Thin flexible wearable immunosensor for detecting multiple biomarkers / targets in body fluids

Abstract

The invention provides a layered dressing comprising: a permeable wound contact layer for placement in contact with a wound; a gas permeable barrier layer; a biosensor sensor array configured to detect one or more markers in wound fluid; and a fluid collection layer disposed between the wound contact layer and the gas permeable barrier layer and configured to deliver wound fluid from a wound in contact with the wound contact layer to the biosensor sensor array by capillary action. In preferred embodiments, the layered dressing comprises aptamer-based electrodes for detecting TNF-a, IL-6, IL-8, TGF-b, and Staphylococcus aureus epitopes.

Description

Technical Field

[0001] The present invention relates to a layered dressing comprising a biosensor array configured to detect one or more markers in wound fluid. Background Technology

[0002] Chronic wounds are debilitating conditions that can cause severe suffering for patients. Globally, due to an aging population, they place an increasing social and financial burden on healthcare systems. For example, venous ulcers require long-term treatment to heal, with a prevalence of up to 15% in people over 70 years of age and a recurrence rate varying between 54% and 78%. Chronic wounds are caused by a variety of environmental and physiological factors that prevent the natural healing process. These factors are reflected in the composition of wound exudates, which exhibit a dynamic mixture of cytokines, growth factors, and microorganisms during the progression of wound healing.

[0003] Clinical assessment of wounds currently relies on planimetry to qualitatively score features such as slough reduction, granulation tissue formation, and reepithelialization. Quantitative analysis of biochemical parameters is typically limited to downstream laboratory tests, such as enzyme-linked immunosorbent assays (ELISA). Non-invasive, point-of-care wound care devices capable of in-situ monitoring of wound biomarkers would provide timely analysis for more effective diagnosis and treatment. Currently designed flexible sensors for wound care can monitor a limited set of parameters, such as pH, temperature, oxygen, humidity, uric acid, impedance, and pressure. However, other biomarkers also have significant clinical value, such as indicators of inflammatory mediators and bioburden. For example, cytokines and growth factors are recognized indicators of inflammation during ulcer formation. The wound microbiome is also a key characteristic of chronic wounds and is involved in inhibiting healing through persistent inflammation, proteolysis, and endothelial dysfunction. Based on these indicators, a wound sensor is needed that can detect these additional biomarkers to allow for improved classification of wound healing status. Summary of the Invention

[0004] Wound sensors that overcome the problems associated with existing sensors will be better able to guide clinical wound management compared to visual inspection or single-marker measurements alone. Furthermore, wound sensors integrated into dressings will provide continuous in-situ monitoring of the wound and the wound healing process (e.g., monitoring the wound microenvironment, inflammation, and infection status).

[0005] The inventors have surprisingly discovered that a wound sensor capable of detecting multiple relevant biomarkers can be provided, as described herein. Therefore, this invention offers numerous advantages over conventional single-marker sensors, including the ability to simultaneously detect various relevant biomarkers and the ability to adapt a biosensor array to new biomarkers using aptamer-based sensors, efficient and effective delivery of wound fluid to the biosensor array via capillary action, and the ability to wirelessly connect to a controller.

[0006] Therefore, the present invention provides the following.

[0007] 1. A layered dressing comprising:

[0008] A permeable wound contact layer, which is placed in contact with the wound;

[0009] Breathable barrier layer;

[0010] A fluid collection layer disposed between the wound contact layer and the breathable barrier layer, the fluid collection layer comprising a biosensor housing portion and a fluid collection portion, the fluid collection portion comprising a plurality of channels, each channel having a terminus at the biosensor housing portion; and

[0011] A biosensor sensing array, comprising one or more electrodes, is disposed between the biosensor housing portion of the fluid collection layer and the air-permeable barrier layer.

[0012] in:

[0013] The channels in the fluid collection portion of the fluid collection layer are configured such that, in use, the channels deliver wound fluid from the wound in contact with the wound contact layer to the biosensor sensing array via capillary action, wherein the biosensor sensing array is configured to detect one or more markers in the wound fluid.

[0014] 2. The layered dressing according to Item 1, wherein the wound contact layer includes a plurality of perforations.

[0015] 3. The layered dressing according to item 1 or 2, wherein the fluid collection portion of the fluid collection layer has an annular shape, the annular shape having an outer surface, wherein the annular shape defines a central portion, wherein the biosensor housing portion of the fluid collection layer is located at the central portion.

[0016] 4. The layered dressing according to Item 3, wherein the fluid collection portion has an outer surface, and wherein each of the plurality of channels extends from the outer surface of the fluid collection portion to the biosensor housing portion.

[0017] 5. The layered dressing according to any one of items 1 to 4, wherein the plurality of channels are configured such that fluid from the wound flows along the channels in only one direction.

[0018] 6. The layered dressing according to item 5, wherein each of the plurality of channels comprises a plurality of interconnected semi-open serrated capillary channels.

[0019] 7. The layered dressing according to any one of items 1 to 6, wherein the plurality of channels do not have a uniform width over their entire length.

[0020] 8. The layered dressing according to Item 7, wherein the channel includes a first portion and a second portion, the first portion being configured to aspirate fluid from a wound in contact with the wound contact layer, the second portion being closer to the biosensor sensing array than the first portion, wherein the width of the channel at the first portion is greater than the width of the channel at the second portion.

[0021] 9. The layered dressing according to item 8, wherein the channel includes a first end and a second end, wherein the width of the channel at the first end is about 180 μm to about 220 μm, and the width of the channel at the second end is about 140 μm to about 180 μm.

[0022] 10. The layered dressing according to any one of the preceding items, wherein the biosensor sensing array comprises one or more electrodes, each electrode configured to detect a marker selected from the group consisting of healing biomarkers and bioburden biomarkers.

[0023] 11. The layered dressing according to Item 10, wherein the healing biomarker is selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β1 and pH.

[0024] 12. The layered dressing according to item 10, wherein the bioburden biomarker includes a biomarker of Staphylococcus aureus.

[0025] 13. The layered dressing according to any one of items 10 to 12, wherein the biosensor sensing array comprises two or more electrodes, each electrode configured to detect a biomarker selected from the group consisting of biomarkers of TNF-α, IL-6, IL-8, TGF-β1, pH and Staphylococcus aureus.

[0026] 14. The layered dressing according to Item 13, wherein the biosensor sensing array comprises six electrodes, each configured to detect a biomarker selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β1, pH and Staphylococcus aureus, such that the biosensor sensing array is capable of simultaneously detecting TNF-α, IL-6, IL-8, TGF-β1, pH and Staphylococcus aureus biomarkers.

[0027] 15. The layered dressing according to any one of items 12 to 14, wherein the biomarker of said Staphylococcus aureus is an epitope.

[0028] 16. The layered dressing according to any one of the preceding items, wherein the biosensor sensing array comprises one or more aptamer-based working electrodes, each of the aptamer-based working electrodes comprising an aptamer bonded to the electrode, wherein the aptamer is adapted to detect markers in the wound fluid.

[0029] 17. The layered dressing according to Item 16, wherein the one or more aptamer-based working electrodes comprise aptamers of IL-8, IL-6, TNF-α, TGF-β1 and / or Staphylococcus aureus.

[0030] 18. The layered dressing according to item 17, wherein any of the following is used:

[0031] (a) The aptamers of IL-8 include the sequence

[0032] 5'- / 5ThioMC6-D / rGrGrGrGrGrCrUrUrArUrCrArUrUrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArArCrC / 3MeBlN / -3'; and / or

[0033] (b) The aptamers of IL-6 include the sequence

[0034] 5'- / 5ThioMC6-D / GGTGGCAGGAGGACTATTTATTTGCTTTTCT / 3MeBl N / -3'; and / or

[0035] (c) The aptamers of TNF-α include the sequence

[0036] and / or

[0037] (d) The aptamers of TGF-β1 include the sequence

[0038] and / or

[0039] (e) The aptamers of Staphylococcus aureus include the sequence

[0040] 5'- / 5ThioMC6-D / TCGGCACGTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC / 3MeBlN / -3'.

[0041] 19. The layered dressing according to item 18, wherein:

[0042] (a) The aptamers of IL-8 include the sequence

[0043] 5'- / 5ThioMC6-D / rGrGrGrGrGrCrUrUrArUrCrArUrUrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArArCrC / 3MeBlN / -3'; and / or

[0044] (b) The aptamers of IL-6 include the sequence

[0045] 5'- / 5ThioMC6-D / GGTGGCAGGAGGACTATTTATTTGCTTTCT / 3MeBl N / -3'.

[0046] 20. A layered dressing according to any one of claims 16 to 20, wherein the adaptor includes a first end region and a second end region, wherein the adaptor is bonded to the electrode via the first end region.

[0047] 21. The layered dressing according to item 20, wherein the surface of one or more aptamer-based working electrodes comprises an electrochemically exfoliated graphene-gold nanoparticle (AuNPs-GP) nanocomposite layer.

[0048] 22. The layered dressing according to item 21, wherein the aptamer is bonded to the surface of the electrode via a gold-thiol bond.

[0049] 23. The layered dressing according to any one of items 16 to 22, wherein the adaptor is conjugated with a redox label, optionally wherein the redox label is methylene blue.

[0050] 24. The layered dressing according to item 23, wherein the aptamer includes a first end region and a second end region, wherein the aptamer is bonded to the biosensor via the first end region and the aptamer is conjugated to the redox marker via the second end region.

[0051] 25. The layered dressing according to any one of the preceding items, wherein the biosensor sensing array comprises a polyaniline pH sensor.

[0052] 26. The layered dressing according to any one of the preceding items, wherein the biosensor sensing array includes a temperature sensor, optionally wherein the temperature sensor includes a Wheatstone bridge.

[0053] 27. The layered dressing according to any one of the preceding items, wherein the biosensor array is capable of wirelessly transmitting measurement data to a paired device. Attached Figure Description

[0054] Figure 1A shows a diagram of a biomarker analysis dressing applied to an open wound in a patient with venous ulcers for in situ wound monitoring.

[0055] Figure 1B shows a layered dressing comprising a permeable wound contact layer 1011, a fluid collection layer 1012, a biosensor array 1013, and a breathable barrier layer 1014. The fluid collection layer, inspired by the skin of the Texas horned lizard 1015, is capable of achieving a predetermined flow direction against gravity toward the lizard's nose.

[0056] Figure 1C A schematic diagram of a biosensor array configured to detect TNF-α, IL-6, IL-8, TGF-β1, Staphylococcus aureus, pH, and temperature is shown.

[0057] Figure 1D The hardware block diagram of the prototype is shown.

