primers designed in step (1) were verified using templates from the two parents, P1 and P2, and the F1 generation of the two parents.

[0007] (3) Multiplex PCR verification was performed using parents P1 and P2, and 10-20 offspring individuals derived from P1 and P2 (the SNP locus genotype of each offspring individual has been determined): Multiplex primer reaction systems of parental types P1 and P2 were prepared separately. A multiplex PCR amplification system X1 of type P1 was prepared using primer pairs of parental type P1; a multiplex primer reaction system X2 of type P2 was prepared using primer pairs of parental type P2; X1 and X2 were finally prepared into PCR reaction systems with templates of P1, P2 and offspring individuals.

[0008] (4) Perform electrophoresis on the reaction system amplified in step (3) using 1% agarose gel. If the following conditions are met, it can be further used for the identification of the genotypes of the offspring of P1 and P2: The genotyping result of the multiplex system X1 is i clearly visible bands when genotyping P1, and the fragment size corresponds one-to-one with the result of each primer when testing P1. No bands are found when genotyping P2, and the genotyping results of F1 are consistent with those of P1. The genotyping result of the multiplex system X2 is i clearly visible bands when genotyping P2, and the fragment size corresponds one-to-one with the result of each primer when testing P2. No bands are found when genotyping P1, and the genotyping results of F1 are consistent with those of P2.

[0009] (5) Genotyping of the offspring individuals obtained by crossing parents P1 and P2 using X1 and X2 was performed. A PCR reaction system was prepared using X1 and X2 as templates for the offspring individuals obtained by crossing parents P1 and P2, and electrophoresis was performed using 1% agarose gel for genotyping. The determination criteria were as follows:

[0010] If the X1 genotype has a band and the X2 genotype does not have a band, then the individual has the P1 genotype.

[0011] If the X1 genotype has no band and the X2 genotype has a band, then the individual has the P2 genotype.

[0012] If there is a band in both the X1 and X2 gene types, then the individual is a heterozygous genotype.

[0013] Specifically, the genotype of each individual at locus i can be represented as xy, where x represents the genotype of the X1 genotype, with a value of 0 or 1, where 0 represents no band and 1 represents a band; y represents the genotype of the X2 genotype, with a value of 0 or 1, where 0 represents no band and 1 represents a band. The genotyping results 10, 01, and 11 represent individuals with the P1 genotype, individuals with the P2 genotype, and individuals with the heterozygous genotype, respectively, and the genotypes are represented as 2, 0, and 1.

[0014] Preferably, in the above simple multiplex KASP genotyping method, the primer design in step (1) satisfies the following conditions:

[0015] A1. The annealing temperature of each primer differs by ±2℃;

[0016] A2. The target fragments amplified by N1-Nk markers are of different sizes, so that they can be easily distinguished by agarose gel electrophoresis;

[0017] A3. There are no structures between primer sequences that easily form primer dimers.

[0018] Preferably, in the above simple multiplex KASP genotyping method, in step (2), the primers are verified to: have no non-specific amplification for each primer pair and amplify clearly; the PriNkP1 primer amplifies the parental P1 template and produces a band, while the amplified parental P2 primer does not produce a band; the PriNkP2 primer amplifies the parental P2 template and produces a band, while the amplified parental P1 template does not produce a band; both PriNkP1 and PriNkP2 primers amplify the F1 template and produce a band.

[0019] Preferably, in the above simple multiplex KASP genotyping method, in step (3), when preparing the PCR reaction system, i pairs of primers can be added in an amount of i / 1ul to mix (25ul reaction system). If the amplification effect is not good, the primer concentration and other reaction system conditions can be adjusted. The fragments amplified by each pair of primers used for mixing are of different sizes and can be easily distinguished by agarose gel electrophoresis.

[0020] The above-mentioned simple multiplex KASP genotyping method is applied in crop breeding.

[0021] Preferably, in the above application, the DNA template extracted from plant seeds with high protein content is genotyped according to the simple multiplex KASP genotyping method based on SNP sites. Before sowing, the genotype of each seed is used to select seeds that meet the requirements for planting.

