A method for improving the acetate tolerance and lipid accumulation of oil-producing microorganisms by using acetyl-CoA synthetase (ACS)

By overexpressing the acetyl-CoA synthetase MaACS2 in Acetamoto and optimizing the acetyl-CoA metabolic pathway, the problem of low tolerance to acetate by Acetamototoxin was solved, significantly improving lipid accumulation and PUFAs yield, and improving the production performance and economic benefits of the strain.

CN115838641BActive Publication Date: 2025-06-24JIANGNAN UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202211634866.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-19
Publication Date
2025-06-24
Estimated Expiration
2042-12-19

AI Technical Summary

Technical Problem

The low tolerance to acetate during fermentation of Alpine Spermia leads to reduced lipid accumulation and PUFAs yield, affecting the production performance and economic benefits of the strain.

Method used

By overexpressing the acetyl-CoA synthetase MaACS2 in Alpine, and optimizing the acetyl-CoA metabolic pathway with the help of the CRISPR/Cpf1 multigene operating system, the strain's tolerance to acetate and lipid accumulation ability are improved.

Benefits of technology

It significantly improves the tolerance of Alpine Sorbaceous to acetate, enhances lipid accumulation and PUFAs yield, and improves the production performance and economic benefits of the strain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115838641B_ABST
    Figure CN115838641B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for improving the acetate tolerance and lipid accumulation of oil-producing microorganisms by using acetyl-CoA synthetase (ACS), belonging to the technical fields of genetic engineering and microbial engineering. In the present invention, the endogenous constitutive MaACS is overexpressed in Mortierella alpina, improving the acetate tolerance, lipid production and the proportion of polyunsaturated fatty acids (PUFAs) represented by arachidonic acid (ARA) of the recombinant strain, and a medium with ammonium acetate as the nitrogen source is used to further improve its lipid accumulation. The present invention also further optimizes the acetyl-CoA metabolic pathway by using the CRISPR / Cpf1 multi-gene operating system, and co-expresses citrate lyase (ACL1) while overexpressing the MaACS to further strengthen the supply of acetyl-CoA, or expresses glucose-6-phosphate dehydrogenase (G6PD2) to balance the supply of reducing power NADPH to avoid the spillage of acetyl-CoA, or knockdowns the SNF1γ subunit of the sucrose non-fermenting protein kinase complex that negatively regulates lipid accumulation to improve the activity of acetyl-CoA carboxylase 1 (ACC1).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for improving acetate tolerance and lipid accumulation of oil-producing microorganisms by utilizing acetyl-CoA synthetase (ACS), and specifically relates to an acetyl-CoA synthetase and application thereof in producing oils and fats rich in polyunsaturated fatty acids. The invention also relates to a method for optimizing the acetyl-CoA metabolic pathway by utilizing a multi-gene operating system, thereby improving the lipid accumulation capacity of Mortierella alpina, and belongs to the technical fields of genetic engineering and microbial engineering. Background Art

[0002] The intake level of polyunsaturated fatty acids (PUFAs) is an important indicator of dietary quality. Humans primarily obtain PUFAs from deep-sea fish and vegetable oils in their diet. With the rise of the biomanufacturing industry, oil-producing microorganisms have become an important source of dietary PUFAs, primarily including algae (Schizochytrium cohnii and Crypthecodinium cohnii) and filamentous fungi (Mortierella alpina and Mucor circinelloides). Crypthecodinium cohnii is the primary commercial producer of docosahexaenoic acid (DHA), while Mortierella alpina is the only commercial producer of arachidonic acid (ARA). These oils and fats are primarily used as nutritional supplements in infant formula.

[0003] In recent years, more and more lipid synthesis pathways and mechanisms of oil-producing microorganisms have been elucidated, and relatively complete omics research methods and genetic manipulation systems have been developed, providing clearer directions for fermentation scheme design and genetic modification to increase the production of target fatty acids. When using oil-producing microorganisms to produce oils rich in PUFAs, culture conditions and product yields are important factors to consider. Therefore, researchers mainly explore the factors affecting the selection of carbon and nitrogen sources, the improvement of strain production performance and the yield of target products. Using low-cost carbon and nitrogen sources as substrates for bacterial growth and lipid production, and converting more carbon flow into acetyl-CoA for fatty acid synthesis, is the most effective way to improve strain production performance and product economic benefits.

[0004] For example, when fermenting Mortierella alpina with common nitrogen sources such as ammonium sulfate or ammonium tartrate, the pH of the culture broth drops below 4 in the late stages of fermentation. However, it has been previously demonstrated that fatty acid desaturation and elongation processes are more optimally performed at a pH above 6. Excessively low pH inhibits the conversion of very-long-chain PUFAs, reducing strain productivity and product economics. Currently, all fermentation technologies rely on real-time monitoring of the fermentation broth to automatically adjust or maintain pH, which places limitations on process control and equipment. Recent metabolomics studies based on liquid chromatography-mass spectrometry (LC-MS / MS) have shown that during fermentation, oil-producing microorganisms such as Mortierella alpina produce small amounts of acetic acid, which is highly biotoxic. Acetate levels as low as 10 mmol / L inhibit growth, shorten the lipid accumulation period, and affect product yield. Similar issues exist in the oil-producing algae Crypthecodinium cohnii.

[0005] Therefore, optimizing the nitrogen source in the fermentation process of Mortierella alpina, finding a more convenient and efficient method to adjust the pH of the fermentation broth, and improving the tolerance of microorganisms to metabolites are of great significance for enhancing the lipid production of the bacteria, reducing the fermentation cost, and increasing the proportion of economically beneficial very-long-chain PUFAs.

[0006] Acetyl-CoA synthetase (ACS), also known as acetate-coenzyme A ligase, participates in the following reaction: with the participation of ATP, the intermediate acetyl-AMP is first synthesized, and then acetyl-AMP is linked to CoA in the form of a high-energy thioester bond to generate acetyl-CoA, while releasing a molecule of AMP and pyrophosphate. Therefore, ACS is also called AMP-forming acetyl-CoA synthetase.

[0007] ATP+Acetate+CoA<=>AMP+PPi+Acetyl-CoA

[0008] ACS is widely present in prokaryotes and eukaryotes and is an important node in lipid and acetate metabolism. It has been reported that overexpression of ACS in bacteria results in the conversion of acetate into acetyl-CoA in large quantities, thereby supporting the subsequent glycolysis pathway, fatty acid metabolism, amino acid metabolism and gluconeogenesis, and accelerating cell growth and the accumulation of acetyl-CoA derivatives. The most important research on ACS focuses on its mechanism of influence on tumor cell survival: in cancer cells with scarce glucose and oxygen supply, highly expressed ACS uses the byproduct acetate to synthesize acetyl-CoA to activate the fatty acid synthesis pathway, which serves as an additional nutrient source to maintain tumor cell survival. However, the function of microbial ACS in lipid metabolism has been less studied because, compared with the glycolysis pathway using glucose as a carbon source, the ACS pathway is not the main source of acetyl-CoA in microbial cells.

