A strain for secreting and expressing glutaminase, its construction method and application

Abstract

The present invention provides a strain secreting and expressing glutaminase, and a construction method and application thereof. The genetic engineering strain secreting and expressing glutaminase provided by the present invention has the following characteristics: (a) one or more combinations of the following constructs are integrated into the genome: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, PHpaII-PamyQ-SamyQ; or, (b) the cell contains an expression vector containing one or more combinations of the following constructs: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, PHpaII-PamyQ-SamyQ. The present invention provides a strain secreting and expressing glutaminase, and a construction method and application thereof.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and particularly to a strain for secreting and expressing glutaminase, a construction method thereof, and an application thereof. Background Art

[0002] Glutaminase (glutaminase, EC3.5.1.2) is an enzyme that can catalyze the hydrolysis of L-glutamine to produce L-glutamic acid and ammonia. Glutamic acid plays an important role in the food industry, increasing the umami of food while enhancing its nutrition. Glutaminase is widely present in bacteria, fungi, and yeasts. In recent years, studies have shown that the catalytic action of glutaminase is greatly affected by pH. Usually, hydrolysis occurs at pH 6-8, while transpeptidation occurs at pH 8-9.

[0003] In recent years, the application research of glutaminase in the food and medical fields has developed rapidly. Currently, in the food industry, glutaminase is mainly used in the production of soy sauce, hydrolyzing glutamine in soy sauce to glutamic acid to enhance the flavor of soy sauce. At the same time, glutaminase also has extremely important application value in the fields of biotechnology and biomedicine. In biocatalysis, glutaminase can transfer the γ-glutamyl group to other amino acid or peptide receptors to form new γ-glutamyl derivatives. This transfer ability of glutaminase can be used for the development of high-value-added γ-glutamyl compound products, such as L-theanine. The receptors for the action of glutaminase are mainly water molecules, γ-glutamyl itself, and other amino acids or dipeptides, and can catalyze the synthesis of novel high-value-added products with immunomodulatory effects such as γ-Glu-Trp, precursor drugs for treating Parkinson's syndrome such as γ-glutamyl-L-dopa, and γ-glutamyl taurine with anticonvulsant effects.

[0004] Currently, the production of glutaminase mainly relies on wild-type strains, combined with the transformation of genetically engineered bacteria. The expression levels of wild-type strains are generally low and they cannot secrete and express. The transformation of genetically engineered bacteria mainly focuses on Bacillus subtilis. Although the intracellular expression level of glutaminase has been increased to a certain extent, secretion and expression have still not been achieved, resulting in significant losses of enzyme activity during the extraction process in industrial production and difficulties in preparing enzyme preparation products. Summary of the Invention

[0005] Aiming at the problems of low expression levels of strains expressing glutaminase and the inability of glutaminase to be secreted and expressed in the prior art, the present invention provides a strain capable of secreting and expressing glutaminase.

[0006] The strain provided by the present invention can secrete and express glutaminase, solving the problems of the inability of glutaminase to be secreted and expressed and significant losses of enzyme activity during the subsequent extraction process in industrial production, and the difficulty in preparing high-quality enzyme preparation products.

[0007] The present invention provides a genetically engineered strain that secretes and expresses glutaminase, and the strain comprises the following characteristics:

[0008] (a) One or more combinations of the following constructs are integrated into the genome: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, PHpaII-PamyQ-SamyQ;

[0009] Or, (b) an expression vector containing one or more combinations of the following constructs is present in the cell: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, PHpaII-PamyQ-SamyQ.

[0010] Preferably, the strain uses Bacillus amyloliquefaciens as the host;

[0011] Preferably, the host is the Bacillus amyloliquefaciens strain ESP827 with the preservation number CCTCC No: M 2018828.

[0012] Preferably, one or more sites in the gene locus of the host are integrated with the construct,

[0013] Preferably, the construct is integrated at the srfA locus of the host.

[0014] Preferably, the expression vector is a pUC plasmid.

[0015] Preferably, the genetically engineered strain is Bacillus amyloliquefaciens BAG6-1, which is preserved in the China Center for Type Culture Collection (CCTCC) with the preservation number CCTCC NO: M 2022849;

[0016] Or, the genetically engineered strain is Bacillus amyloliquefaciens BAG6, which is preserved in the China Center for Type Culture Collection (CCTCC) with the preservation number CCTCC NO: M 2022850.