[0058] Figure 2A A biomimetic passive microfluidic collector is shown, formed by a polar-axis array of interconnected semi-open serrated capillary channels 2001, the channels having widths decreasing from 200 μm to 160 μm, fabricated on top of the base electrode of a biosensor sensing array 2002. 2003 shows the direction of fluid delivery.

[0059] Figure 2BThe mechanism of a directional fluid delivery system utilizing the interconnection of adjacent serrated capillary channels is shown.

[0060] Figure 2C-D Together, a COMSOL simulation of fluid transport in interconnected capillary channels is shown, with widths decreasing over time in the forward and reverse directions, respectively (black for fluid; white for air).

[0061] Figure 2E The dynamics of the fluid transport process of the biomimetic prototype at different time points are shown (scale bar, 500 μm).

[0062] Figure 2F This shows the elapsed time of fluid transport in a capillary channel with a consistent length and decreasing width.

[0063] Figure 3A An illustration showing the microenvironment of a venous ulcer.

[0064] Figure 3B A schematic diagram of the sensing mechanism of aptamer-based biosensors used for cytokine and bacterial detection is shown.

[0065] Figure 3C The calibration of the temperature sensor's resistance relative to temperature is shown.

[0066] Figure 3D-3H The relative peak height reduction of the TNF-α, TGF-β1, IL-6, IL-8, and Staphylococcus aureus sensors relative to the concentrations of their respective targets in serum are shown. Error bars represent the standard deviation of the average values ​​obtained from three scans under the same conditions. Insets show the SWV scans of the TNF-α, TGF-β1, IL-6, IL-8, and Staphylococcus aureus sensors when challenged with different analyte concentrations.

[0067] Figure 3I The calibration of the pH sensor's OCP relative to the pH value in serum is shown. The error bars represent the standard deviation of the average over a 20-second span under the same conditions. The inset shows the real-time OCP of the pH sensor for different pH values.

[0068] Figure 4A The design of the wound monitoring study is shown.

[0069] Figure 4B shows a photograph of a freely moving mouse with an immune sensor mounted on a skin wound.

[0070] Figure 4C shows a photograph of the excised wound. The immunosensor was in direct contact with the right wound, while the left wound served as a control.

[0071] Figure 4DThis demonstrates in situ assessment of pH, temperature, mouse TNF-α, and Staphylococcus aureus using an immunosensor. Error bars show the standard deviation.

[0072] Figures 4E-F show images of the wound (scale bar, 5 mm) and the change in wound area from day 0 to day 5. The error bars in F show the standard deviation.

[0073] Figure 4G shows a comparison of wound area on days 1, 3, and 5 (cumulative total of sensor contact for 2, 3, and 4 hours). The error bars show the standard error.

[0074] Figure 4H-I The images show H&E images (20× suture) of the entire full-thickness wound on day 3 and the wound margins on days 1, 3, and 5 (scale bar, 1000, 250 μm). Dashed lines indicate re-epithelialization.

[0075] Figure 4J-K The comparisons of epidermal thickness and re-epithelialization distance are shown separately. The error bars display the standard error.

[0076] Figure 4L-N shows H&E images of the entire wound on day 5, the dermis at the wound margins on days 1, 3, and 5, and the granulation tissue area on day 5 (scale bars, 1000, 250, 250 μm). The images are representative of all mice. Statistical comparisons were performed using the Wilcoxon signed-rank test (ns = non-significant result).

[0077] Figure 5Aa and 5Ab Weekly assessments of pH, Staphylococcus aureus, IL-6, IL-8, TNF-α, and TGF-β1 for each patient are displayed using an immune sensor. The axes represent independent scales for each quantified parameter, varying from 0% at the lowest level to 100% at the highest level. Weekly changes in wound size and biomarker assessments are also shown.

[0078] Figure 5B Patient-specific correlation matrices are shown for parameters assessed via immune sensors (pH, Staphylococcus aureus, IL-6, IL-8, TNF-α, TGF-β1) and wound size over five weeks. The table shows the total number of wounds and their duration (in months) for each patient. The top left, bottom left, and bottom right represent males, while the top center and top right represent females. The scale bar represents the Pearson correlation coefficient (r). p ).

[0079] Figure 6COMSOL simulations (black, fluid; white, air) show fluid transport in interconnected capillary channels with fixed widths of (a, b) 200 μm and (c, d) 160 μm, respectively, in the forward and reverse directions of time.

[0080] Figure 7 Characterization of the AuNPs-GP nanocomposite is shown. (a) AuNPs-GP dispersion (left) and its drop-cast film (right). (b) FESEM image of the drop-cast AuNPs-GP film (top: scale bar, 2 μm; bottom: scale bar, 200 nm). Raman spectra of graphene and AuNPs-GP nanocomposite.

[0081] Figures 8A-8D show the CV scans of AuNPs-GP / Au at different scan rates. (b) Variation of anodic and cathode peak currents relative to the square root of the scan rate. (c) EIS evaluation of bare Au, AuNPs-GP / Au, Apt / AuNPs-GP / Au, MCH / Apt / AuNPs-GP / Au, and TNF-α / MCH / Apt / AuNPs-GP / Au. (d) CV analysis of bare Au, AuNPs-GP / Au, Apt / AuNPs-GP / Au, MCH / Apt / AuNPs-GP / Au, and TNF-α / MCH / Apt / AuNPs-GP / Au.

[0082] Figures 9A-9H show the optimization and reproducibility studies of the aptamer sensors. (a) Comparison of SWV scans of TNF-α sensors with aptamer densities of 10 μM and 1 μM. (b) Effect of aptamer density on the signal-to-noise ratio of the TNF-α sensor. (cg) Effect of incubation duration on the aptamer target binding equilibrium of the TNF-α, TGF-β1, IL-8, IL-6, and Staphylococcus aureus sensors, respectively. (h) Reproducibility studies of two separate TNF-α sensors. Error bars represent the standard deviation of the average values ​​obtained from three scans under the same conditions.

[0083] Figure 10 shows the selectivity studies of (a) TNF-α, (b) TGF-β1, (c) IL-8, and (d) IL-6 sensors. Error bars represent the standard deviation of the average values ​​obtained from three scans under the same conditions.

[0084] Figures 11A-F show the characterization, repeatability, and reproducibility studies of the pH sensors. (a) Real-time OCP changes in serum as pH alternated between acidic and alkaline conditions over three cycles. (b) Reproducibility studies of four individual pH sensors in serum. (c) Real-time OCP for different pH values. The inset in (c) shows the calibration of OCP in plasma relative to pH. Error bars represent the standard deviation of the mean over a 20-second span under the same conditions. (d) Real-time OCP changes in plasma as pH alternated between acidic and alkaline conditions over three cycles. (e) Reproducibility studies of four individual pH sensors in plasma. (f) Comparison of calibrations in serum and plasma.

[0085] Figures 12A-C illustrate the size adjustment capability of biosensors. (a) Minimum volume required for immunosensors at different sizes. (b) Optical images of immunosensors with larger sensing regions (16 mm diameter) and smaller sensing regions (8 mm diameter), respectively. (c) Comparison of signal-to-noise ratio for 8 mm and 16 mm sensors.

[0086] Figure 13A and 13B This shows weekly changes in pH, Staphylococcus aureus, IL-6, IL-8, TNF-α, and TGF-β1 levels from routine measurements.

[0087] Figure 14 Characterization of the mouse TNF-α sensor is shown. With increasing mouse TNF-α concentration, the sensor exhibits a decrease in peak current height (Part A). Part B shows the relative decrease in peak height normalized relative to the absence of mouse TNF-α.

[0088] Figures 15A-15E Optical images of rapid staphylococcal agar plates used for estimating Staphylococcus aureus cell density in wound exudate samples from patients 1–5 over five consecutive weeks are shown.

[0089] Figure 16 A-16F demonstrates the stability of the aptamer-based sensor over a four-week period.

[0090] Figures 17A-17F show the performance of aptamer-based sensors for different analyte concentrations. Detailed Implementation

[0091] This invention provides a layered dressing comprising:

[0092] A permeable wound contact layer, which is placed in contact with the wound;

[0093] Breathable barrier layer;

[0094] A fluid collection layer disposed between the wound contact layer and the breathable barrier layer, the fluid collection layer comprising a biosensor housing portion and a fluid collection portion, the fluid collection portion comprising a plurality of channels, each channel having an end at the biosensor housing portion; and

[0095] A biosensor sensing array, comprising one or more electrodes, is disposed between the biosensor housing portion of the fluid collection layer and the air-permeable barrier layer.

[0096] in:

[0097] The channels in the fluid collection portion of the fluid collection layer are configured such that, in use, the channels deliver wound fluid from the wound in contact with the wound contact layer to the biosensor sensing array via capillary action, and wherein the biosensor sensing array is configured to detect one or more markers in the wound fluid.

[0098] In the embodiments herein, the word "comprising" can be interpreted as requiring the mentioned features but not limiting the presence of other features. Alternatively, the word "comprising" can also refer to situations where only the listed components / features are intended to be present (e.g., the word "comprising" can be replaced by the phrases "consisting of" or "substantially consisting of"). It is expressly anticipated that both broader and narrower interpretations can be applied to all aspects and embodiments of the invention. In other words, the word "comprising" and its synonyms can be replaced by the phrases "consisting of" or "substantially consisting of" or their synonyms, and vice versa.

[0099] In the embodiments described herein, various features may be described in either singular or plural forms. It is expressly contemplated herein that references to the singular should be understood to include the plural, and references to the plural should be understood to include the singular, unless such interpretation would be technically illogical.

[0100] A permeable wound contact layer is used to protect the remainder of the layered dressing from direct contact with the wound bed and to minimize damage to granulating tissue. The wound contact layer is permeable, allowing the wound to breathe and also allowing moisture to escape. Furthermore, the permeable wound contact layer allows wound fluid to be transferred from the wound to a fluid collection layer. In some embodiments of the invention, permeability may be provided by multiple perforations, i.e., the wound contact layer may include multiple perforations. Suitable materials for the wound contact layer are known to those skilled in the art and include polymers such as polyurethane and PDMS (e.g., polyurethane, such as porous polyurethane).

[0101] A breathable barrier layer is typically the outermost layer of a layered dressing and protects the dressing from external environmental influences while allowing the skin to breathe and moisture to escape. In some embodiments, the breathable barrier layer can be a waterproof and breathable barrier layer that provides protection for both the layered dressing and the wound. The breathable barrier layer can be made of any suitable material, such as polymers like polyurethane and PDMS (e.g., polyurethane).