[0009] In eukaryotes, the transcription of ACSs is regulated by the intracellular carbon source. The ACS1 promoter is an inducible promoter, and its gene expression is repressed in the presence of glucose, but can be activated by acetate (salt) in the absence of glucose. The transcription of ACS2 is regulated by its upstream constitutive promoter and is not affected by external nutrient levels. A similar phenomenon occurs in bacteria, and studies have confirmed that ACS2 is also involved in the transcriptional regulation of ACS1. ACSs have different subcellular localizations depending on the species. ACSs present in the cytoplasm participate in the synthesis of acetyl-CoA, while ACSs present in mitochondria and peroxisomes participate in the oxidation of fatty acids.

[0010] Mortierella alpina is an oil-producing filamentous fungus with a strong lipid biosynthesis capacity and is currently the only commercial producer of arachidonic acid (ARA). During fermentation, pH and nitrogen source have a significant impact on lipid accumulation and composition in Mortierella alpina. Furthermore, metabolomics data show that a small amount of acetic acid is produced and secreted extracellularly at the end of fermentation. This acetic acid not only reduces the bacterial cell's glucose utilization but also has a certain impact on bacterial growth. Furthermore, some cellulose / lignin hydrolysates have been reported as good carbon sources. However, because they contain toxic substances such as acetic acid, they have high requirements for bacterial tolerance and limited application. Therefore, it is urgent to find a method to improve Mortierella alpina's acetate tolerance, enhance lipid accumulation, and improve PUFA yield. This is of great significance for further improving strain production performance, broadening the application range of carbon sources, and stabilizing culture conditions. Summary of the Invention

[0011] Analysis of the Mortierella alpina ATCC 32222 genome revealed two AMP-forming ACS genes, Maacs1 and Maacs2, in Mortierella alpina, sharing 85% identity. Bioinformatics analysis revealed that MaACS1 and MaACS2 have molecular weights of 72.2 kDa and 72.1 kDa, with isoelectric points of 6.51 and 6.62, respectively. Their major structural domains include an adenosine monophosphate (AMP) binding domain, a coenzyme A binding domain, and an activation site. Subcellular localization revealed that both MaACS1 and MaACS2 are cytoplasmic proteins lacking a mitochondrial targeting signal peptide. Transcriptome and proteome data from Mortierella alpina revealed that both Maacs1 and Maacs2 are normally transcribed and translated under glucose as the sole carbon source, but the transcript and protein expression levels of Maacs2 are significantly higher than those of Maacs1, suggesting that it may be the primary ACS in Mortierella alpina. However, there are few studies on the functional identification of ACS from oil-producing microorganisms such as Mortierella alpina, and no reports have been reported on their functional investigations in acetate utilization and enhanced lipid accumulation.

[0012] The present invention provides a recombinant strain, which uses Mortierella alpina as a host and overexpresses acetyl-CoA synthetase with an amino acid sequence as shown in SEQ ID No. 1.

[0013] In one embodiment, the recombinant bacterium further knocks down or inhibits the γ subunit of sucrose non-fermenting protein kinase, overexpresses citrate lyase and / or overexpresses glucose-6-phosphate dehydrogenase 2.

[0014] In one embodiment, the amino acid sequence of the citrate lyase is shown as SEQ ID No.9, the amino acid sequence of the glucose-6-phosphate dehydrogenase 2 is shown as SEQ ID No.10, and the amino acid sequence of the γ subunit of the sucrose non-fermenting protein kinase is shown as SEQ ID No.11.

[0015] In one embodiment, the nucleotide sequence encoding the acetyl-CoA synthetase gene is shown as SEQ ID No. 2.

[0016] In one embodiment, the recombinant strain uses the pBIG2-ura5s_ITs plasmid as an expression vector.

[0017] In one embodiment, the pBIG2-ura5s_ITs vector is described in the patent application with publication number CN103571762A.

[0018] In one embodiment, the pBIG2-ura5s_ITs plasmid carries a protein tag.

[0019] In one embodiment, the protein tag comprises myc, whose amino acid sequence is shown in SEQ ID No. 3, or flag, whose amino acid sequence is shown in SEQ ID No. 4.

[0020] In one embodiment, the recombinant strain is based on Mortierella alpina MA-Pcbh1-LbCpf1-ura5 - or CCFM501 as the host.

[0021] In one embodiment, the Mortierella alpina CCFM 501 is described in the patent application with the authorization number ZL201310347934.8, and the Mortierella alpina MA-Pcbh1-LbCpf1-ura5 - It is recorded in the patent application with publication number CN112592926A.

[0022] The present invention also provides an application of acetyl-CoA synthetase in regulating lipid synthesis in oil-producing microorganisms. The application comprises using ammonium salt as a nitrogen source, adding 0 to 30 mmol / L of acetate, and overexpressing the acetyl-CoA synthetase with an amino acid sequence as shown in SEQ ID No. 1.

[0023] In one embodiment, the concentration of the ammonium salt is 12 to 21 mmol / L.

[0024] In one embodiment, the concentration of acetate is 12 to 30 mmol / L.

[0025] In one embodiment, the oleaginous microorganism comprises Mortierella alpina.

[0026] In one embodiment, the recombinant strain is based on Mortierella alpina MA-Pcbh1-LbCpf1-ura5 - or CCFM501 as the host.

[0027] In one embodiment, the Mortierella alpina CCFM 501 is described in the patent application with the authorization number ZL201310347934.8, and the Mortierella alpina MA-Pcbh1-LbCpf1-ura5 - It is recorded in the patent application with publication number CN112592926A.

[0028] In one embodiment, the lipid comprises a phospholipid, a triglyceride, arachidonic acid, or a free fatty acid.

[0029] The present invention also provides a whole-cell catalyst containing the above-mentioned recombinant strain.

[0030] The present invention also provides a method for synthesizing lipids, which comprises using the above-mentioned recombinant strain or the above-mentioned whole-cell catalyst as a fermentation strain to synthesize lipids in a fermentation system containing acetate and ammonium salt.

[0031] In one embodiment, the fermentation system contains 20-80 g / L glucose, 1-2 g / L yeast extract, 5-10 g / L potassium dihydrogen phosphate, 1.5-2.5 g / L disodium hydrogen phosphate, 1-2 g / L magnesium sulfate heptahydrate, 0.08-0.12 g / L calcium chloride dihydrate, and trace elements, 12-21 mmol / L ammonium salt, and 0-30 mmol / L acetate.

[0032] In one embodiment, the concentration of acetate is 12 to 30 mmol / L.

[0033] In one embodiment, the ammonium salt comprises ammonium acetate and / or ammonium tartrate.

[0034] In one embodiment, the acetate salt comprises sodium acetate.

[0035] In one embodiment, the concentration of trace elements is: 0.001 g / L ferric chloride heptahydrate, 0.0001 g / L zinc sulfate heptahydrate, 0.0001 g / L copper sulfate pentahydrate, 0.0001 g / L cobalt nitrate, and 0.0001 g / L manganese sulfate pentahydrate.

[0036] The present invention also provides the use of the above-mentioned recombinant strain or the above-mentioned whole-cell catalyst or the above-mentioned method in lipid production.