[0022] This invention also provides a method for typing the soybean yellow leaf gene, which employs the aforementioned simple multiplex KASP gene typing method. Specifically, it includes: using two sets of primers to perform multiplex PCR amplification on the soybean DNA template to be tested; and performing electrophoresis typing on the completed reaction system using 1% agarose gel. The two primer pairs are: Primer N2YL, with the upstream primer having the nucleotide sequence SEQ ID NO:1: CGGAGAGGAGATAATGGTAAC and the downstream primer having the nucleotide sequence SEQ ID NO:2: TTGATCCAAGCACGCAATA; and Primer N2GC8, with the upstream primer having the nucleotide sequence SEQ ID NO:3: CGGAGAGGAGATAATGGTAAG and the downstream primer having the nucleotide sequence SEQ ID NO:2: TTGATCCAAGCACGCAATA.

[0023] Preferably, in the above-mentioned genotyping method for soybean yellow leaf genes, the evaluation criteria are as follows:

[0024] If the primer pair PrimerN2YL corresponds to a band in the genotype, and the primer pair PrimerN2GC8 corresponds to a band in the genotype, then the soybean yellow leaf gene is a recessive yellow leaf trait.

[0025] If the primer pair PrimerN2YL has no corresponding band in the genotype, and the primer pair PrimerN2GC8 has a corresponding band in the genotype, then the soybean yellow leaf gene is a dominant homozygous trait.

[0026] If the primer pair PrimerN2YL has a corresponding genotype band and the primer pair PrimerN2GC8 has a corresponding genotype band, then the soybean yellow leaf gene is a dominant heterozygous trait.

[0027] Compared with existing technologies, the present invention has the following advantages:

[0028] 1. The simple multiplex KASP genotyping method of the present invention does not have high requirements for instruments. Ordinary PCR instruments can meet the requirements, and banding can be distinguished by ordinary agarose gel electrophoresis. It is not only low in cost, but also uses low-toxicity chemicals in the experimental process, which reduces pollution to human body and environment.

[0029] 2. The simple multiplex KASP genotyping method of the present invention inherits the advantages of multiplex PCR, but eliminates the sequencing step, and can achieve the purpose of genotyping multiple gene loci at the same time; it is easier to read band patterns than SSR markers, and the presence of a band at the target site is recorded as 1, and the absence of a band is recorded as 0.

[0030] 3. The simple multiplex KASP genotyping method of the present invention has lower requirements for template quality than KASP. It can quickly genotype DNA templates extracted from seeds of plants with high protein content, such as soybeans. The genotype of each seed can be determined before sowing, and seeds that meet the requirements can be selected for planting. This not only saves land and reduces costs, but can also be used for rapid identification of false hybrids. Attached Figure Description

[0031] Figure 1 This is a Manhattan plot showing the location of QTLs for yellow soybean leaves in Example 1 of the present invention.

[0032] Figure 2 This shows the physical location of the soybean yellow leaf gene in Example 1 of the present invention.

[0033] Figure 3 This is an agarose gel electrophoresis image of the two parents YL and GC8 and their F1 generation, obtained by different mixing ratios of PrimerN1 and PrimerN2 in Example 1 of the present invention.

[0034] Figure 4 This is an agarose gel electrophoresis image of the two parents YL and GC8 and their F1 generation genotypes using the two primer pairs PrimerN1 and PrimerN2 in Example 1 of this invention.

[0035] Figure 5 This is an agarose gel electrophoresis image of 10 recombinant monoclonal samples genotyped using PrimerN1 and PrimerN2 in Example 1 of this invention. The materials corresponding to lanes 1-14 are: 22SummerGL8, 22SummerGL9, 22SpringP24-1, 22SpringP24-2, 22SpringP25-9, 22SpringP34-23, 22SpringP45-1, 22SpringP64-8, 22SpringP24-10, 22SpringP61-21, YL, GC8, and F1. Detailed Implementation

[0036] The specific embodiments of the present invention will be described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments.

[0037] Example 1

[0038] A cross was conducted using the normal-leaved soybean variety Guichun 8 GC8 as the female parent and the yellow-leaved variety YL as the male parent. The resulting F1 generation exhibited normal leaves, while the F2 generation showed segregation between yellow and normal leaves. Chi-square analysis showed a 3:1 segregation ratio between normal and yellow leaves, suggesting that the yellow leaf mutation is a recessive single-gene mutation. Sequencing libraries were constructed using 30 normal-leaved and 30 yellow-leaved individual plants from the F2 generation, and BSA sequencing was performed. The sequencing depth for both parents was 10×, and the sequencing depth for the two pooled sequencing was 30×. Both SNP-index and ED calculation methods located the gene yl controlling yellow leaves at the start of chromosome 11 (see [link to SNP-index calculation]). Figure 1 Combining the two methods, the physical location of yl is: 115027bp-1738746bp.