[0102] The fluid collection layer performs the function of collecting wound fluid and directing it to the biosensor sensing array. In other words, the fluid collection layer is used to guide fluid that has passed through the permeable wound contact layer toward the biosensor sensing array. Due to gravity, wound fluid may not be inherently directed toward the biosensor, which can be overcome using capillary action. Therefore, the fluid collection layer includes a biosensor housing portion and a fluid collection portion comprising a plurality of channels, each having an end at the biosensor housing portion. The channels within the fluid collection portion of the fluid collection layer are configured such that, in use, the channels deliver wound fluid from the wound in contact with the wound contact layer to the biosensor sensing array via capillary action.

[0103] The fluid collection layer can have any shape / layout that allows fluid to be transported from the wound to the biosensor sensing array (i.e., from the fluid collection portion to the biosensor housing portion) via capillary action. In some embodiments, the fluid collection portion of the fluid collection layer can have an annular shape with an outer surface, wherein the annular shape defines a central portion, and wherein the biosensor housing portion of the fluid collection layer is located at the central portion. In this way, a large amount of wound fluid can be advantageously directed toward the biosensor housing portion because the wound fluid can be collected from 360° around the biosensor housing portion. In some aspects of this embodiment, the fluid collection portion can have an outer surface with multiple channels each extending from the outer surface of the fluid collection portion to the biosensor housing portion.

[0104] The fluid collection layer can be made of any suitable material and by any appropriate method. For example, the fluid collection layer can be made by precision machining or additive manufacturing methods. Suitable materials for the fluid collection layer include epoxy-based materials, such as SU-8 2150.

[0105] In some embodiments, the multiple channels are configured such that fluid from the wound flows along the channels in only a unidirectional direction. This facilitates fluid flow toward the biosensor housing portion, advantageously increasing the fluid supply to the biosensor sensing array. In some aspects of this embodiment, this unidirectional fluid flow can be achieved when the multiple channels each comprise a plurality of interconnected semi-open serrated capillary channels. The width of the channel can also vary along its length, as capillary action causes fluid to pass through from a wider width to a narrower width, but not typically in opposite directions. Thus, in some aspects of this embodiment, the channel may include a first portion and a second portion, the first portion configured to aspirate fluid from the wound in contact with the wound contact layer, and the second portion closer to the biosensor sensing array than the first portion, wherein the width of the channel at the first portion is greater than the width of the channel at the second portion. For example, the channel may include a first end and a second end, wherein the width of the channel at the first end is about 180 μm to about 220 μm, and the width of the channel at the second end is about 140 μm to about 180 μm.

[0106] In some implementations, the permeable wound contact layer, the breathable barrier layer, and the fluid collection layer can all be transparent (or at least substantially transparent). This allows for easy observation of the healing wound without removing the layered dressing.

[0107] The biosensor sensing array includes one or more electrodes and is disposed between a biosensor housing portion of a fluid collection layer and a breathable barrier layer. Therefore, the biosensor sensing array is positioned such that fluid flowing toward the biosensor housing portion of the fluid collection layer contacts the biosensor sensing array, thereby allowing the detection of biomarkers in the fluid. The biosensor sensing array is configured to detect one or more biomarkers in the wound fluid. In some embodiments, the biosensor sensing array includes one or more electrodes, each configured to detect a biomarker selected from the group consisting of healing biomarkers and bioburden biomarkers. For example, healing biomarkers may be selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β1, and pH. An example of a bioburden biomarker is a biomarker for Staphylococcus aureus (S. aureus), but those skilled in the art will understand that it may be necessary to detect other pathogenic bioburdens.

[0108] In some embodiments, the biosensor array may include two or more electrodes, each configured to detect an associated biomarker. For example, the biosensor array may include two or more electrodes, each configured to detect a biomarker selected from the group consisting of biomarkers of TNF-α, IL-6, IL-8, TGF-β1, pH, and Staphylococcus aureus. In some embodiments, the biosensor array may include six electrodes, each configured to detect a biomarker selected from the group consisting of biomarkers of TNF-α, IL-6, IL-8, TGF-β1, pH, and Staphylococcus aureus. In this way, the biosensor array can be capable of simultaneously detecting biomarkers of TNF-α, IL-6, IL-8, TGF-β1, pH, and Staphylococcus aureus.

[0109] Pathogens, such as bacteria (e.g., Staphylococcus aureus), can be detected by detecting epitopes.

[0110] In some embodiments, the biosensor sensing array may include one or more aptamer-based working electrodes. As used herein, an aptamer-based working electrode refers to an electrode conjugated to or otherwise bonded to an aptamer. The aptamer-based working electrode may include aptamers for biomarkers such as IL-8, IL-6, TNF-α, TGF-β1, and / or Staphylococcus aureus for desired detection.

[0111] In some embodiments, the aptamer in the aptamer-based working electrode may be bonded to the surface of the electrode at its 5' or 3' end or at another point within the aptamer. In some embodiments of the invention, the aptamer-based working electrode may be bonded to the surface of the electrode at its 5' or 3' end, for example, at its 5' end. More generally, the aptamer may include a first end region and a second end region, wherein the aptamer is bonded to the electrode via the first end region.

[0112] An aptamer-based working electrode may include a redox marker, such as a redox marker at the end opposite to the end bonded to the electrode. For example, the aptamer may be bonded to the electrode via a first end region and conjugated to a redox marker via a second end region. Thus, when the aptamer is bonded to the electrode surface at its 5' end, the aptamer may include a redox marker at its 3' end. This can be advantageous because, as Figure 3BAs shown, in the absence of aptamer-binding biomarkers, redox labels can approach the electrode surface, allowing electron transfer. The Faradaic current can then be detected electrochemically. Upon aptamer binding to the biomarker, the hairpin structure of the aptamer undergoes a conformational change, during which the redox label migrates away from the electrode, resulting in a decrease in the redox current. Therefore, aptamer-based sensors do not require additional reagents to complete electrochemical measurements in a single step, making them suitable for in-situ analysis and independent of downstream analysis. A specific example of a suitable redox label that can be mentioned in this paper is methylene blue.

[0113] As those skilled in the art will understand, aptamer-based sensors can be applied to detect virtually any relevant biomarker. Specific examples of aptamer sequences that can be used in this invention are provided below; however, those skilled in the art will understand that other aptamer sequences can be used within the scope of this invention.

[0114] Suitable aptamers for IL-8 include the sequence

[0115] 5'- / 5ThioMC6-D / rGrGrGrGrGrCrUrUrArUrCrArUrUrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArArCrC / 3MeBlN / -3'.

[0116] Suitable aptamers for IL-6 include the sequence

[0117] 5'- / 5ThioMC6-D / GGTGGCAGGAGGACTATTTATTTGCTTTCT / 3MeBlN / -3'.

[0118] Suitable aptamers for TNF-α include the sequence

[0119] 5'- / 5MeBlN / rG*rG*rA*rG*rU*rA*rU*rC*rU*rG*rA*rU*rG*rA*rC*rA*rA*rU*rU*rC*rG*rG*rA*rG*rC*rU*rC*rC / 3ThioMC3-D / -3'.

[0120] Suitable aptamers for TGF-β1 include the sequence

[0121] 5'- / 5MeBlN / CG*CTCGG*CTTC*ACG*AG*ATT*CGTGT*CGTTGTGT*C*CTGT*A*C*C*CG*C*CTTG*A*C*C*AGT*C*ACT*CT*AG*AGC*AT*C*CGG*A*CTG / iSpC3 / / 3ThioMC3-D / -3'.

[0122] Suitable aptamers for Staphylococcus aureus include the sequence

[0123] 5'- / 5ThioMC6-D / TCGGCACGTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC / 3MeBlN / -3'.

[0124] In some embodiments of the present invention:

[0125] (a) The aptamers of IL-8 include the sequence

[0126] 5'- / 5ThioMC6-D / rGrGrGrGrGrCrUrUrArUrCrArUrUrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArArCrC / 3MeBlN / -3'; and / or

[0127] (b) The aptamers of IL-6 include the sequence

[0128] 5'- / 5ThioMC6-D / GGTGGCAGGAGGACTATTTATTTGCTTTCT / 3MeBlN / -3'.

[0129] Biosensor arrays may include pH sensors, such as polyaniline pH sensors. Biosensor arrays may also include temperature sensors, such as temperature sensors incorporating a Wheatstone bridge.

[0130] In embodiments of the invention where the biosensor sensing array includes one or more electrodes (e.g., two or more electrodes, which may be, for example, aptamer-based electrode sensors), the electrodes may include electrochemically exfoliated graphene layers. In another such embodiment, the surface of the electrode may include an electrochemically exfoliated graphene-gold nanoparticle layer, such that the electrode is modified with a thin layer of electrochemically exfoliated graphene-gold nanoparticle (AuNPs-GP) nanocomposite material. In this case, and when the electrode is an aptamer-based electrode sensor, the aptamer can be bonded to the electrode surface via gold-thiol bonds. Unbound by theory, electrochemically exfoliated graphene (which may also be referred to herein as “graphene”) possesses excellent properties such as high crystallinity, high conductivity, and low oxidation. Furthermore, the presence of gold is believed to provide high current density, enhanced electron mobility, and rapid mass transport. The combination of AuNPs and graphene is considered to contribute to enhanced signal scaling, high sensitivity, and good stability of aptamer-based biosensors.

[0131] As explained in this article, biosensor arrays can wirelessly transmit measurement data to paired devices. This can advantageously provide clinicians with easy access to real-time updates on the wound microenvironment.

[0132] The layered dressing of the present invention can be directly attached to a wound (such as a venous ulcer) in the form of a bioanalytical dressing, said bioanalytical dressing including sensors for a wide range of healing biomarkers (including inflammatory mediators, bacterial load, and physicochemical parameters). Figure 1C Laminar dressings can measure highly clinically relevant biomarkers such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-8 (IL-8), which are elevated in wound fluid obtained from unhealed ulcers compared to healed ulcers. To assess the status of dermal healing in chronic skin injuries, laminar dressings can also detect transforming growth factor-β1 (TGF-β1), which plays a key role in regulating dermal fibroblast phenotype and function, and has been clinically observed to have elevated concentrations in exudates from venous ulcers. Physicochemical markers may additionally include pH, temperature, and bacterial load. The pH of wound exudate is an important biochemical indicator of wound healing status: wounds that are difficult to heal often exhibit an alkaline pH, ranging from 7.15 to 8.93. Wound temperature provides information about inflammation and infection: wounds with elevated temperatures tend to heal more slowly. Staphylococcus aureus (S. aureus) is the predominant species in samples from all types of chronic wounds and can be a useful biomarker of wound bioburden.