[0017] The present invention also provides a method for constructing the above-mentioned genetically engineered strain, and the construction method comprises the following steps:

[0018] Integrate the described construct into the chromosomal genome of the host cell or transform the host cell with an expression vector containing the construct.

[0019] Preferably, the construction method includes: directionally modifying the host cell by using gene editing technology and / or homologous recombination, so that any one or two or more sites in the gene locus of the host cell contain the construct of the gene editing technology and / or homologous recombination.

[0020] Preferably, the srfA locus of the host cell contains the construct of the gene editing technology and / or homologous recombination.

[0021] Preferably, the gene editing technology is selected from one or a combination of two or more of ZFN editing, TALEN editing or CRISPR / Cas9 editing.

[0022] Preferably, the homologous recombination is selected from λ-red homologous recombination or homologous recombination mediated by sacB gene screening or homologous recombination mediated by an integration plasmid.

[0023] The present invention also provides the application of the genetically engineered strain or the genetically engineered strain obtained by the described construction method in the fermentation production of glutaminase.

[0024] The present invention also provides the application of the genetically engineered strain or the genetically engineered strain obtained by the described construction method in food additives or health products;

[0025] Preferably, the food additive is soy sauce or yeast extract.

[0026] The present invention also provides a method for fermenting and producing glutaminase, and the method includes culturing the genetically engineered strain or the genetically engineered strain obtained by the described construction method.

[0027] Preferably, the inoculation amount of the strain is 4%-8%.

[0028] Preferably, the fermentation temperature is 24°C - 37°C.

[0029] Preferably, the pH is maintained at 6 - 7.0 by adding alkali during the fermentation process.

[0030] Preferably, the fermentation rotation speed is 500 - 600 rpm.

[0031] Preferably, the fermentation ventilation ratio is 1:1.

[0032] The present invention also provides a recombinant expression vector, which contains one or a combination of two or more of the following constructs: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, PHpaII-PamyQ-SamyQ.

[0033] The present invention provides a strain that can stably ferment and produce glutaminase and a method for constructing the same. Through the combined optimization and screening of promoters, a promoter combination with a relatively high expression level is obtained. Using the CRISPR gene editing system, a recombinant strain of antibiotic-free genomic integration type is transformed. Fermentation using this strain can solve the problems of instability of the strain and easy plasmid loss during the fermentation process, and at the same time, it can avoid adding antibiotics during the fermentation process and reduce production costs.

[0034] The strain provided by the present invention secretes the expressed glutaminase extracellularly, which can reduce the loss of enzyme activity during the extraction process of glutaminase and make it easier to prepare enzyme preparation products.

[0035] Using the strain constructed by the present invention for fermenting and preparing glutaminase enzyme preparation products and applying them to enhance the freshness of soy sauce, it is found that it can significantly improve the freshness of soy sauce without increasing the salinity of soy sauce. At the same time, when the glutaminase product is applied to the treatment of yeast extract, it can also improve the freshness of yeast extract.

[0036] Strain preservation information

[0037] Bacillus amyloliquefaciens BAG6 in the present invention was deposited at the China Center for Type Culture Collection (CCTCC) on June 9, 2022, with the deposit number CCTCC NO: M M 2022850. The deposit address is: Wuhan University, Wuhan, China, Postcode: 430072; Tel: (027)-68754052.

[0038] Bacillus amyloliquefaciens BAG6-1 in the present invention was deposited at the China Center for Type Culture Collection (CCTCC) on June 9, 2022, with the deposit number CCTCC NO: M2022849. The deposit address is: Wuhan University, Wuhan, China, Postcode: 430072; Tel: (027)-68754052. Description of the drawings

[0039] Figure 1 The pMA-glu1 plasmid map is shown;

[0040] Figure 2 Shown is the plasmid map of pMA-glu2;

[0041] Figure 3 Shown is the plasmid map of pMA-glu3;

[0042] Figure 4 Shown is the plasmid map of pMA-glu4;

[0043] Figure 5 Shown is the plasmid map of pMA-glu5;

[0044] Figure 6 Shown is the plasmid map of pMA-glu6;

[0045] Figure 7 Shown is the plasmid map of pHY-Cas9-Glu6. Specific embodiments

[0046] The present invention provides a genetically engineered strain capable of secreting and expressing glutaminase. The strain provided by the present invention can secrete glutaminase extracellularly, reduce the loss of enzyme activity during the extraction process of glutaminase, and make it easier to prepare enzyme preparation products.