[0037] The present invention also provides a method for extracting total protein from oil-producing microorganisms, which comprises grinding the recombinant bacteria with liquid nitrogen, precipitating the bacteria with pre-cooled acetone containing 10% trichloroacetic acid (TCA) to remove metabolites, extracting protein with urea extract, and then adding icy acetone to precipitate the sample to obtain total protein suitable for immunoblotting analysis.

[0038] In one embodiment, the specific steps of the method are:

[0039] (1) Grind wet bacterial cells into powder using liquid nitrogen;

[0040] (2) Add pre-cooled 10% TCA / acetone (w / v), shake and mix, then place at 18-22°C overnight for precipitation, centrifuge and discard the supernatant;

[0041] (3) Add pre-cooled ice acetone, shake and mix, then place it at -18 to -22 ° C to precipitate for 1.5 to 2.5 hours, centrifuge and discard the supernatant, repeat 2 to 3 times, and dry until the acetone is completely evaporated.

[0042] (4) Add urea extract, shake thoroughly to dissolve, and place in a constant temperature incubator at 26-30°C for 0.5-1.5 hours. Mix once every 15-30 minutes, centrifuge, take the supernatant, add urea extract to the precipitate, repeat this step, and take the supernatant and combine it;

[0043] (5) Add 4.5 to 5.5 times the volume of glacial acetone to the supernatant, mix well, and precipitate for at least 1.5 to 2.5 hours or overnight. After centrifugation, wash with glacial acetone 2-3 times. After drying, dissolve with 8M urea to obtain total protein.

[0044] In one embodiment, the urea extract contains 150 mmol / L Tris-HCl pH 8.0, 6.0-9.0 mol / L urea, 0.5-1.0% (w / v) sodium dodecyl sulfate (SDS), 10-65 mmol / L dithiothreitol (DTT) and protease inhibitor (PMSF).

[0045] The present invention also provides application of the above method in protein immunoassay detection of oil-producing microorganisms.

[0046] Beneficial effects:

[0047] According to the present invention, the addition of acetate is beneficial to the lipid accumulation and PUFAs synthesis of Mortierella alpina, but 10 mmol / L of acetate will cause certain growth inhibition on the bacteria. In order to solve this problem, the present invention overexpresses acetyl-CoA synthase MaACS2 in Mortierella alpina, and screens out recombinant Mortierella alpina with stronger acetate tolerance. After culturing for 48 hours under the condition of 21 mmol / L ammonium acetate as the nitrogen source, the biomass is 1.68 to 1.83 times that of the wild-type strain (p < 0.05). At the end of fermentation, the average total biomass reaches 13.4±0.5 g / L, and the average total lipid yield is 5.9±0.3 g / L, which are 1.21 times and 1.44 times that of the wild-type strain, respectively. Because ammonium acetate has good pH buffering properties, the natural pH value of the fermentation broth is stable at 6.3-6.5, which significantly promotes the synthesis of PUFAs. The arachidonic acid (ARA) production in the MaACS2 recombinant strain increased to 2.8g / L, which is 5.3 times that of the wild-type strain when using ammonium tartrate as the nitrogen source. On this basis, the CRISPR / Cpf1 multi-gene operating system further enhanced the cytoplasmic acetyl-CoA supply (ACL1), strengthened the reducing power NADPH supply (G6PD2), and indirectly increased the activity of acetyl-CoA carboxylase (ACC1) to promote lipid accumulation (SNF1-γ subunit interference). By optimizing the acetyl-CoA synthesis and consumption pathways to balance its supply and directing acetyl-CoA flow to the lipid synthesis pathway, the lipid accumulation capacity of Mortierella alpina was optimized. This protocol also provides a protein extraction method suitable for oil-producing microorganisms. The determination of protein expression levels by western blot can more rationally explore the function of the target gene itself and can eliminate the influence of the insertion site on protein expression levels. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 PCR verification results of the genome of transformants of the recombinant Mortierella alpina Maacs2 strain (MA-Maacs2). M, marker; N, control group, i.e., prototrophic Mortierella alpina transformed with an empty plasmid; the rest are transformants.

[0049] Figure 2 , Preliminary screening results of transformants of recombinant Mortierella alpina Maacs2 (MA-Maacs2), with the control group being wild-type Mortierella alpina ATCC 32222. * indicates data are significantly different from the control group, and ns indicates not significant.

[0050] Figure 3Figure 2. Growth and lipid production of recombinant Mortierella alpina Maacs2 strains at different time points in medium containing ammonium acetate as the nitrogen source. The control group was wild-type Mortierella alpina ATCC 32222. Asterisks indicate data that are significantly different from the control group (wild-type strain at the same time point), and ns indicates not significant.

[0051] Figure 4 , the expression levels of target protein MaACS2 protein of recombinant Mortierella alpina Maacs2 at different time points in culture medium with ammonium acetate as nitrogen source, and the control group was wild-type Mortierella alpina ATCC 32222 (N).

[0052] Figure 5 Optimization of the acetyl-CoA metabolic pathway in Mortierella alpina using the CRISPR / Cpf1 multigene manipulation system. Growth and lipid production information of the recombinant strain. A, B, Total biomass of the recombinant strain when Maacs2 and Mag6pd2 are co-overexpressed; C, D, Total biomass and fatty acid content of the recombinant strain when Maacs2 and Maacl1 are co-overexpressed; E, F, Total biomass and fatty acid content of the recombinant strain when Maacs2 and Masnf4Ri are co-overexpressed. DETAILED DESCRIPTION

[0053] The Mortierella alpina ATCC 32222 involved in the following examples was purchased from the American Type Culture Collection (ATCC); the Agrobacterium tumefaciens AGL-1 involved in the following examples was purchased from Beijing Huayueyang Biological; the Escherichia coli DH5α involved in the following examples was purchased from Invitrogen; the pBIG2-ura5s_ITs vector involved in the following examples is described in the patent application with publication number CN103571762A; the Mortierella alpina MA-Pcbh1-LbCpf1-ura 5- Described in the patent application text with publication number CN112592926A; the following G6PD2 and SNF1γ subunit related expression vectors are respectively described in publication numbers CN105368727A (G6PD2, amino acid sequence as shown in SEQ ID NO.10, nucleotide sequence as shown in SEQ ID NO.13) and CN110656097A (SNF1γ subunit interference vector, amino acid sequence as shown in SEQ ID NO.11, nucleotide sequence as shown in SEQ ID NO.14), the amino acid sequence of ACL1 is shown in SEQ ID NO.9, and the nucleotide sequence is shown in SEQ ID NO.12.

[0054] Method for multi-gene expression in Mortierella alpina, engineered strain Mortierella alpina MA-Pcbh1-LbCpf1-ura with multi-gene operating system 5- , uracil targeted knockout and recovery methods and related culture media are described in the patent application text with publication number CN112592926A.