[0133] The invention is described in more detail below with reference to the accompanying drawings and the embodiments described herein, which should not be construed as limiting.

[0134] Example

[0135] Material

[0136] Ferric chloride (FeCl3), N,N-dimethylformamide (DMF), tetraalkylammonium (TAA), N-methyl-2-pyrrolidone (NMP), potassium hexacyanoferrate (K3Fe(CN)6), potassium hexacyanoferrate (K4Fe(CN)6·3H2O), potassium chloride (KCl), tris(2-carboxyethyl)phosphonic acid hydrochloride (TCEP), 6-mercapto-1-hexanol (MCH), hydrochloric acid (HCl), aniline, disodium hydrogen phosphate (Na2HPO4), citric acid, and a buffer solution at pH 10.00. Human serum and plasma were purchased from Sigma-Aldrich. PET sheets (ST506) were purchased from MELINEX. Bulk graphite crystals (99.9% purity) were purchased from HQgraphene. Organic spherical gold nanoparticles (20 nm in diameter, dispersed in DMF) were purchased from Nanopartz Inc. Modified oligonucleotides and IDTE buffer (10 mM Tris, 0.1 mM EDTA) were purchased from Integrated DNA Technologies. Recombinant human TNF-α, IL-6, IL-8, TGF-β1, IL-1β, IL-2, IL-7, IFN-γ, recombinant mouse TNF-α, and bovine serum albumin (BSA) were purchased from R&D systems. Calcium- and magnesium-free phosphate-buffered saline (PBS) (1×) was purchased from Lonza. Staphylococcus aureus HG001 was provided by the Department of Microbiology and Immunology, National University of Singapore. UltraPure TM DNase / RNase-free distilled water, BD Difco TM LB broth, Miller (Luria-Bertani), and Oxoid tryptone soy agar (TSA) were purchased from Thermo Fisher Scientific. Rapid Staphylococcus agar and potassium-containing egg yolks were purchased from Bio-Rad.

[0137] Example 1: Preparation of layered dressings

[0138] Figure 1A shows a biomarker analysis dressing incorporating an immunosensor, applied to an open wound in a patient with venous ulcers for in situ wound monitoring. The dressing comprises a permeable wound contact layer 1011, a fluid collection layer 1012, a biosensor sensing array 1013 (also described herein as an immunosensor), and a breathable barrier layer 1014 (Figure 1B). The permeable wound contact layer includes multiple perforations and is referred to herein as a perforated wound contact layer. The perforated wound contact layer functions to protect the immunosensor from direct contact with the wound bed, minimizing damage to granular tissue. This barrier allows normal skin function by allowing oxygen to enter and water vapor to escape. The dressing substrate can be transparent, which allows for convenient in-situ observation and assessment of the wound during application: the surface area and color of exudate.

[0139] Figure 1D A circuit block diagram illustrating the hardware design is shown. The portable electrochemical analyzer is designed to manage signal transduction and perform electrochemical measurements. Measurement data is wirelessly transmitted to a paired mobile device using Bluetooth Low Energy (BLE). The mobile device can run an accompanying application, including a GUI, to help manage patient information and medical records, while facilitating data collection, analysis, and visualization (method).

[0140] Design of fluid collection layer

[0141] Effective wound fluid capture and delivery are essential for accurate in-situ biomarker detection. To ensure effective wound fluid collection, the inventors incorporated a microfluidic layer capable of guiding wound fluid to the sensing area. The fluid collection layer was designed based on the skin of the Texas horned lizard (Phrynosoma cornutum), enabling predetermined directional fluid flow against gravity toward the lizard's snout (Figure 1B). The directional fluid transport of the Texas horned lizard skin is attributed to a microstructural network of special capillary systems formed between the scales. Based on a theoretical model derived from this capillary network, the fluid collection layer was designed with a ring-shaped pattern (…). Figure 2A The pattern consists of a polar array of interconnected, semi-open, serrated capillary channels with widths decreasing from 200 μm to 160 μm (from outside to inside). The interconnection of adjacent serrated capillary channels promotes continuous flow in the forward direction (i.e., toward the sensing region) but inhibits fluid transport in the reverse direction. Specifically, in... Figure 2BIn the forward direction, the fluid stops at capillary i due to the sudden widening with an infinite meniscus radius, while continuously flowing to capillary ii. At capillary ii, the fluid merges with the fluid stopped at capillary i and flows forward to capillary iv. Similarly, the merged fluid coalesces with the fluid stopped at capillary iii and continues flowing into subsequent capillaries. On the other hand, the fluid flow stops in the reverse direction at the widened portions v and vi. Figure 2B Therefore, a directional fluid transport system is formed.

[0142] To demonstrate this working principle, a model (method) for a directional fluid transport system was established. As shown in Figures 2C-2D, simulations of fluid transport in interconnected capillary channels with decreasing widths were performed in both the forward and reverse directions. The fluid flows in the forward direction; it stops completely at the starting point in the reverse direction. Furthermore, the fluid transport performance of capillary channels with widths of 160 μm and 200 μm was simulated. It was observed that at a width of 200 μm, the fluid could not flow in the forward direction. Figure 6 (part a), while continuous flow was observed at a width of 160 μm ( Figure 6 Part c). On the other hand, the fluid flows through the two capillary channels (widths). Figure 6 Neither parts b nor d can overcome the starting point in the reverse direction. Based on these simulation results, capillary channels with reduced width can ensure efficient and continuous directional fluid delivery toward the sensing area.

[0143] Experimental results obtained using a biomimetic prototype validated the simulation results. Specifically, a droplet (2 μL) of soapy water with a contact angle similar to human serum was applied to the middle section of the directional fluid delivery system. Figure 2E A dynamic passive fluid transport process (method) at different times is illustrated. Fluid is transported to the sensing region by continuously utilizing interconnected capillary channels, while movement in the reverse direction is suppressed. It was also observed that a reduced capillary channel width requires a shorter fluid transport time within the capillary channels. Figure 2F The average flow velocity in the forward direction is ~0.43 mm. 3 / s. Regardless of ulcer shape or size, the directional fluid delivery system is designed to capture and deliver an additional ~180% of wound fluid to the sensor within 130s, ensuring reliable sensing performance.

[0144] The simulation experiment used to test the fluid collection layer was conducted as follows. The directional fluid transport system was simulated using the Computational Fluid Dynamics (CFD) module (COMSOL Multiphysics 5.3a, two-phase flow, horizontal settings interface). The experiment was recorded using a high-speed camera (FASTCAM MiniAX, Photron) mounted on an inverted microscope system (IX71, Olympus), set to 125fps and 1024×1024 resolution.

[0145] Through a breathable barrier layer (which is formed of a medical-grade polyurethane membrane, trade name Tegaderm) TM A fluid collection layer was prepared by spin-coating a SU-8 2150 layer (~150 μm) onto the top of the membrane. The fluid collection layer was then patterned using photolithography. The wound contact layer was formed from a perforated medical-grade polyurethane membrane. The preparation of each layer is described in more detail in the methods below.

[0146] Design and characterization of biosensor arrays (immune sensors)

[0147] The immunosensor is designed to measure various biophysical and chemical parameters of sampled wound fluid based on an electrochemical system. It comprises a polar-axis array of petal-shaped working electrodes, sharing a central Ag / AgCl reference electrode and a peripheral Au counter electrode. Figure 1C (Methods) have resulted in a compact, circular layout ideal for microvolume analysis. The sensing elements of the TNF-α, IL-6, IL-8, and TGF-β1 electrodes are based on aptamer-analyte affinity, while the binding affinity of the Staphylococcus aureus electrode lies between the aptamer and a specific epitope on the bacterial cell wall surface.

[0148] Previous approaches to biosensor functionalization relied on fabrication techniques specific to each biomarker, which did not allow for the direct integration of multiple sensing modalities. This is overcome using a microdroplet process that functionalizes each working electrode with a different sensing element via micropores. The optimized height of the micropores (20 μm) enables independent drop casting, aptamer immobilization, and passivation, while also protecting the immobilized aptamer and captured target from scratches (method).

[0149] To optimize the performance of the microelectrodes, each aptamer-based electrode was modified with a thin layer of electrochemically exfoliated graphene-gold nanoparticles (AuNPs-GP) nanocomposite (method). The morphology of AuNPs-GP was characterized by field emission scanning electron microscopy (FESEM) images. Figure 7Part b). Raman spectra of graphene and AuNPs-GP nanocomposites show... Figure 7 In Part c (Methods), the intensity ratio of the D-band to the G-band (ID / IG) reflects the degree of disorder in the graphite material. The ID / IG value of AuNPs-GP (0.93) is slightly larger than that of graphene (0.91), indicating that AuNPs introduce additional defects into the nanocomposite material.

[0150] As shown in Figure 8A, qualitative analysis of the AuNPs-GP modified electrode was performed using cyclic voltammetry (CV) at different scan rates. The anode-to-cathode peak current ratio (Ipa / Ipc) ranged from 0.92 to 1.15, indicating the quasi-reversibility of the system. Theoretically, the peak current is proportional to the square root of the scan rate. Figure 8B shows the variation of the anode and cathode peak currents with respect to the square root of the scan rate, with regression coefficients of 0.9867 and 0.9903, respectively. The good linearity indicates a diffusion-controlled process at the electrode.

[0151] The aptamer sequence (method) is designed, modified at one end with methylene blue (a redox marker), and at the other end with a thiol group to covalently bind to AuNPs. For example... Figure 3B As shown, in the absence of analyte, MB approaches the AuNPs-GP modified electrode, allowing electron transfer. Faraday current can be detected electrochemically. Upon target binding, the hairpin structure of the aptamer undergoes a conformational change, during which MB moves away from the electrode, resulting in a decrease in redox current. Due to the sensing mechanism, aptamer-based sensors do not require additional reagents to complete electrochemical measurements in a single step, making them suitable for in-situ assays and independent of downstream analysis. With advantages such as chemical and thermal stability, high affinity and selectivity, and non-immunogenicity, aptamer-based sensors offer a highly favorable dressing for biocompatible molecular analysis. After aptamer immobilization, the electrode surface can be passivated with 6-mercapto-1-hexanol (MCH) to suppress nonspecific adsorption.