[0039] Eight KASP markers were designed between 0.10M and 3.03M on chromosome 11, seven of which were suitable for normal genotyping. These seven KASP markers were used to genotype 261 F2 individuals. Local linkage maps were constructed using Jionmap4, and the yellow leaf gene was located using MapQTL6. Combined with recombinant individual screening, yl was located within 0.5M between Chr11_208853 and Chr11_703984 on chromosome 11 (see...). Figure 2 ).

[0040] To further narrow down the region, two MSKASP molecular markers, PrimerN1 and PrimerN2, were developed at positions 282597 bp and 425097 bp within this region. Detailed information on the two markers is shown in Table 1. The designed primers were validated using DNA templates from the two parents, P1 and P2, and the F1 generation of both parents. Through preliminary experiments, the optimal mixing ratio of PrimerN1 and PrimerN2 markers was determined to be 2:1. Electrophoretic typing images of different ratios are shown in [Table 1]. Figure 3 The 25µl PCR amplification system used in this example consisted of: 12.5µl of Kangwei Century 2×Es Taq MasterMix (Dye), 1µl of Forward Primer, 1µl of Reverse Primer, 1µl of DNA template, and 9.5µl of ddH2O. The PCR amplification program was as follows: pre-denaturation temperature 94℃, time 2 min; denaturation temperature 94℃, time 30 s; annealing temperature 60℃, 30 s; extension temperature 72℃, 30 s; final extension temperature 72℃, 2 min. A total of 38 cycles of denaturation-annealing-extension were performed. The DNA template was soybean seed DNA extracted using the CTAB method.

[0041] Table 1. Detailed information on the two markers, PrimerN1 and PrimerN2.

[0042]

[0043] Genotyping was performed on the first generation F1 offspring of YL, GC8, and GC8 (maternal) and YL (paternal) hybrids using PrimerN1 and PrimerN2. The results are as follows: Figure 4 As shown in Table 2, the results indicate that both markers of the YL type showed bands in both YL and F1, but not in GC8, while both primers of the GC8 type showed bands in both GC8 and F1, but not in YL. This suggests that the typing results are good and can be used for genotyping identification of other individuals.

[0044] Table 2: Genotyping results of the two primer pairs for the two parents YL and GC8 and their F1 generations.

[0045]

[0046] Genotyping was performed on 10 screened recombinant single plants using PrimerN1 and PrimerN2 primers. Figure 5 As can be seen, the genotyping results are good. The banding data is converted into genotype data as shown in Table 3. The genotyping results of the PrimerN2 primer pair are completely consistent with the phenotype. Based on the marker results at 0.2M and 0.7M and the phenotypic identification results of each recombinant single plant, the yl gene can be further narrowed down to the range of approximately 0.28M between 0.42M and 0.7M.

[0047] Table 3 shows the genotyping results of 10 recombinant single plants using PrimerN1 and PrimerN2 primers.

[0048]

[0049] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. A method for typing a gene for yellowing soybean leaves, characterized in that, include: Two sets of primers were used to amplify the DNA template of soybean to be tested by PCR. The amplified reaction system was then electrophoretically genotyped using 1% agarose gel. The two primer pairs were: PrimerN2YL, with the upstream primer having the nucleotide sequence SEQ ID NO:1: CGGAGAGGAGATAATGGTAAC and the downstream primer having the nucleotide sequence SEQ ID NO:2: TTGATCCAAGCACGCAATA; and PrimerN2GC8, with the upstream primer having the nucleotide sequence SEQ ID NO:3: CGGAGAGGAGATAATGGTAAG and the downstream primer having the nucleotide sequence SEQ ID NO:2: TTGATCCAAGCACGCAATA. The evaluation criteria are: If the primer pair PrimerN2YL corresponds to a band in the genotype, and the primer pair PrimerN2GC8 corresponds to a band in the genotype, then the soybean yellow leaf gene is a recessive yellow leaf trait. If the primer pair PrimerN2YL has no corresponding band in the genotype, and the primer pair PrimerN2GC8 has a corresponding band in the genotype, then the soybean yellow leaf gene is a dominant homozygous trait. If the primer pair PrimerN2YL has a corresponding genotype band and the primer pair PrimerN2GC8 has a corresponding genotype band, then the soybean yellow leaf gene is a dominant heterozygous trait.