[0055] The KOD plus high-fidelity DNA polymerase involved in the following examples was purchased from Toyobo, Japan; the Taq DNA polymerase involved in the following examples was purchased from CWBIO; the reverse transcription kit (PrimeScript RT regent Kit with gDNA Eraser RR047A&R6110A) involved in the following examples was purchased from Takara, Japan; the plasmid extraction kit involved in the following examples was purchased from Beijing Tiangen Biochemical Technology Co., Ltd.; the fungal genomic DNA extraction kit involved in the following examples was purchased from BioFlux; the restriction endonucleases, T4 ligase, Trizol, PCR product purification kit, gel recovery kit, GeneRuler DNA Ladder Mix, and PageRuler Prestained Protein Ladder involved in the following examples were purchased from Thermo Fisher Scientific. The n-pentadecanoic acid (C15:0), ammonium acetate, sodium acetate, and microcrystalline cellulose involved in the following examples were purchased from Sigma; DEPC water, kanamycin (Kana), rifampicin (Rif), spectinomycin (Spe), cefotaxime sodium (Cef), amino-free yeast nitrogen source (YNB), and various amino acids involved in the following examples were purchased from Shanghai Bioengineering Co., Ltd.; the yeast involved in the following examples were purchased from Shanghai Bioengineering Co., Ltd. The mother extract and tryptone were purchased from Oxoid; the low-adsorption enzyme-free pipette tips, enzyme-free centrifuge tubes, enzyme-free PCR tubes, 2 mL brown gas phase bottles and bottle caps involved in the following examples were purchased from Suzhou Keqing Biological Company; the inducing conversion agents acetosyringone (Acetosuringone, AS, CAS#[2478-38-8]), 2-(N-morpholino)ethanesulfonic acid (MES buffer, CAS#[145224-94-8]), uracil (Urail), 5-fluorouracil, yeast nitrogen source (Yeast Nitrogen Base, WITHOUT Amino Acids CAS#[A610507-0500] Lot: C418BA0040) and various amino acids involved in the following examples were purchased from Sangon Biotech (Shanghai) Co., Ltd.; other reagents were purchased from Sinopharm Group.

[0056] The vector construction and bacterial competent cell preparation involved in the following examples are all referred to the Handbook of Molecular Cloning.

[0057] The primers and sequencing work involved in the following examples were completed by Shanghai BGI Genomics Co., Ltd.

[0058] Mortierella alpina ATCC 32222, Agrobacterium tumefaciens AGL-1, and Escherichia coli DH5α are all commercially available and do not require deposit for patent procedures.

[0059] The culture medium involved in the following examples is as follows:

[0060] Broth medium: 20 g / L (activated) / 30 g / L (lipid production) glucose, 5 g / L yeast extract, 1 g / L potassium dihydrogen phosphate, 0.25 g / L magnesium sulfate heptahydrate, and 10 g / L potassium nitrate.

[0061] Kendrick medium: 20 g / L (for activation) / 30 g / L (for lipid production) glucose; 3.3 g / L ammonium tartrate (for activation) / 1.67 g / L ammonium acetate (for lipid production), 1.5 g / L yeast extract, 7 g / L dipotassium hydrogen phosphate, 2.0 g / L potassium dihydrogen phosphate, 1.5 g / L magnesium sulfate heptahydrate, 0.1 g / L calcium chloride dihydrate, and trace elements.

[0062] Among them, the trace element concentrations are: 0.001g / L ferric chloride heptahydrate, 0.0001g / L zinc sulfate heptahydrate, 0.0001g / L copper sulfate pentahydrate, 0.0001g / L cobalt nitrate, and 0.0001g / L manganese sulfate pentahydrate;

[0063] The ammonium nitrogen in Kendrick medium (lipid production) can also be replaced by 2.0 g / L ammonium tartrate instead of 1.67 g / L ammonium acetate, and 12 to 30 mmol / L acetate (sodium acetate) can be added.

[0064] GY medium: 20 g / L glucose, 10 g / L yeast extract, 2 g / L potassium nitrate, 1 g / L sodium dihydrogen phosphate, 3 g / L magnesium sulfate heptahydrate, and 20 g / L agar powder.

[0065] GY auxotrophic strain selection medium (GYU-F) is used to screen for uracil-deficient strains: Add 0.5g / L 5-fluorouracil (5-FOA) and 0.1g / L uracil to GY medium. Dissolve 5-FOA in dimethyl sulfoxide and sterilize it by filtration through a 0.22μm organic filter. After sterilization and cooling, add the medium and store in the dark.

[0066] MM induction knockout medium (induces the Pcbh1 promoter and nuclease, and knocks out the uracil selection marker): 3 g / L microcrystalline cellulose, 4 g / L potassium dihydrogen phosphate, 2.8 g / L ammonium sulfate, 0.6 g / L magnesium sulfate heptahydrate, 0.5 g / L calcium chloride, 0.6 g / L urea, 3 g / L tryptone, 1 ml / L Tween 80, 5 g / L calcium carbonate, 0.01 g / L ferrous sulfate heptahydrate, 0.0032 g / L manganese sulfate monohydrate, 0.0028 g / L zinc sulfate heptahydrate, and 0.004 g / L cobalt chloride.

[0067] MM basal medium: 1.74 g / L potassium hydrogen phosphate, 1.37 g / L potassium dihydrogen phosphate, 0.146 g / L sodium chloride, 0.49 g / L magnesium sulfate heptahydrate, 0.078 g / L calcium chloride, 0.53 g / L ammonium sulfate, 1.8 g / L glucose, 10 mL / L ferric sulfate heptahydrate (100×), 5 mL / L glycerol. After sterilization, filter-filtered MES buffer was added to a final concentration of 7.8 g / L.

[0068] IM induction medium (for Agrobacterium tumefaciens-mediated transformation): Based on MM medium, make slight adjustments by adding 0.1 g / L uracil and 0.9 g / L glucose, while keeping the rest unchanged. Before use, add 100 μg / mL acetosyringone (AS) and 7.8 g / L MES. When used for solid culture medium, add 20 g / L agar strips. IM medium with AS should be stored in the dark.

[0069] SC screening medium: 20 g / L glucose, 5 g / L amino-free yeast nitrogen source, 1.7 g / L ammonium sulfate, 10 mL / L amino acid stock solution (100×), and 20 g / L agar.

[0070] SC-CS medium (for transformant screening): 20 g / L glucose, 5 g / L amino-free yeast nitrogen base, 1.7 g / L ammonium sulfate, 10 mL / L amino acid stock solution (100×), 20 g / L agar, and 100 μg / mL cefotaxime and 100 μg / mL spectinomycin were added before pouring.

[0071] Among them, amino acid mother solution: 60mg / L isoleucine, 60mg / L leucine, 60mg / L phenylalanine, 50mg / L threonine, 40mg / L lysine, 30mg / L tyrosine, 20mg / L adenine, 20mg / L arginine, 20mg / L histidine, 10mg / L methionine.

[0072] SOC recovery medium: 20 g / L tryptone, 5 g / L yeast extract, 0.5 g / L sodium chloride, 0.186 g / L potassium chloride, 0.95 g / L magnesium chloride, and 3.6 g / L glucose.

[0073] LB liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 100 μg / mL kanamycin added before use.

[0074] LB solid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 20 g / L agar, and 100 μg / mL kanamycin was added before use.