[0152] The stepwise assembly of different layers on the working electrode was verified by electrochemical impedance spectroscopy (EIS) (Figure 8C, Methods). The AuNPs-GP modified electrode exhibited a lower charge transfer resistance (Rct) (3.17 kΩ) than the bare gold electrode (5.29 kΩ), indicating enhanced electron transfer kinetics at the electrode junctions and a higher electroactive surface area. Immobilization of the aptamer and MCH led to increases in Rct to 14.4 kΩ and 17 kΩ, respectively. Electron mobility was impeded by the immobilized material. The presence of the analyte further blocked the electron transfer indicated by the 18 kΩ increase in Rct. Figure 8D reports the CV analyses of the different steps, where the redox peak current is an indicator of conductivity. The results are consistent with those from EIS, confirming the successful and functional electrode fabrication.

[0153] Square wave voltammetry (SWV) was used to characterize aptamer-based sensors to monitor changes in peak current height related to the distance from the MB redox tag to the electrode. Serum was used to simulate wound exudate due to its similar molecular composition to wound fluid. A 10 μM aptamer concentration (density) was applied to ensure distinguishable peak heights (Fig. 9A) and optimize the signal-to-noise ratio (Fig. 9B), where signal represents peak height and noise represents the standard deviation of the signal. Studies of the incubation process revealed that aptamer-target binding requires approximately 30 min to establish equilibrium (Fig. 9C-G). The performance of each aptamer sensor for different analyte concentrations is shown in [Figure 9C-G]. Figure 3D In the illustration of -H (method), it was observed that the peak current height decreased with increasing target concentration. Figure 3D -H represents the normalized peak height relative to analyte concentration relative to the analyte concentration. The quadratic regression line represents TNF-α(R 2 =0.9798), TGF-β1(R 2 =0.9931), IL-8(R) 2 =0.9958), IL-6(R) 2 =0.9882) and Staphylococcus aureus (R 2 =0.9712) The sensor exhibits good monotonicity. Notably, TNF-α (0-2 ng / mL) -1 TGF-β1 (0-150 pg mL) -1 ), IL-8 (0-30 ng / mL) -1The concentration ranges of IL-6 (0–30 ng / mL) were based on reported levels in wound fluid from patients with venous ulcers, combined with ELISA results from clinical samples used in this study. Similarly, the range of Staphylococcus aureus (0–1E+0.9 CFU / mL) was selected based on the reported microbial load in the wound and the CFU count from this study. The cytokine sensor demonstrated good selectivity, minimal interference (Fig. 10), and good reproducibility (Fig. 9H).

[0154] The working electrode used for pH sensing is based on a polyaniline (PANI) polymer (method). Changes in open-circuit potential (OCP) are used to monitor pH changes. Figure 3I As illustrated in the illustration, the potential of the pH sensor remains stable until the pH level changes. A decrease in potential is observed as the fluid sample changes from acidic to alkaline. Characterization of the pH sensor in serum is described in... Figure 3I The sensitivity is defined as the relative change in OCP per unit pH value normalized to pH 3.76, which is -31.402% [pH]. -1 Good linearity (R0) has been proven. 2 =0.9997 (obtained from the linear regression line), the pH sensor was characterized by good repeatability (Figure 11A) and reproducibility (Figure 11B). The performance of the pH sensor was also validated using plasma, which produced similar results (Figures 11C-F). The embedded temperature sensor is based on a thermally responsive resistor (method). The aptamer sensor and pH sensor showed good long-term stability over more than four weeks, with drift less than 5%. Figure 16 The method offers advantages over antibody-based biosensors, which are prone to inactivation due to antibody denaturation. The characterization of the temperature sensor is as follows: Figure 3C As shown. Sensitivity is defined as the relative change in resistance per unit temperature at 20°C, normalized to 0.1384%℃. -1 It has good linearity R 2 =0.9998. Note that the operating range of the pH sensor (pH 4-9) and temperature sensor (20-50°C) should be considered to ensure coverage of pH and temperature variations in the wound fluid environment.

[0155] An immunosensor embedded in a biomarker analysis dressing was designed with a sensing region (16 mm in diameter) suitable for most venous ulcers. However, the size of the immunosensor can be scaled up (Figure 12) to achieve a variety of other potential applications (e.g., acute trauma, surgical wounds, psoriasis, eczema). The minimum volume required for different sizes of immunosensors is shown in Figure 12. Due to the volume limitations of micropores in multi-aptimide sensing systems that can accommodate individual aptimide fixation, the limitation for resizing was explored to be an 8 mm diameter sensing region. Figure 12A shows the minimum volume required for the immunosensor at different sizes. An SNR loss of less than 5% was observed when the sensor was resized to a smaller size (8 mm in diameter). Figure 12C ).

[0156] method

[0157] Precision machining of base electrodes on dressings

[0158] The base electrode pattern was designed using AutoCAD 2018. To fabricate the base electrodes on the coating, a Ni sacrificial layer (25 nm) was deposited on a Si wafer using a sputtering machine (ATC-2200UHV, AJA). A bottom insulating layer of SU-83025 (~20 μm) was spin-coated onto the Ni layer and patterned using photolithography. After O2 plasma cleaning, an S1818 layer was spin-coated onto the SU-8 layer and patterned using photolithography. Cr / Au (30 nm / 50 nm) was deposited using a thermal evaporator (NANO 36, Kurt J. Lesker) followed by acetone lifting up. Similarly, 200 nm Ag was deposited on the reference electrode region (3 mm diameter) using an electron beam evaporator (AJA). A top insulating layer of SU-8 3025 was spin-coated, followed by photolithography to expose the working areas of the electrochemical electrodes, providing micropores for each working electrode. A 0.1M FeCl3 solution was dropped onto the top of the Ag layer for 1 min to generate an Ag / AgCl reference electrode. A microfluidic wound exudate collector was formed by spin-coating a SU-8 2150 (~150 μm) layer on top of an insulating layer and then patterning it using photolithography. The Ag / AgCl reference electrode was temporarily protected by a 950PMMA A4 (2 μm) layer. After etching the Ni layer with a 30% FeCl3 solution, the entire stack was released from the Si wafer. Next, the electrode was transferred and printed onto a medical-grade polyurethane film (Tegaderm). TM Afterward, the PMMA layer is removed with acetone. Following aptamer fixation, the immunosensor is finally encapsulated with a perforated medical-grade polyurethane membrane.

[0159] Precision machining of base electrodes on PET

[0160] To fabricate the base electrode on PET, Cr / Au (30nm / 50nm) was directly deposited onto an O2 plasma-cleaned PET sheet (125μm). Subsequent procedures for constructing the stacked layers (SU-8 insulating layer, Ag / AgCl reference electrode, microfluidic wound exudate collector) remained the same as described above.

[0161] Preparation and characterization of AuNPs-GP nanocomposites

[0162] First, graphene flakes were prepared via cathodic exfoliation. In short, electrochemical exfoliation of bulk graphite was performed using an electrochemical workstation (CHI 760E) with a dual-electrode system. Bulk graphite crystals were placed as the working cathode, and Pt wire was used as the counter electrode. A non-aqueous solution of 0.01 M TAA salt and NMP was used as the electrolyte. Expansion of the bulk graphite was achieved using a cathode voltage of 8 V. The expanded graphene flakes were further exfoliated, centrifuged, and dried. The dried graphene flakes were dispersed in DMF (1.4 mg / mL). -1 The AuNPs dispersion was then ultrasonically treated for 3 hours using an ultrasonic cleaner (SW1, Sonoswiss AG). Excess AuNPs dispersion was added to the graphene dispersion, followed by ultrasonic treatment for 1.5 hours to induce good adsorption between the graphene and AuNPs. The dispersion was further centrifuged at 13000 rpm (Heraeus). TM Pico TM 17. (Thermo Scientific) 5 min, then wash with DMF. Repeat this step several times to remove unadsorbed AuNPs. Finally, acoustically treat the dispersion for 5 min to obtain the AuNPs-GP nanocomposite. When not in use, store the composite at 4°C and acoustically treat for 5 min before each use. Morphological images of AuNPs-GP were obtained using FESEM (Verios 460, FEI). Raman spectra were measured using Raman microscopy (Alpha 300R, Witec).

[0163] aptamer sequence

[0164] The TNF-α aptamer sequence is:

[0165] 5'- / 5MeBlN / rG*rG*rA*rG*rU*rA*rU*rC*rU*rG*rA*rU*rG*rA*rA*rC*rA*rU*rU*rC*rG*rG*rA*rG*rG*rC*rU*rC*rC / 3ThioMC3-D / -3'. Specifically, the RNA oligonucleotide is modified at the 3' end with a disulfide (SS) bond via a 3-carbon (C3) spacer, and at the 5' end with methylene blue (MB) via an amino modification. A phosphate thioester bond (marked with *) is introduced to inhibit RNA degradation by RNases.

[0166] The IL-6 aptamer sequence is:

[0167] 5'- / 5ThioMC6-D / GGTGGCAGGAGGACTATTTATTTGCTTTTCT / 3MeBlN / -3'. Specifically, the DNA oligonucleotide is modified at the 5' end with an SS bond via a 6-carbon (C6) spacer and at the 3' end with an MB bond via an amino modifier.

[0168] The IL-8 aptamer sequence is:

[0169] 5'- / 5ThioMC6-D / rGrGrGrGrCrUrUrArUrCrArUrUrCrCrArUrUrUrArGrUrGrUrUrArUrArArCrC / 3MeBlN / -3'. Specifically, the RNA oligonucleotide is modified at the 5' end with an SS bond via a C6 spacer, and at the 3' end with an MB bond via an amino group.

[0170] The TGF-β1 aptamer sequence is:

[0171] 5'- / 5MeBlN / CG*CTCGG*CTTC*ACG*AG*ATT*CGTGT*CGTTGTGT*C*CTGT*A*C*C*CG*C*CTTG*A*C*C*AGT*C*ACT*CT*AG*AGC*AT*C*CGG*A*CTG / iSpC3 / / 3ThioMC3-D / -3'. Specifically, the DNA oligonucleotide is modified at the 3' end with an SS bond via a C3 spacer, and at the 5' end with an MB bond via an amino modification. An internal spacer C3 is introduced to extend the spacer arm. A phosphate thioester bond is introduced to inhibit DNA degradation by DNases.

[0172] The Staphylococcus aureus aptamer sequence is:

[0173] 5'- / 5ThioMC6-D / TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC / 3MeBlN / -3'. Specifically, the DNA oligonucleotide is modified at the 5' end with an SS bond via a C6 spacer, and at the 3' end with an MB bond via an amino group.

[0174] The mouse TNF-α aptamer sequence is:

[0175] 5'- / 5ThioMC6-D / GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC / 3MeBlN / -3'. Specifically, the DNA oligonucleotide is modified at the 5' end with an SS bond via a C6 spacer and at the 3' end with an MB bond via an amino modifier.