[0047] In the present invention, different promoters and signal peptide combinations are used for the glutaminase recombinant vector. In a specific embodiment of the present invention, six groups of different promoters (whose gene sequences are shown in SEQ ID NO.1-6), the pMA5 plasmid vector backbone (whose gene sequence is shown in SEQ ID NO.7-10), and the glutaminase gene sequence (whose gene sequence is shown in SEQ ID NO.15) are ligated by Gibson assembly. The obtained product is transformed into Escherichia coli, and plasmid-type recombinant vectors pMA-glu1, pMA-glu2, pMA-glu3, pMA-glu4, pMA-glu5, and pMA-glu6 are extracted and prepared.

[0048] The construction method of the plasmid-type recombinant expression glutaminase B. amyloliquefaciens engineering bacteria is to transfer the obtained six groups of recombinant plasmid-type vectors pMA-glu1, pMA-glu2, pMA-glu3, pMA-glu4, pMA-glu5, and pMA-glu6 into B. amyloliquefaciens ESP827 competent cells by electroporation, and then the B. amyloliquefaciens plasmid-type genetically engineered bacteria are obtained.

[0049] In a specific embodiment of the present invention, sgRNA (whose gene sequence is shown in SEQ ID NO.11), homologous arms upstream and downstream of srfA (whose gene sequences are shown in SEQ ID NO.12-13), and the backbone of recombinant plasmid pMA-glu6 (whose gene sequence is shown in SEQ ID NO.14) are ligated by Gibson assembly, transformed into Escherichia coli, and the genome-integrated recombinant vector pHY-Cas9-Glu6 to be transformed is prepared by extraction.

[0050] The obtained genome-integrated recombinant vector pHY-Cas9-Glu6 is first treated by demethylation to prepare a demethylated recombinant vector, then treated with BamHI methylase to obtain a site-specific methylated recombinant vector, and then the recombinant transformant is obtained by electrotransforming competent cells of the host bacterium B. amyloliquefaciens ESP827. The obtained positive recombinant transformants are picked and subcultured in a medium without antibiotics to screen for strains with the loss of the CRISPR system plasmid, and finally the genome-integrated recombinant expression glutaminase B. amyloliquefaciens engineering bacterium BAG6-1 is obtained.

[0051] In an embodiment of the present invention, the construction method is specifically (as shown in Table 1):

[0052] (1) Using P1 / P2, P3 / P4, P5 / P6, P7 / P8, P9 / 10, P11 / P12 as primers and recombinant plasmids pUC-PamyQ-SamyQ, pUC-PHpaII-SamyQ, pUC-P43-SamyQ, pUC-Pgrac-SamyQ, pUC-PamyQ-PHpaII-SamyQ, pUC-PHpaII-PamyQ-SamyQ as templates, the corresponding promoter gene sequences are obtained by PCR. Using P13 / 14, P15 / 16, P17 / 18, P19 / P20 as primers and plasmid pMA5 as a template, the pMA5 backbone gene sequence is obtained by PCR. Using P21 / P22 as primers and the B. amyloliquefaciens genome as a template, the glutaminase gene sequence is obtained by PCR; then, by the method of Gibson assembly, the respective fragments are assembled into a plasmid-type recombinant vector.

[0053] (2) Design primers P23 / P24 according to the sgRNA sequence, and amplify the CRISPR plasmid system by PCR. Using P25 / p26 as primers and the recombinant plasmid pHY-Cas9-1 as the template, amplify the plasmid backbone gene sequence of the CRISPR system by PCR. Using P27 / P28 and P29 / P30 as primers and the B. amyloliquefaciens genome as the template, amplify the upstream and downstream homologous arm gene sequences of srfA by PCR. Using P31 / P32 as primers and the recombinant plasmid pMA-glu6 as the template, amplify the glutaminase gene expression cassette sequence. Use Gibson assembly to assemble the corresponding fragments into a genome-integrated recombinant vector.