[0075] YEP liquid medium: 10 g / L yeast extract, 10 g / L trypsin, 5 g / L sodium chloride. Add 100 μg / mL kanamycin and 100 μg / mL rifampicin before use. Store in the dark.

[0076] YEP solid medium: 10 g / L yeast extract, 10 g / L trypsin, 5 g / L sodium chloride, 20 g / L agar. Add 100 μg / mL kanamycin and 100 μg / mL rifampicin before use. Store in the dark.

[0077] Protein extraction solution: 8 mol / L urea, 1% (w / w) sodium dodecyl sulfate, 65 mmol / L dithiothreitol, 150 mmol / L Tris-HCL pH 8.0, 1‰ (v / v) protease inhibitor PMSF.

[0078] Example 1: Screening and cloning of genes encoding acetyl-CoA synthetase

[0079] The specific steps are as follows:

[0080] Based on the EC number (6.2.1.1) for acetyl-CoA synthetase, we screened and compared the gene library of the fully sequenced and assembled M. alpina ATCC 32222 strain to identify candidate target genes. We screened for normally transcribed and expressed candidate genes based on transcriptome and proteome information. A secondary comparison was performed in the NCBI database, and the resulting target gene was named Maacs2 (nucleotide sequence shown in SEQ ID No. 2), and the corresponding protein was named MaACS2 (amino acid sequence shown in SEQ ID No. 1).

[0081] Mortierella alpina contains two AMP-forming ACS genes, Maacs1 and Maacs2, sharing 85% homology. Bioinformatics analysis revealed that Maacs1 and Maacs2 are encoded by 1980 and 1968 bases, respectively, with molecular weights of 72.2 kDa and 72.1 kDa, respectively, and isoelectric points of 6.51 and 6.62. Their major structural domains include an adenosine monophosphate (AMP) binding domain, a coenzyme A binding domain, and an activation site. Subcellular localization revealed that both proteins are cytoplasmic and lack a mitochondrial targeting signal peptide. Transcriptome and proteome data from Mortierella alpina revealed that both Maacs1 and Maacs2 are normally transcribed and translated under glucose as the sole carbon source, but Maacs2 transcript and protein expression levels are significantly higher than those of Maacs1, suggesting that it may be the primary ACS in Mortierella alpina. Therefore, Maacs2 was selected for further analysis.

[0082] Total RNA was extracted from Mortierella alpina ATCC 32222 using the Trizol method, and reverse transcription was performed according to the instructions of the Takara reverse transcription kit to obtain cDNA. Maacs2 was amplified by PCR from the cDNA library of Mortierella alpina ATCC 32222. The primers used for amplifying Maacs2 (Maacs2F / Maacs2R) are shown in Table 1.

[0083] The PCR instrument used was a BIO-RAD T100 Thermal Cycler, and KOD plus high-fidelity DNA polymerase was used. The reaction system was 50 μL, and the system contents were carried out according to the instructions of the DNA polymerase. The reaction process was as follows: pre-denaturation at 95°C for 5 min, then denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 68°C for 2.5 min. The above three steps were repeated 32 times, and then full extension was performed at 68°C for 7 min. Finally, the reaction was lowered to 12°C and maintained for 10 min before stopping.

[0084] After the reaction was completed, the amplified product was obtained. The amplified product was purified and the size of the amplified product band was verified by 1% agarose gel electrophoresis to obtain the DNA sequence of Maacs2.

[0085] Table 1 Primer sequences and their uses

[0086]

[0087] Example 2: Expression of Maacs2 in Mortierella alpina

[0088] The specific steps are as follows:

[0089] (1) Construction of Mortierella alpina expression vector

[0090] The DNA sequence of Maacs2 obtained in Example 1 and the expression vector pBIG2-ura5s-2myc-ITs were digested using restriction endonucleases HindIII and SmaI (pBIG2-ura5s-2myc-ITs is based on pBIG2-ura5s_ITs, with a 2-fold myc protein fusion tag connected to the front end of Its, and the sequence of the myc protein fusion tag is shown in SEQ ID No. 3). Then, the digested and purified DNA was ligated using T4 ligase to obtain a ligation product. The specific enzyme digestion system (20 μL) is shown in Table 2.

[0091] Table 2 Enzyme digestion system

[0092] Reagents Dosage 10×cutmart buffer 2μL Restriction enzymes 1 μL PCR product or vector 200ng~1μg <![CDATA[ddH2O]]> Make up to 20 μL

[0093] The obtained ligation product was ligated overnight at 4-16°C and then transformed into Escherichia coli DH5α competent cells. The transformation method was as follows: 100 μL of competent cells were taken under sterile conditions, 5-8 μL of ligation product were added, and pipetting was performed to mix; the mixed competent cells were transferred to a pre-cooled electroporation cup to avoid bubbles; the electroporation handle was placed in a Bio-Rad electroporator, adjusted to the appropriate preset program gear, and electroporated at a voltage of 1.8 kV; 1 mL of SOC recovery medium was added to the electroporated competent cells, mixed and transferred to a 1.5 mL centrifuge tube, and incubated at 37°C and 150 rpm for 1 hour; 200 μL was taken to coat an LB solid medium plate containing 100 μg / mL kanamycin and inverted and cultured at 37°C overnight; positive transformants were picked, plasmids were extracted, and sequencing verification results showed that the ligation was successful, obtaining the recombinant plasmid pBIG2-ura5s-2myc-Maacs2.

[0094] (2) Transformation screening of Mortierella alpina

[0095] The obtained recombinant plasmid pBIG2-ura5s-2myc-Maacs2 was transformed into Agrobacterium tumefaciens AGL-1 by electroporation to obtain Agrobacterium tumefaciens carrying the recombinant plasmid pBIG2-ura5s-2myc-Maacs2; the alpine fungus MA-Pcbh1-LbCpf1-ura5 carrying the CRISPR / Cpf1 multigene operating system was scraped with physiological saline. - The spores were placed in an incubator at 4°C to 28°C for 6 to 24 hours to obtain germinated spore liquid. Agrobacterium tumefaciens carrying the recombinant plasmid pBIG2-ura5s-2myc-Maacs2 was activated in YEP liquid medium, cultured in MM basal medium, and induced in IM induction medium. The OD value of the Agrobacterium tumefaciens cultured in IM induction medium was measured. 660 , and diluted with IM induction medium to OD 660 =0.2~1.2, obtain Agrobacterium tumefaciens culture liquid carrying recombinant plasmid pBIG2-ura5s-2myc-Maacs2; take Agrobacterium tumefaciens culture liquid carrying recombinant plasmid pBIG2-ura5s-2myc-Maacs2 and Mortierella alpina MA-Pcbh1-LbCpf1-ura5 - 100-200 μL of spore liquid was mixed upside down in a sterile EP tube, and then spread on IM solid culture medium covered with cellophane and co-cultured at 16-28°C in the dark for 12-48 hours. After the co-culture, the cellophane with the co-culture system was transferred to SC-CS medium containing spectinomycin (Spe) and cefotaxime (Cef) and cultured at 16-28°C until colonies grew. After the colonies grew, the newly grown hyphae at the edge of the colony were picked and continuously cultured on new S The cells were cultured on C-CS medium at 28°C for 12 to 48 hours for subculture. After subculture, colonies that could grow stably were selected and transferred to Broth medium (activated, containing 20 g / L glucose) and cultured at 28°C for 2 days to obtain bacterial suspension. Fungal genomic DNA was extracted from the bacterial suspension for PCR verification. Transformants that amplified the target band (containing both the screening marker ura5s and the target gene Maacs2) were considered correct positive transformants (PCR results as shown in Figure 2). Figure 1 As shown). Thus, recombinant Mortierella alpina MA-Maacs2 carrying the Maacs2 gene was obtained; wherein, PCR was performed using a Taq enzyme system, and the primers used were universal primers for the plasmid vector pBIG2-ura5s_ITs, and the specific sequences are as follows:

[0096] Upstream primer Hispro F1: CACACACAAACCTCTCTCCCACT (SEQ ID No. 7);

[0097] Downstream primer TrpCR 1: CAAATGAACGTATCTTATCGAGATCC (SEQ ID No. 8).