[0176] Preparation of pH sensor

[0177] First, the base electrode was cleaned with acetone and ethanol using an ultrasonic cleaner. To electropolymerize the PANI layer, a 0.1M aniline / 0.1M HCl solution was added dropwise to the entire electrochemical operating region, and then a potentiostat (CompactStat.h, Ivium, the same below) was used at 100 mV s. -1 Perform 25 cycles of CV from -0.2V to 1V.

[0178] Fabrication of aptamer sensors

[0179] After the pH sensor was prepared, it was first subjected to a large-volume sterile ultrapure (Milli-) solution. The electrodes were rinsed with ultrapure water (hereinafter referred to as "ultrapure water") and dried under N2. The AuNPs-GP dispersion was then drop-cast onto each working electrode and dried. The AuNPs-GP modified working electrodes were rinsed with a large volume of ultrapure water, followed by a second wash with DNase / RNase-free distilled water (hereinafter referred to as "distilled water"). 100 μM oligonucleotides were reduced by 10 mM TCEP for 1 h at room temperature to cleave SS bonds. Continuously, the oligonucleotides were then diluted to 10 μM with IDTE buffer and vortexed for 10 seconds to aid dispersion. 10 μM TNF-α, IL-6, IL-8, TGF-β1, and Staphylococcus aureus aptamer dispersions were drop-cast onto each working electrode and incubated at room temperature under airtight conditions for 6 h. The aptamer-fixed electrodes were then rinsed with a large volume of ultrapure water, followed by a second wash with distilled water. 3 mM MMCCH was drop-cast onto each working electrode and incubated overnight at room temperature under airtight conditions. Finally, after rinsing with plenty of ultrapure water, wash a second time with distilled water, and the apter sensor is ready for use.

[0180] Qualitative analysis and characterization of aptamer sensors

[0181] Qualitative evaluation of the aptamer sensor was performed by dropping 5 mL of K₃Fe(CN)₆ / K₄Fe(CN)₆ (1:1) containing 0.1 M KCl across the entire electrochemical operating region. For CV measurements, and for quasi-reversible analysis of the AuNPs-GP modified electrode, the potential range was varied across different scan rates (150–10 mV s⁻¹). -1 The range is -0.6V to 0.6V, while for stepwise assembly analysis, the scan rate is fixed at 50mV / s. -1 For EIS measurements, a potential of 0.2V was applied. The voltage frequency range was 100kHz–0.01Hz, with an amplitude of 5mV. Randle circuitry was used to fit Nyquist plots. The cytokine sensor was characterized in human serum with incorporated analytes (reconstructed in PBS). Bacterial culture and counting were performed prior to characterization of Staphylococcus aureus. Briefly, Staphylococcus aureus colonies from streak plates were inoculated into 10 mL of sterile LB broth (hereinafter referred to as “LB broth”) and incubated at 37°C and 200 rpm for 17 h. 1 mL of inoculum and its serial diluents were mixed with 15 mL of sterile TSA medium for pour plate culture. After incubation, the Staphylococcus aureus cell density in the original inoculum was estimated using plates displaying visible isolated colonies between 30 and 300. Subsequently, Staphylococcus aureus was precipitated after centrifugation at 4000 rpm for 5 min and reconstructed in human serum for sensor characterization. The SWV measurement of the aptamer sensor was performed in a scan from -0.8V to 0V with a step potential of 4mV. The frequency was 50Hz and the pulse amplitude was 40mV. Furthermore, solutions with pH values ​​of 3.76, 4.56, 5.47, 6.2, 7.06, and 8.04, used for pH sensor characterization, were prepared using a mixture of serum and McIlvaine buffer, while a solution with pH 9.01 was obtained using a mixture of serum and pH 10.00 buffer. The temperature sensor was characterized in a glass beaker containing water, the water temperature of which was regulated by a hot plate below the beaker.

[0182] The long-term stability of the aptamer sensor or pH sensor was investigated by observing the longitudinal weekly variation of peak height relative to no analyte or OCP at pH 7.06 for four consecutive weeks. The immunosensor was stored airtight at 4°C between measurements.

[0183] Radiochemical Analyzer

[0184] Inspired by the open-source Universal Wireless Electrochemical Detector (UWED), a radiochemical analyzer was designed and fabricated for comprehensive chronic wound monitoring. Unlike the UWED, which was designed to operate in a single channel using a commercially available three-electrode battery, this device is a multi-channel design capable of performing a variety of analytical techniques using a 10-electrode sensor.

[0185] Hardware Design

[0186] The main components include a digital-to-analog converter (DAC), a low-pass filter, a potentiostat, analog switches, a multiplexer, a temperature sensing circuit, and the RFduino microcontroller. This connects the hardware to the immune sensor described in the previous section. A circuit diagram was first designed using Autodesk Eagle 9.3.0. Subsequently, component layout and routing were designed for a two-layer PCB prototype and an FPCB. Both designs were manufactured and partially assembled using a turnkey PCB service (Interhorizon Corporation Pte. Ltd., Singapore). The PCB was inspected using a microscope and multimeter to ensure proper connections between all components.

[0187] Microcontrollers, DACs, filters, and potentiostats

[0188] The microcontroller, DAC, filter, and potentiometer are all UWED components. At the heart of the device is the RFduino microcontroller, a low-cost 32-bit ARM processor. The RFduino chip package integrates numerous GPIO ports and an I2C bus for connecting to peripherals, as well as an onboard 10-bit analog-to-digital converter (ADC) for sampling measurement data. Furthermore, it is compatible with the Arduino development environment and features an integrated BLE front-end for communication with BLE-enabled mobile devices such as phones or tablets. The DAC receives digital voltage input from the microcontroller via the I2C protocol and outputs analog voltages to WE and RE through two separate channels. A second-order low-pass filter using an operational amplifier (op-amp) is included to minimize electrical noise in the RE potential. The potential is set directly from the second output of the DAC.

[0189] Analog switches and multiplexers

[0190] To enable multiple technologies and multi-channel operation, analog switches and multiplexer integrated circuit (IC) components (Analog Devices Inc. triple 3-to-1 multiplexer IC, ADG793G) are used to implement the necessary hardware logic, which can be controlled using general purpose input / output (GPIO) and I2C protocols respectively. Analog switches are crucial for switching between different technologies. To support ampere (SWV) and potential (OCP) measurements, a set of two switches (S1 and S2) is used. Figure 1D The operational amplifier OP2 is used to alternate between transimpedance amplifier and voltage follower configurations. Additional switches are used to implement the necessary hardware logic to support switching between OCP, SWV, and temperature measurements, while the multiplexer IC allows for programmable selection of each WE channel.

[0191] Temperature sensing circuit

[0192] A temperature sensing circuit was designed based on a Wheatstone bridge differential amplifier configuration to achieve accurate resistance measurement. The Wheatstone bridge utilizes two voltage divider paths to establish a balance point, where a small deviation in the thermistor's resistance will generate a differential voltage at the operational amplifier output. Since the thermistor's resistance varies between 2.3kΩ and 2.5kΩ over the temperature range of interest, a balancing resistor of 2.26kΩ was chosen, and an AD627ARZ instrumentation amplifier configured with a gain of 25 was used.

[0193] Custom MATLAB applications

[0194] A mobile application (VeCare) for layered dressings was developed using MATLAB 2018b, providing a GUI and comprehensive data processing and reporting capabilities. It can run on any MATLAB 2018b-enabled PC or mobile tablet with the help of a BLE-to-USB adapter. The application is designed as a one-stop system for patient management, data logging, data analysis, and results visualization, intended for use by healthcare providers. Upon opening VeCare, a BLE connection to the application is established using Universally Unique Identifiers (UUIDs). Healthcare providers can then use the application to manage patient records, collect sensor data, receive real-time visual feedback from the GUI, analyze data and generate useful results, and log them to relevant records for monitoring over extended periods.

[0195] power supply

[0196] The hardware can be powered by a single rechargeable 3.7V lithium-ion polymer battery with the desired capacity. In our implementation, a 190mAh battery pack is used, providing an estimated 40 hours of continuous operation. Actual battery life may be significantly longer, depending on the frequency of operation required, as this is a device for immediate diagnostics. Low-dropout regulator ICs (MICRELMIC5205-3.3YM5) are used to generate separate 3.3V digital and analog power supplies, respectively powering the RFduino microcontroller and analog peripherals, creating separate digital and analog circuitry to prevent digital noise from degrading analog performance.

[0197] Example 2: In situ wound monitoring and biocompatibility study in a mouse model

[0198] result

[0199] To demonstrate the platform's utility for in situ wound monitoring, longitudinal wound monitoring was performed in a mouse model (method). Briefly, two bilateral full-thickness resection wounds were created on day 0, equidistant from the midline and spaced apart on either side of the back. Figure 4A The immune sensor was placed in direct contact with the right wound (Fig. 4C), while the left wound served as a control. Subjects with the immune sensor attached were allowed free movement for 1 hour, followed by in-situ wound monitoring. The presence of the immune sensor appeared to be well tolerated, with no signs of discomfort or excessive scraping of the sensor-covered wound observed during free movement (Fig. 4B). In all cases, the immune sensor remained functional 1 hour after contact with the wound. Figure 4D The longitudinal assessment of pH, temperature, mouse TNF-α, and Staphylococcus aureus at injury (day 0 (N=9)) and on days 1 (N=9), 3 (N=6), and 5 (N=3) post-injury is presented. Longitudinal pH measurements showed a 6% decrease in pH at the wound site on day 5 compared to day 0. This decrease corresponds to wound reepithelialization, which is associated with hypoxia and lactate production. Immunosensor measurements also revealed a significant increase in TNF-α from day 0 to day 1 (an increase of 44%), corresponding to the inflammatory response following injury. In contrast, the temperature and levels of Staphylococcus aureus measured at the wound site remained constant throughout the healing duration, consistent with the absence of infection assessed by visual examination. These results demonstrate that immunosensors allow for in situ multi-biomarker analysis of wound fluids over the duration associated with wound healing.

[0200] Histological examination of the wound site further confirmed the biocompatibility of the immunosensor. No obvious signs of adverse reactions (e.g., redness, swelling, degeneration) were observed on the skin surface in contact with the immunosensor within 5 days (Fig. 4E). Figs. 4F-G show that sensor placement had no cumulative effect on wound closure rate. Reepithelialization distance and new epidermal thickness were measured from hematoxylin and eosin (H&E) histological sections (Figs. 4H, 4I) to assess the effect of sensor placement on wound healing. No significant differences were observed between control wounds and wounds with sensor contact (Figs. 4J, 4K). Qualitative assessment of immune cells in the dermis at the wound margin, identified by cell morphology and the presence of polymorphonuclear lesions, indicated no difference in infiltration at all time points of sensor contact (Figs. 4L, 4M). Fig. 4N reveals no difference in granulation tissue maturation or cellular structure level. Behavioral, visual, and histological assessments in a mouse model of wound healing demonstrated the biocompatibility of the immunosensor for in situ wound monitoring.