[0054] (3) Respectively transform the two recombinant vectors obtained in the above two steps into the competent cells of B. amyloliquefaciens ESP827 by electroporation to obtain the plasmid-type genetically engineered bacteria B. amyloliquefaciens engineering strains BAG1 - BAG6 with resistance, and the genome-integrated recombinant expression glutaminase B. amyloliquefaciens engineering strain BAG6-1 without resistance.

[0055] The glutaminase gene in the present invention is the gene of B. amyloliquefaciens itself and is expressed in B. amyloliquefaciens, meeting the requirements of GB 2760. However, the glutaminase gene in the prior art CN107828710A comes from Micrococcus luteus and is expressed in Bacillus subtilis, not meeting the requirements of GB 2760 for enzyme preparation production strains, and the two glutaminases are not the same substance. In addition to hydrolyzing glutamine, the glutaminase of the present invention also has transpeptidase activity in terms of enzymatic properties, which can endow more flavors to the catalytic reaction, while the glutaminase in the prior art CN107828710A only has hydrolytic activity and no transpeptidase activity. The glutaminase of the present invention has good stability, and the enzyme activity loss is very small when stored at room temperature for the finished product. The glutaminase in the prior art CN107828710A has poor stability, and after storing at room temperature for a period of time, the enzyme activity loss is close to 90%. The glutaminase in the present invention is secreted and expressed by B. amyloliquefaciens, which is more conducive to downstream extraction and preparation, and finally made into a finished product, with a yield of more than 70% and meeting the industrialization conditions; while the Bacillus subtilis in the prior art CN107828710A is intracellularly expressed, cell disruption is required during extraction and preparation, and after making it into a finished product, the yield is only about 10% and nearly 90% of the enzyme activity is lost, not meeting the industrialization conditions.

[0056] The method for detecting the enzyme activity of glutaminase in the examples of the present invention is as follows:

[0057] Definition: Under specific conditions, the amount of glutaminase required to catalyze the formation of 1 μmol of glutamate from glutamine per minute is defined as 1 enzyme activity unit.

[0058] Test method:

[0059] Principle: This method defines the enzyme activity of glutaminase by catalyzing the conversion of glutamine into glutamate under the conditions of pH 6.0 and 37 °C. Among them, the generated glutamate is detected by a biosensor.

[0060] The reagents and solutions used for the detection of glutaminase enzyme activity are as follows:

[0061] 0.75 mol / L perchloric acid solution: Dissolve 83 mL of 60% perchloric acid in 900 mL of distilled water, make up the volume to 1000 mL, and store it at 4 °C in a brown reagent bottle.

[0062] 0.75 mol / L sodium hydroxide solution: Dissolve 30 g of solid sodium hydroxide in 800 mL of distilled water, make up the volume to 1000 mL.

[0063] 1.0 mol / L acetic acid solution: Dissolve 60.05 g of acetic acid in 900 mL of distilled water, make up the volume to 1000 mL.

[0064] 1.0 mol / L sodium acetate solution: Dissolve 136.08 g of sodium acetate trihydrate in 900 mL of distilled water, make up the volume to 1000 mL.

[0065] 1.0 mol / L pH 6.0 acetate buffer solution: Adjust 1.0 mol / L sodium acetate solution to pH 6.0 with 1.0 mol / L acetic acid solution.

[0066] 10% TritonX-100 solution: Dissolve 10 g of TritonX-100 in 70 mL of distilled water, make up the volume to 100 mL.

[0067] Enzyme dilution solution: Mix 10 mL of 1.0 mol / L pH 6.0 acetate buffer solution and 0.5 mL of 10% TritonX-100 solution, and make up the volume to 1000 mL with distilled water.

[0068] 2.0% pH 6.0 L-glutamine substrate solution: Dissolve 2.00 g of L-glutamine in 70 mL of distilled water, add 10 mL of 1.0 mol / L acetate buffer solution, and make up the volume to 100 mL with distilled water.