[0098] Depend on Figure 1 It can be seen that through PCR verification using universal primers, the uracil-complemented marker ura5s and the target gene Maacs2 in the T-DNA region of Agrobacterium tumefaciens carrying the recombinant plasmid pBIG2-ura5s-2myc-Maacs2 can be successfully amplified, and the band size is consistent with the theoretical value (because the primers are designed on the vector, the obtained fragment is 156 bp larger than the actual fragment), indicating that the target gene was successfully transferred into Mortierella alpina, and the transformant was named MA-Maacs2.

[0099] Single spores of recombinant Mortierella alpina MA-Maacs2 transformants were randomly selected and inoculated into Broth medium (activated, containing 20 g / L glucose) and incubated at 28°C for 2 days for activation. Three activation generations were repeated, and the activated cells were collected by centrifugation. The cells were broken into a uniform flocculent mass. The broken cells were then inoculated at a 1% (v / v) inoculum into Kendrick medium (lipid-producing, containing 30 g / L glucose) containing 21 mmol / L ammonium acetate. The cells were incubated at 28°C with a shaker at 200 rpm, and samples were collected after 48 hours, 96 hours, and 7 days. The culture medium was removed by filtration using a Buchner funnel. The cells were ground in liquid nitrogen, and the powder was weighed into a 1.5 mL centrifuge tube. The crude enzyme extract was added, vortexed, and thoroughly broken. The supernatant was then centrifuged and the precipitate discarded to obtain the supernatant. Transformants expressing the acetyl-CoA synthase MaACS2 in the supernatant were selected for sequencing, and those with the correct sequence were selected for further screening.

[0100] Example 3: Growth and lipid production analysis of recombinant Mortierella alpina

[0101] The specific steps are as follows:

[0102] (1) Initial screening

[0103] The recombinant Mortierella alpina MA-Maacs2 transformants sequenced correctly in Example 2 were selected for primary screening. Single spores of the transformants were picked and inoculated into Broth medium (activated, containing 20 g / L glucose) and cultured at 28°C for 2 days for activation. Three generations of activation were performed, and the activated cells were collected by centrifugation. The cells were broken into uniform floccules. The broken cells were inoculated into Broth medium (lipid-producing, containing 30 g / L glucose) at a 1% (v / v) inoculum for preliminary screening. After culturing in a shaker at 28°C and 200 rpm for 7 days, 100 mL of cells were collected using a Buchner funnel. The cells were vacuum freeze-dried to a constant weight, weighed, and the biomass was calculated.

[0104] Grind the bacteria into powder, accurately weigh 30.00 mg, accurately add 100 μL of 2 mg / mL C15:0 as an internal standard, add 2 mL of 4 mol / L hydrochloric acid and mix thoroughly; water bath at 80°C for 1 hour, place at -80°C for 15 minutes; repeat three times, cool to room temperature, add 1 mL of methanol and 1 mL of chloroform, mix well, and shake for 2 minutes; centrifuge at 3000 g for 10 minutes; collect the chloroform layer in a new extraction bottle; repeat this step twice; combine the chloroform layers, blow dry with nitrogen, and add 1 mL The method comprises the following steps: adding 10% anhydrous methanol solution containing 2% sulfuric acid to the methylation system in a 70°C water bath for 4 hours for methylation; then adding 1 mL of saturated sodium chloride and 1 mL of n-hexane to the methylation system, mixing the mixture, and centrifuging at 2500 g for 10 minutes, and repeating this step twice; collecting the n-hexane layer in a new bottle, adding 1 mL of n-hexane to the remaining liquid, shaking and mixing for 1 minute, and centrifuging at 2500 g for 10 minutes; combining the n-hexane layers, drying with nitrogen blowdown, and re-dissolving in 1 mL of n-hexane to obtain fatty acid methyl esters; and detecting the composition and content of fatty acids in the bacteria using GC-MS.

[0105] Fatty acid methyl esters were analyzed using a GCMS-QP2010 Ultra (Shimadzu Co., Japan) with an Rtx-Wax (30 m × 0.25 mm, 0.25 μm) chromatographic column (Agilent Technologies, United States); the ionization mode was electron impact ionization (EI); the ion source temperature and detector temperature were 220°C and 250°C, respectively; the injection temperature was 240°C, the separation method was 1 μL injection, the split ratio was 10:1, and the carrier gas was nitrogen; the temperature was programmed as follows: the initial temperature was 150°C for 2 min, then increased to 190°C at 10°C / min and held for 4 min, then increased to 220°C at 5°C / min and held for 6 min; the fatty acid components were relatively quantified by comparing the peak area with that of the internal standard C15:0, and the total fatty acid content was expressed as the mass of total fatty acids per unit cell.

[0106] The results are as follows Figure 2As shown, after 7 days of cultivation in Broth fermentation medium with potassium nitrate as the nitrogen source, overexpression of Maacs2 resulted in varying degrees of increased lipid accumulation in the recombinant strains. The wild-type ATCC 32222 control had a total biomass of 12.42±0.108 g / L and a fatty acid content of 37.85±0.66 DCW% after 7 days of fermentation. In contrast, some transformants had significantly higher fatty acid contents than the wild-type ATCC 32222 control (p<0.05). Transformants No. 2 and No. 8 had fatty acid contents of 43.53±0.05% and 48.37±0.62% of cell dry weight, respectively, and fatty acid yields of 5.68±0.20 g / L and 6.34±0.15 g / L, respectively. These two transformants were subsequently designated MA-Maacs2-1 and MA-Maacs2-2.

[0107] (2) Growth and lipid production analysis of recombinant Mortierella alpina

[0108] In order to further analyze the tolerance of the recombinant bacteria to acetate and the growth and lipid accumulation characteristics at different time points, two recombinant bacteria (transformants No. 2 and No. 8) screened in step (1) were selected. Figure 3 The activation process was the same as step (1). After three generations of activation, the broken bacteria were inoculated into Kendrick medium (lipid production, containing 30 g / L glucose) at a 1% (v / v) inoculum. The bacterial liquid was collected at 48 h, 96 h, and 7 d after inoculation, and biomass and fatty acid analysis was performed. The results are shown in Figure 2. Figure 3 shown.