[0201] method

[0202] Characterization of mouse TNF-α sensor

[0203] The aptamer sensor showed a decrease in peak current height with increasing target concentration. Figure 14 (Part a). The peak height normalized relative to the analyte-free peak height decreases with the relative decrease in analyte concentration, as shown in [the diagram]. Figure 14 In part b, it is noteworthy that the concentration range of TNF-α in mice is (0-1800 pg / mL). -1 The level is based on the level reported in wound tissue from mouse models.

[0204] Animal program

[0205] Mice were housed in individually ventilated cages with a 12-hour light / dark cycle. They had free access to a standard laboratory diet and water. Male ICR outcrossed mice (IcrTac:ICR, provided by InVivos, Singapore) aged 10–12 weeks and weighing 25–35 g were used in this study. Anesthesia was induced by inhalation of isoflurane (5% mg / kg), which was checked by testing the pedal reflex. The animals' backs were prepared by shaving with an electric hair trimmer, taking care not to cause any trauma with the razor teeth. Depilatory cream was then applied to the shaved skin for 2 minutes. Hair and cream were removed with warm water and gauze. All remaining depilatory cream was wiped away with clean, dry gauze to ensure there was no risk of skin irritation or injury. Animals received subcutaneous injections of buprenorphine (1.5 mg / kg) before injury and daily for three days after injury, including a subcutaneous injection on the day of sensor placement. To create a full-thickness resection wound, the skin on the mouse's back was lifted from the back, and a 6mm biopsy puncturer was used to cut and penetrate the dartos membrane to create the wound. This technique was used to create two bilateral wounds equidistant from the midline and spaced apart on either side of the back. Any blood generated by the surgical procedure was removed using clean, dry gauze. The gauze was only removed once bleeding, which occurred relatively quickly in the mice, had stopped. An immunosensor (8mm in diameter) was placed on one wound, while the other wound served as a control. Wounds in contact with the sensor and controls were randomly assigned. The immunosensor or control was prepared using Tegaderm. TM Small, individual slices of the membrane were applied. Then, a large, single dressing of OPSITE (Smith and Nephew) was used to cover the entire back. The immunosensors were left in situ for 1 hour before reading under anesthesia, allowing the animal to recover in its normal home. The estimated wound exudate volume was 5 μL at a depth of up to 0.43 mm. 3 s -1 The accumulated flow rate was sufficient for sensor reading (Figure 12A). Signal stability was confirmed before measurement when the peak height variation over three consecutive scans was less than 1% (noise level). The immunosensor was then removed and the dressing replaced.

[0206] Tissue processing, sectioning, and staining

[0207] Animals were euthanized via CO2 inhalation, with cervical dislocation used as an auxiliary means of confirming death. Animals were sacrificed on days 1, 3, and 5 post-injury (N=3 at each time point). A large slice of dorsal skin was cut and laid flat on a smooth card. The wound was excised and fixed in 4% paraformaldehyde for at least 24 hours and stored at 4°C. After fixation, the sample was transferred to 70% (v / v) ethanol for 24 hours and then processed in a HistoCore PEARL (Leica) tissue processor. The tissue was subjected to an ethanol concentration gradient (70%, 80%, 95%, 100% × 3, 45 min, 45°C), followed by xylene (3 × 45 min, 45°C) and paraffin (3 × 45 min, 62°C). It was then transferred to a paraffin tissue inserter (HistoCore Arcadia C and H, Leica). 4 μm tissue sections were then produced using a Leica RM2245 microtome and attached to the inserter. Apply to glass slides. Dry these slides at 40°C for at least one hour before staining. Hematoxylin and eosin staining is performed using Leica Autostainer XL (Leica). Organic mounting medium (Sigma) is used to mount the slides.

[0208] Bright-field microscopy and image analysis

[0209] Images of the wounds were captured daily after sensor readings or during dressing changes using a scaled and color-referenced camera (Nikon D5600). Wound area measurements were obtained using ImageJ (NIH). Hematoxylin and eosin (H&E) stained tissues were imaged using an AxioScan.Z1 slide scanner (Zeiss) with 20× objectives. Qualitative examination and image output were performed using ZEN (Zeiss). Further quantitative analysis of the output images was performed using ImageJ. Epidermal thickness was measured 150 μm back from the anterior margin on both sides of each wound, and the values ​​for each sample were averaged. Reepithelialization distance measurements were obtained for each sample by averaging the length of newly grown epidermis from the wound margins on both sides of each wound using ImageJ. Infiltrating immune cells were qualitatively assessed by observing polymorphonuclear cells and macrophages in the dermis at the wound margins on both sides of each wound.

[0210] Example 3: Clinical study of wound exudate from patients with venous ulcers

[0211] result

[0212] To evaluate the clinical application of the immune sensor, the platform was used to analyze wound exudate from venous ulcers to objectively observe wound bed characterization and bioburden (methods). Briefly, wound exudate was collected weekly for five weeks from five patients clinically diagnosed with non-healing venous ulcers (P1–P5). The wound exudate was evaluated using the platform described herein. Figure 5Aa and 5Ab The longitudinal changes in TNF-α, IL-6, IL-8, TGF-β1, Staphylococcus aureus, pH, and wound size are shown. Clearly, the readings of each biomarker varied during the study period. While each patient's wound fluid exhibited a unique longitudinal analysis, some common characteristics were evident. For example, wound fluids in P2 and P3 became less alkaline during weeks 1–3 and weeks 2–5, respectively, indicating a positive response of their wounds to treatment during those periods. P2 (week 3), P4 (week 2), and P5 (week 4) experienced elevated Staphylococcus aureus loads and exhibited more alkaline wound fluids in their subsequent follow-up weeks. These observations are consistent with the reported association between wound infection and pH. P2 exhibited high levels of Staphylococcus aureus; correspondingly elevated IL-6 and IL-8 levels were observed at week 3.

[0213] To assess the impact of wound exudate on sensor performance, the immunosensors were challenged after use using analytes at different high concentrations or pH values. Figures 17A-E show the performance of each aptamer sensor. It was observed that the peak current height of each aptamer sensor further decreased with increasing target concentration, as shown in the insets of Figures 17A-E. Figure 17F shows the similarity performance of the pH sensor to the newly prepared pH sensor. The performance of the immunosensors showed no impairment after exposure to wound exudate.

[0214] Similar responses were observed in P1 (week 3), P3 (week 3), P4 (week 2), and P5 (week 4), with elevated levels of Staphylococcus aureus, IL-6, IL-8, and TNF-α, consistent with observations in keratinocytes. Elevated IL-6 and IL-8 levels were observed in P1 (week 2) and P5 (week 4), which showed increased wound size, consistent with observations in a preliminary study of 10 refractory venous ulcers. Furthermore, the trends of inflammation and colonization in P1 (week 3), P2 (week 3), P4 (week 2), and P5 (week 4) decreased in the following week, suggesting that clinical interventions (e.g., topical dressings impregnated with antimicrobial agents) appear to be effective in reducing microbial load. These multi-biomarker analyses provide comprehensive wound-specific parameters and inform clinical decisions regarding treatment modality and duration. Biomarkers measured by immunosensors were further independently evaluated using standard methods. The levels of cytokines, pH, and Staphylococcus aureus were determined using multiplex ELISA, pH meter, and coagulase-positive staphylococci count (methods). Figure 13A -B presents the longitudinal variation of each biomarker level for each patient. These measurements exhibit characteristics similar to sensor readouts, demonstrating that the immune sensor is capable of reporting objective quantitative data within a clinically relevant range.

[0215] The platform’s multimodal measurement capabilities also enable the assessment of the relationship between these wound bed characterizations and bioburden parameters. Figure 5B Patient-specific correlation matrices are shown, displaying Pearson correlation coefficients between levels of parameters including wound size. A statistically significant positive correlation was observed between IL-6 and IL-8 levels in all patients. Wound fluid reporting a high burden of Staphylococcus aureus was associated with elevated IL-6 and IL-8 levels, consistent with keratinocyte responses to Staphylococcus aureus. The extent or range of correlation between wound size and residual biomarkers is patient-specific, possibly due to sample origin from patients of different sexes, ages, and wound durations. Prospective randomized studies in larger patient cohorts will further validate the prognostic value of these biomarkers in predicting wound healing status. Providing measurements of inflammatory and microbial bioburden that are currently unavailable from single or limited non-inflammatory biomarker sensors, immunosensing systems are expected to serve as a valuable complement to existing clinical medical devices.

[0216] method

[0217] Clinical studies of wound exudate from patients with venous ulcers

[0218] Participants were patients diagnosed with venous ulcers and treated with a four-layer pressure bandage. Patients aged 21 years and older, with an ankle-brachial pressure index (ABPI) ≥0.8, and whose open ulcers between the ankle and knee had failed to reduce in size for more than 12 weeks were eligible to participate. Five patients (3 men and 2 women, aged 57–77 years) were recruited from the vascular clinic and their consent was obtained. Wound exudate was collected weekly using a standard protocol during scheduled weekly dressing changes for five consecutive weeks. Briefly, after removal of the four-layer bandage, the wound was cleaned with saline and covered with a transparent film dressing. The affected leg remained seated for approximately 40 minutes. Accumulated wound exudate from all wounds in the affected leg was aspirated from the transparent film dressing using a hypodermic needle and syringe. Wound fluid sampling was performed prior to conservative debridement, as vascular leakage following conservative debridement could impair biomarker analysis. Ulcer size was measured using a ruler method. Topical dressings impregnated with antimicrobial agents (e.g., cardemerol, nanocrystalline silver) were used for colonized wounds. These were placed on the wound after conservative debridement and before the application of a fresh four-layer bandage. Where applicable, foam dressings were placed under bandages for wounds with excessive exudate. Rapid and simultaneous assessment of wound bed characterization and biomarkers of bioburden in wound exudate was performed using the layered dressings disclosed herein. Wound exudate was also analyzed using conventional methods, on the other hand. Briefly, for cytokine assessment, a custom-designed multiplex ELISA kit from ThermoFisher was used, and the assay was performed on pure samples (neat samples) according to the manufacturer's instructions. Readings were performed using a Luminex 200 with xPONENT 3.1, and cytokine concentrations were determined using a MasterPlex QT 2.0.0.59. Furthermore, the pH of wound fluid samples was measured using a commercial pH meter (LAQUAtwin pH-33, HORIBA). Staphylococcus aureus was detected via coagulase-positive staphylococcal counting. In short, 10 μL of wound exudate was first diluted in 10 mL of LB broth, followed by serial dilutions. 1 mL of the initial dilution and each serial dilution were then mixed with 15 mL of sterile Rapid Staphylococcus aureus agar medium (a mixture of basal medium and potassium-containing egg yolk) for pour plate incubation. After incubation, Staphylococcus aureus formed black colonies on opaque medium, surrounded by a clear halo attributed to egg yolk protein hydrolysis. A colony count of 30–300 Staphylococcus aureus on the Rapid Staphylococcus aureus agar plates was used to estimate the Staphylococcus aureus cell density in the wound exudate samples. Optical images of the Rapid Staphylococcus aureus agar plates used for wound fluid assessment in patients 1–5 are shown below. Figure 15A -E is shown.