[0069] Process of glutaminase enzyme activity detection

[0070] Enzymatic reaction: Pipette 1.0 mL of enzyme solution into a test tube and incubate in a 37 °C water bath for 5 min; then add 1.0 mL of substrate solution and immediately start timing the reaction in a 37 °C water bath; after exactly 10 min of reaction, add 1.0 mL of 0.75 mol / L perchloric acid solution, mix well, and ice bath for 1 min; then add 1.0 mL of 0.75 mol / L sodium hydroxide solution, mix well to obtain a mixed solution.

[0071] Blank control: Pipette 1.0 mL of enzyme solution into a test tube, add 1.0 mL of 0.75 mol / L perchloric acid solution, mix well; incubate in a 37 °C water bath for 5 min; after adding 1.0 mL of substrate solution, ice bath for 1 min; then add 1.0 mL of 0.75 mol / L sodium hydroxide solution, mix well to obtain a mixed solution.

[0072] Detecting the glutamate concentration in the mixed solution by biosensor method: When the enzyme activity of the test sample is relatively high (such as the finished product with an enzyme activity of 100 U / g), it is more appropriate to use the glutamate biosensor detection method, and the unit enzyme activity of the diluted sample is controlled at 1 U / g. Prepare the buffer solution required for the biosensor and calibrate it before detecting glutamate; respectively inject 25 μL of the obtained enzymatic reaction mixed solution and the blank control mixed solution for detection.

[0073] Calculation: Under this detection condition, the amount of enzyme required to convert 1 μmol of glutamine to glutamate per minute is defined as one enzyme activity unit.

[0074] Enzyme activity E (U / g) = {(X / 147) * 10 6 * N * 4 * 10 -3 / 10} / m

[0075] X: The value shown by the biosensor, with the unit of g / L

[0076] 147: The molecular mass of glutamate, with the unit of g / mol

[0077] N: The dilution factor of the sample

[0078] 4: The total volume of the enzymatic reaction, with the unit of mL

[0079] 10: The enzymatic reaction time, with the unit of min

[0080] m: The mass of the sample, specified as 1 g

[0081] The primer sequences used in the examples of the present invention are shown in Table 1 below.

[0082] Table 1

[0083]

[0084]

[0085] The source information of the reagents and instruments used in the embodiments of the present invention is shown in Table 2 below.

[0086] Table 2

[0087]

[0088]

[0089]

[0090] The Bacillus amyloliquefaciens host used in the embodiments of the present invention is the Bacillus amyloliquefaciens strain (Bacillus amyloliquefaciens) ESP827 with the preservation number of CCTCC No: M 2018828, and this strain has been recorded in the publication number CN112300954A.

[0091] In order to enable those skilled in the art to better understand the present invention, the present invention will be further described in detail below in conjunction with specific embodiments. Those skilled in the art should understand that this should not be construed as a limitation on the scope of the claims of the present invention. At the same time, it should be noted that the reagents or instruments in the present invention can be obtained through commercial purchase without special instructions.

[0092] Example 1 Construction of recombinant vectors of glutaminase with different promoter and signal peptide combinations

[0093] (1) The sequences of four promoter genes were obtained by querying the NCBI website, and 5 groups of promoter signal peptide combinations were obtained. The Sangon Biotechnology Co., Ltd. (Shanghai, China) optimized the codon preference of Bacillus amyloliquefaciens for each sequence and synthesized it to obtain the corresponding recombinant plasmids pUC-PamyQ-SamyQ, pUC-PHpaII-SamyQ, pUC-P43-SamyQ, pUC-Pgrac-SamyQ, pUC-PamyQ-PHpaII-SamyQ, pUC-PHpaII-PamyQ-SamyQ.