[0109] According to the analysis of the growth and lipid production of recombinant Mortierella alpina in Kendrick medium with ammonium acetate as nitrogen source at different time points, ( Figure 3), the total biomass and total fatty acid production of the Maacs2 overexpressing strain at all stages of fermentation were significantly higher than those of the control group (p<0.05). In the initial fermentation phase (48 h), the two recombinant strains grew well in 21 mmol / L ammonium acetate, with cell dry weight reaching 4.14-4.50 g / L at 48 h, which was 1.68-1.83 times that of the wild-type control strain ATCC 32222 (p < 0.05). The biomass advantage persisted during the fermentation process. After 7 days of fermentation, the biomass of the two recombinant strains reached 13.80±0.03 g / L and 13.08±0.46 g / L, respectively, which were 1.22 times and 1.16 times that of the control group, respectively. The total lipid yields of the two recombinant strains after 7 days of fermentation were 6.21±0.25 g / L and 5.50±0.24 g / L, which were 1.37 times and 1.55 times that of the control group, respectively. This indicates that overexpression of Maacs2 in M. alpina significantly improved the bacterial tolerance to acetate, thereby promoting strain growth and lipid accumulation. Because ammonium acetate has good pH buffering properties, the natural pH value of the fermentation broth is stable at 6.3-6.5, which is conducive to the synthesis of PUFAs. The content of representative PUFA - arachidonic acid (ARA) in the recombinant bacteria of Mortierella alpina MA-Maacs2 accounts for 46.8±1.25% of the total fatty acids, and the yield reaches 2.8g / L, which is 5.3 times that of the wild-type strain ATCC32222 under the culture conditions of Kendrick medium (without adding acetate) with ammonium tartrate as the nitrogen source.

[0110] Example 4: Analysis of protein expression levels of recombinant Mortierella alpina

[0111] The specific steps are as follows:

[0112] The method is as follows: the two recombinant bacteria in Example 3 were selected, and the bacterial liquid at time points of 48 hours, 96 hours and 7 days were fermented under the conditions of Kendrick medium with ammonium acetate as the nitrogen source according to step (2) in Example 3. The wet bacterial cells were ground with liquid nitrogen and about 200 mg of the liquid nitrogen-ground bacterial powder was taken, zirconium oxide crushing beads were added, 1 mL of pre-cooled 10% TCA / acetone (w / v) was added, and the mixture was shaken and placed at 20°C for overnight precipitation. The mixture was centrifuged at 12000g and 4°C for 15 minutes, the supernatant was discarded, 1 mL of pre-cooled ice acetone was added, the mixture was shaken and mixed, and the mixture was again placed at -20°C for 2 hours to wash away TCA. The mixture was centrifuged at 12000g and 4°C for 15 minutes, and this was repeated twice until the TCA was completely washed away. The precipitate was dried in a vacuum rotary dryer until the acetone was completely volatilized.

[0113] Add 1 mL of urea extract to the dried sample, shake thoroughly to dissolve, and place in a constant temperature incubator at 28°C for 1 hour, mixing every 20 minutes. Centrifuge the extract at 12000g for 15 minutes at room temperature, discard the precipitate, take the supernatant, add 1 mL of urea extract to the precipitate and repeat the extraction once. After combining the supernatants, add 5 times the volume of ice acetone and mix well. Precipitate for no less than 2 hours or overnight, centrifuge at 12000g for 15 minutes, and then wash twice with ice acetone to remove DTT and SDS. After drying in a vacuum rotary oven, dissolve with 8M urea, determine the protein concentration using the BCA method, and perform SDS-PAGE and western blot analysis. SDS-PAGE, western blot and development methods refer to the routine steps in the "Protein Operation Manual". The expression levels of target proteins at different time points in recombinant Mortierella alpina MA-Maacs2 are shown in Figure 4 .

[0114] The expression levels of MaACS2 protein in the recombinant M. alpina MA-Maacs2 strain at different time points indicate slightly higher expression of the target protein at 48 hours, corresponding to faster growth and higher fatty acid accumulation at this time point. MaACS2 protein expression levels were generally consistent at other time points, indicating that MaACS2 is continuously expressed throughout the fermentation process and that no significant protein degradation occurs even after nitrogen source depletion in the late fermentation period. This protocol also provides a reliable method for protein expression analysis and related sample preparation in oil-producing filamentous fungi such as M. alpina, offering a more objective reference for verifying the availability of target genes in genetically modified strains at the protein level.

[0115] Example 5: Optimization of the acetyl-CoA metabolic pathway in Mortierella alpina based on multi-gene combination

[0116] The specific steps are as follows:

[0117] In the previous stage, the alpine fungus MA-Maacs2 was used as the starting bacteria to use gene editing technology to induce the knockout of the screening marker ura5 gene (the targeted induced knockout and screening steps of the uracil screening marker refer to the patent application document with publication number CN112592926A).

[0118] A single spore of the starting strain MA-Maacs2 was inoculated into Broth medium (activated, containing 20 g / L glucose) and cultured at 28°C for 2 days for activation; three generations of activation were performed continuously, and the activated bacteria were collected by centrifugation; the bacteria were broken into uniform flocs; the broken bacteria were inoculated into MM induction knockout medium at a 1% (v / v) inoculation rate, and cultured in a shaking table at 28°C and 200 rpm for 7 days. After that, 1 mL of bacterial liquid was aspirated in a clean bench, centrifuged to remove the supernatant, and the precipitate was spread on a GYU-F plate. After culturing at 28°C in the dark for 2 days, a uracil-deficient strain gradually grew.

[0119] The new hyphae at the edge of the uracil-deficient strain were picked and continuously passaged three times on the GYU-F screening plate, and simultaneously inoculated on the SC screening medium without uracil for reverse verification (the defective bacteria could not grow on the SC screening plate without uracil). The genomic DNA of the correct strain was extracted and verified using the above-mentioned universal primers (SEQ ID No.7 and SEQ ID No.8). No uracil bands could be amplified. At the same time, the uracil-deficient strain was fermented and cultured to verify that there was no difference in its biomass and fatty acid synthesis ability. The nutritional deficiency strain MA-2myc-Maacs2-Δura5, which again lacked the uracil selection marker, was obtained. - , and serve as a new starting bacterium to introduce the next gene.

[0120] In order to further improve the lipid accumulation ability of the recombinant bacteria, referring to the steps of expressing MaACS2 in Example 2, combined with the functional characteristics of MaACS2, the above-mentioned uracil selection marker knockout MA-2myc-Maacs2-Δura5 - Overexpression of citrate lyase (ACL1, amino acid sequence as shown in SEQ ID No. 9) in the recombinant bacteria further enhances the supply of acetyl-CoA; overexpression of glucose-6-phosphate dehydrogenase 2 (G6PD2, amino acid sequence as shown in SEQ ID No. 10) balances the reducing power (NADPH) balance to prevent acetyl-CoA overflow and protein acetylation modification; interference with the gamma subunit of sucrose non-fermenting protein kinase (SNF1) (amino acid sequence as shown in SEQ ID No. 11) to increase the activity of acetyl-CoA carboxylase (ACC1). The recombinant bacteria obtained in this example were named MA-Cpf1-Maacs2-Maacl1, MA-Cpf1-Maacs2-Mag6pd2 and MA-Cpf1-Maacs2-Masnf4Ri.