[0219] Statistical analysis

[0220] Statistical tests and data visualizations were performed using GraphPad Prism 8 and R (version 3.6.1). The Wilcoxon signed-rank test was used when comparing two groups. A p-value < 0.05 was considered significant. The R packages ggplot2 (version 3.0.0) and GGally (version 1.4.0) were used to plot the correlation matrix.

[0221] Summary of results in Examples 1-3

[0222] This paper discloses the development of an integrated flexible microfluidic multiplex immunosensing system (layered dressing) that allows for the simultaneous monitoring of multiple biomarker profiles using advanced sensor layouts, functionalization technologies, and wireless, flexible electronics. A platform was designed for in-situ inquiry into wound healing in patients with venous ulcers. This platform incorporates a layered dressing consisting of a permeable (perforated) wound contact layer, a microfluidic fluid collection layer, a biosensor array (immunosensors), and a breathable barrier layer into a small integrated unit suitable for direct application to skin wounds. A biomimetic passive fluid collection layer was developed to facilitate accurate and efficient in-situ identification of clinically relevant fluids. A directional fluid delivery system formed by a polar-axis array of interconnected, semi-open, serrated capillary channels with reduced widths facilitates efficient wound fluid accumulation for wound fluid analysis. The immunosensor array simultaneously quantifies multiple clinically relevant biomarkers (TNF-α, IL-6, IL-8, TGF-β1, pH, temperature) and bioburden (Staphylococcus aureus) within minutes. The cytokine sensor characterizes selectivity, specificity, and reproducibility with minimal interference. The pH sensor is characterized by linearity, repeatability, and reproducibility. Importantly, the immunosensor array is scalable and easily adaptable to meet a variety of potential applications. This immunosensor reveals the ability to perform in situ assessment of multiple biomarkers and biocompatibility in a mouse model of wounds. A portable wireless analyzer was also designed to connect to the immunosensor. Finally, an accompanying application with a GUI was developed to help manage patient data and medical records, while facilitating data collection, analysis, and visualization to integrate the immunosensor platform with existing patient records and enable rapid on-site clinical decision-making. As a proof of principle, a layered dressing was applied to assess wound exudate collected from patients with unhealed venous ulcers, once weekly for five consecutive weeks. Graphical depictions of clinically relevant indicators of healing and bioburden were used as a combined diagnostic / prognostic tool for better and more precise clinical management of patients and their wounds. The layered dressing provides rapid and immediate access to multiple quantitative clinical measurements. Unbound by theory, the platform represents the first class of functionality for its on-the-go devices, capable of providing accurate and relevant personalized clinical diagnostic information to address the unmet needs of numerous individuals suffering from non-healing chronic ulcers (e.g., venous ulcers, diabetic foot ulcers, pressure ulcers). The simplicity of the design allows the layered dressing to be robust, adaptable, and customizable.Layered dressings are easily reconfigurable to detect other skin bacteria (e.g., Enterococcus faecalis, Pseudomonas aeruginosa, Staphylococcus epidermidis, Corynebacterium spp.), allowing pathogen-infected wounds to be layered with wounds colonized by symbiotic organisms. Furthermore, and not bound by theory, sensor technology is thought to allow alternative sets of biomarkers for a variety of applications requiring multiplex analysis; for example, in diagnostic pathology and high-content screening. The layered dressings discussed in this paper are easily reconfigurable to detect other skin bacteria (e.g., Enterococcus faecalis, Pseudomonas aeruginosa, Staphylococcus epidermidis, Corynebacterium spp.), allowing pathogen-infected wounds to be layered with wounds colonized by symbiotic organisms.

Claims

1. A layered dressing comprising: A permeable wound contact layer, which is placed in contact with the wound; Breathable barrier layer; A fluid collection layer is disposed between the wound contact layer and the breathable barrier layer. The fluid collection layer includes a biosensor housing portion and a fluid collection portion. The fluid collection portion includes a plurality of channels, each channel having an end at the biosensor housing portion. as well as A biosensor sensing array, comprising one or more electrodes, is disposed between the biosensor housing portion of the fluid collection layer and the air-permeable barrier layer. in: The channels in the fluid collection portion of the fluid collection layer are configured such that, in use, the channels deliver wound fluid from the wound in contact with the wound contact layer to the biosensor sensing array via capillary action, wherein the biosensor sensing array is configured to detect one or more markers in the wound fluid; and The multiple channels do not have a uniform width along their entire length.

2. The layered dressing of claim 1, wherein the wound contact layer comprises a plurality of perforations.

3. The layered dressing according to claim 1 or 2, wherein the fluid collection portion of the fluid collection layer has an annular shape, the annular shape having an outer surface, wherein the annular shape defines a central portion, and wherein the biosensor housing portion of the fluid collection layer is located at the central portion.

4. The layered dressing of claim 3, wherein the fluid collection portion has an outer surface, and wherein each of the plurality of channels extends from the outer surface of the fluid collection portion to the biosensor housing portion.

5. The layered dressing according to claim 1 or 2, wherein the plurality of channels are configured such that fluid from the wound flows along the channels in only one direction.

6. The layered dressing of claim 5, wherein each of the plurality of channels comprises a plurality of interconnected semi-open serrated capillary channels.

7. The layered dressing of claim 1, wherein the channel comprises a first portion and a second portion, the first portion being configured to aspirate fluid from a wound in contact with the wound contact layer, the second portion being closer to the biosensor array than the first portion, wherein the width of the channel at the first portion is greater than the width of the channel at the second portion.

8. The layered dressing of claim 7, wherein the channel comprises a first end and a second end, wherein the width of the channel at the first end is 180 μm to 220 μm, and the width of the channel at the second end is 140 μm to 180 μm.

9. The layered dressing of claim 1 or 2, wherein the biosensor array comprises one or more electrodes, each configured to detect a biomarker selected from the group consisting of healing biomarkers and bioburden biomarkers.

10. The layered dressing according to claim 9, wherein the healing biomarker is selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β1 and pH.

11. The layered dressing of claim 9, wherein the biomarker of the bioload includes a biomarker of Staphylococcus aureus.

12. The layered dressing of claim 9, wherein the biosensor array comprises two or more electrodes, each configured to detect a biomarker selected from the group consisting of biomarkers of TNF-α, IL-6, IL-8, TGF-β1, pH and Staphylococcus aureus.

13. The layered dressing of claim 12, wherein the biosensor array comprises six electrodes, each configured to detect a biomarker selected from the group consisting of TNF-α, IL-6, IL-8, TGF-β1, pH and Staphylococcus aureus, such that the biosensor array is capable of simultaneously detecting TNF-α, IL-6, IL-8, TGF-β1, pH and Staphylococcus aureus biomarkers.

14. The layered dressing according to any one of claims 11 to 13, wherein the biomarker of Staphylococcus aureus is an epitope.

15. The layered dressing of claim 1, wherein the biosensor sensing array comprises one or more aptamer-based working electrodes, each of the aptamer-based working electrodes comprising an aptamer bonded to the electrode, wherein the aptamer is adapted to detect markers in the wound fluid.

16. The layered dressing of claim 15, wherein the one or more aptamer-based working electrodes comprise aptamers of IL-8, IL-6, TNF-α, TGF-β1 and / or Staphylococcus aureus.

17. The layered dressing of claim 16, wherein any one of the following is used: (a) The aptamer sequence of IL-8 5'- / 5ThioMC6-D / rGrGrGrGrGrCrUrUrArUrCrArUrUrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArArCrC / 3MeBlN / -3'; and / or (b) The aptamer sequence of IL-6 5'- / 5ThioMC6-D / GGTGGCAGGAGGACTATTTATTTGCTTTTCT / 3MeBlN / -3'; and / or (c) The aptamers of TNF-α include the sequence and / or (d) The aptamers of TGF-β1 include the sequence and / or (e) The aptamers of Staphylococcus aureus include the sequence 5'- / 5ThioMC6-D / TCGGCACGTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC / 3MeBlN / -3'.

18. The layered dressing according to claim 17, wherein: (a) The aptamer sequence of IL-8 5'- / 5ThioMC6-D / rGrGrGrGrGrCrUrUrArUrCrArUrUrCrArUrUrUrArGrUrGrUrUrArUrGrArUrArArCrC / 3MeBlN / -3'; and / or (b) The aptamers of IL-6 include the sequence 5'- / 5ThioMC6-D / GGTGGCAGGAGGACTATTTATTTGCTTTCT / 3MeBlN / -3'.

19. A layered dressing according to any one of claims 15 to 18, wherein the adaptor includes a first end region and a second end region, wherein the adaptor is bonded to the electrode via the first end region.

20. The layered dressing of claim 19, wherein the surface of one or more aptamer-based working electrodes comprises an electrochemically exfoliated graphene-gold nanoparticle (AuNPs-GP) nanocomposite layer.

21. The layered dressing of claim 20, wherein the aptamer is bonded to the surface of the electrode via a gold-thiol bond.

22. The layered dressing according to any one of claims 15 to 18, wherein the adaptor is conjugated with a redox marker, optionally wherein the redox marker is methylene blue.

23. The layered dressing of claim 22, wherein the aptamer includes a first end region and a second end region, wherein the aptamer is bonded to the biosensor via the first end region and the aptamer is conjugated to the redox marker via the second end region.

24. The layered dressing according to claim 1 or 2, wherein the biosensor array comprises a polyaniline pH sensor.

25. The layered dressing of claim 1 or 2, wherein the biosensor array comprises a temperature sensor, optionally wherein the temperature sensor comprises a Wheatstone bridge.

26. The layered dressing according to claim 1 or 2, wherein the biosensor array is capable of wirelessly transmitting measurement data to a paired device.

Images