[0121] Single spores of correctly sequenced recombinant Mortierella alpina MA-Cpf1-Maacs2-Maacl1, MA-Cpf1-Maacs2-Mag6pd2 and MA-Cpf1-Maacs2-Masnf4Ri transformants were inoculated into Broth medium (activated, containing 20 g / L glucose) and cultured at 28°C for 2 days for activation; activation was continued for three generations, and the activated cells were collected by centrifugation; the cells were broken into uniform flocs; the broken cells were inoculated into Kendrick medium (lipid production, containing 30 g / L glucose) containing 21 mmol / L ammonium acetate at a 1% (v / v) inoculum size, and the bacterial liquid was collected 7 days after inoculation for biomass and fatty acid analysis. The results are shown in Figure 2. Figure 5 As shown, by combining Maacs2 with other genes that promote lipid accumulation in Mortierella alpina using the CRISPR / Cpf1 multi-gene operating system, the lipid accumulation level of Mortierella alpina was further improved. Acetyl-CoA and reducing power NADPH are the most basic two-carbon units and cofactors for fatty acid synthesis. Co-expression of Maacs2 and g6pd2 increased the total biomass and lipid accumulation of the recombinant strain MA-Cpf1-Maacs2-Mag6pd2 by balancing the supply of acetyl-CoA and reducing power NADPH. The total biomass of the six recombinant strains screened increased by 7.18% to 25.43%, reaching a maximum of 15.85g / L ( Figure 5 A, transformant No. 6); the fatty acid content of the recombinant bacteria was also significantly improved, among which the total fatty acid content of transformants No. 2 and No. 6 increased by 16.86% and 15.06% compared with the control group ( Figure 5 B).

[0122] ACL is the main source of acetyl-CoA in the cytoplasm. Previous experiments have shown that MaACL1 has a more significant effect on fatty acid accumulation in Mortierella alpina. Therefore, this study chose to overexpress acl1 on top of overexpressing Maacs2, with the goal of further increasing the supply of acetyl-CoA in the cytoplasm. Fermentation results showed that the coordinated overexpression of Maacs2 and acl1 significantly increased the biomass of the recombinant strain MA-Cpf1-Maacs2-Maacl1, reaching a maximum of 16.08g / L ( Figure 5 C, No. 3 transformant), which was 27.28% higher than that of the control group. The fatty acid content of the recombinant bacteria of No. 2 and No. 5 transformants was 15.21% and 17.22% higher than that of the control group ( Figure 5 D), indicating that overexpression of acl1 can promote lipid synthesis in the strain by increasing intracellular acetyl-CoA and further improve lipid production by significantly increasing biomass.

[0123] The sucrose non-fermenting kinase complex is a homolog of human AMP-activated protein kinase (AMPK). Both are heterotrimeric structures and can inhibit the activity of ACC1, a key rate-limiting enzyme in lipid synthesis, through phosphorylation. Existing literature reports have confirmed that knocking out or knocking down each subunit of the SNF1 complex can increase ACC1 activity and promote lipid accumulation by relieving the phosphorylation of ACC1. Based on MA-Cpf1-Maacs2, RNA interference (Masnf4Ri) was performed on the γ subunit of the SNF1 complex (encoded by snf4) with a unique gene in Mortierella alpina, which can also further promote the growth and lipid accumulation of the recombinant strain MA-Cpf1-Maacs2-Masnf4Ri of Mortierella alpina. The biomass content of each transformant increased by 9.43% to 17.10% compared with the control group ( Figure 5 E), the total fatty acid content of transformant No. 2 increased by 24.89% compared with the control group ( Figure 5 F) The above cases demonstrate that the CRISPR / Cpf1 multi-gene operating system has enabled the diversified combination and application of Maacs2 genes.

[0124] The above results provide a way to further improve the tolerance of oil-producing microorganisms such as Mortierella alpina to acetate through genetic engineering, while also improving their lipid accumulation capacity. With the establishment of immunoblotting sample pretreatment methods and the application of multi-gene systems, they provide substantial theoretical support and technical methods for the further development of oil-producing microbial resources.

[0125] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant strain, characterized in that, Using Mortierella alpina MA-Pcbh1-LbCpf1-ura5 - as the host, overexpress acetyl-CoA synthetase with the amino acid sequence shown in SEQ ID No.

1.

2. The recombinant strain according to claim 1, wherein The recombinant strain also has knockdown or inhibition of the γ subunit of sucrose non-fermenting protein kinase, overexpression of citrate lyase and / or overexpression of glucose-6-phosphate dehydrogenase 2; the amino acid sequence of the citrate lyase is as shown in SEQ ID No.9, the amino acid sequence of the glucose-6-phosphate dehydrogenase 2 is as shown in SEQ ID No.10, and the amino acid sequence of the γ subunit of the sucrose non-fermenting protein kinase is as shown in SEQ ID No.

11.

3. The recombinant strain according to claim 1 or 2, characterized in that The recombinant strain uses the pBIG2-ura5s_ITs plasmid as an expression vector.

4. Use of acetyl-CoA synthetase in regulating lipid synthesis in oil-producing microorganisms, characterized in that, The application is using an ammonium salt as a nitrogen source, adding 0-30 mmol / L of acetate, overexpressing acetyl-CoA synthetase with the amino acid sequence as shown in SEQ ID No.1, the oil-producing microorganism is Mortierella alpina, and the lipid is the total fatty acids containing arachidonic acid.

5. A method for synthesizing lipids, characterized in that, The method uses the recombinant strain according to any one of claims 1 to 3 or the whole-cell catalyst containing the recombinant strain according to any one of claims 1 to 3 as a fermentation strain, and synthesizes lipids in a fermentation system containing acetate and ammonium salt, and the lipid is the total fatty acids containing arachidonic acid.

6. The application of the recombinant strain according to any one of claims 1 to 3 or the method according to claim 5 in lipid production.

7. A method for extracting total protein of oil-producing microorganisms, characterized in that, The method is to grind the recombinant strain according to any one of claims 1 to 3 in liquid nitrogen, add pre-cooled acetone containing 10% trichloroacetic acid to precipitate the cells, then add a urea extraction solution, and finally add ice-cold acetone to precipitate to obtain total protein.

Citation Information

Patent Citations

  • A method for constructing a uracil auxotroph of *Morchella alpinea* with homologous recombination knockout of the ura5 gene.

    CN103468581B

  • Recombination gene expression system of mortierella alpina and construction method and applications thereof

    CN103571762A

  • Glucose-6-phosphate dehydrogenase and malic enzyme coordinate-expressed recombinant mortierella alpine strain, constructing method thereof and application thereof

    CN105368727A

  • Cane sugar non-fermentation type protein kinase regulatory subunit and application thereof

    CN110656097A

  • CRISPR system and application thereof to mortierella alpina

    CN112592926A