[0094] (2) Using P1 / P2, P3 / P4, P5 / P6, P7 / P8, P9 / 10, P11 / P12 as primers and the above six recombinant plasmids as templates, the corresponding promoter gene sequences (SEQ ID NO.1 - 6) were obtained by PCR. Using P13 / 14, P15 / 16, P17 / 18, P19 / P20 as primers and plasmid pMA5 as the template, the gene sequences (SEQ ID NO.7 - 10) were obtained by PCR. Using P21 / P22 as primers and the B. amyloliquefaciens genome as the template, the glutaminase gene sequence SEQ ID NO.15 was obtained by PCR. Using Gibson assembly, the genes (SEQ ID NO.1 - 6) were respectively assembled and ligated with the genes (SEQ ID NO.7 - 10) and the glutaminase gene. The ligation product was transformed into Escherichia coli TOP10 competent cells by chemical transformation method. The transformation solution was spread on an LB plate containing ampicillin (100 mg / L) and cultured overnight. The transformants were picked for colony PCR, and the plasmids of the positive transformants were extracted. The sequencing work was completed by Shanghai Sangon, and six groups of recombinant plasmids pMA - glu1, pMA - glu2, pMA - glu3, pMA - glu4, pMA - glu5, pMA - glu6 were obtained. The plasmid maps are as Figures 1 - 6 shown.

[0095] Among them, the sequence of SEQ ID NO.1 (PamyQ - SamyQ) is as follows:

[0096] ctaatgtgtaatgagggcggcgttctgtttctgcttcggtatgtgattgtgaagctggcttacagaagagcggtaaaaga

[0097] agaaataaaaaagaaatcatcttttttgtttggaaagcgagggaagcgttcacagtttcgggcagctttttttataggaac

[0098] attgatttgtattcactctgccaagttgttttgatagagtgattgtgataattttaaatgtaagcgttaacaaaattctccagtc

[0099] ttcacatcggtttgaaaggaggaagcggaagaatgaagtaagagggatttttgactccgaagtaagtcttcaaaaaat

[0100] caaataaggagtgtcaagaatgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttc

[0101] atttggttctggcaggaccggcggctgcgagtgctgaaatgaaagatatggtc

[0102] The sequence of SEQ ID NO.2 (PHpaII - SamyQ) is shown as follows:

[0103] ctaatgtgtaatgaggttcggattcatctatgggaggcaagtgatgaaggctggcgctctcgtagtaatgattcaccgg

[0104] tttgtacaggtgcggagtcgtttattgctggtactgctagttgccgcattgaagtagagggaattgatgaattatatcaac

[0105] atattaagcctttgggcattttgcaccccaatacatcattaaaagatcagtggtgggatgaacgagactttgcagtaattg

[0106] atcccgacaacaatttgattagcttttttcaacaaataaaaagctaaaatctattattaatctgttcagcaatcgggcgcga

[0107] ttgctgaataaaagatacgagagacctctcttgtatcttttttattttgagtggttttgtccgttacactagaaaaccgaaag

[0108] acaataaaaattttattcttgctgagtctggctttcggtaagctagacaaaacggacaaaataaaaattggcaagggttt

[0109] aaaggtggagattttttgagtgatcttctcaaaaaatactacctgtcccttgctgatttttaaacgagcacgagagcaaaa

[0110] cccccctttgctgaggtggcagagggcaggtttttttgtttcttttttctcgtaaaaaaaagaaaggtcttaaaggttttatg

[0111] gttttggtcggcactgccgacagcctcgcagagcacacactttatgaatataaagtatagtgtgttatactttacttggaa

[0112] gtggttgccggaaagagcgaaaatgcctcacatttgtgccacctaaaaaggagcgatttacatatgtttgcaaaacgat

[0113] tcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgct

[0114] gaaatgaaagatatggtc

[0115] The sequence of SEQ ID NO.3 (P43 - SamyQ) is shown as follows:

[0116] ctaatgtgtaatgagtgataggtggtatgttttcgcttgaacttttaaatacagccattgaacatacggttgatttaataactgacaaacatcaccctcttgctaaagcggccaaggacgctgccgccggggctgtttgcgtttttgccgtgatttcgtgtatcattggtttacttatttttttgccaaagctgtaatggctgaaaattcttacatttattttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataaagtgatagcggtaccattataatgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaatgaaagatatggtc The sequence of SEQ ID NO.4 (Pgrac - SamyQ) is shown as follows:

[0117] ctaatgtgtaatgagagctattgtaacataatcggtacgggggtgaaaaagctaacggaaaagggagcggaaaaga

[0118] atgatgtaagcgtgaaaaattttttatcttatcacttgaaattggaagggagattctttattataagaattgtggaattgtga

[0119] gcggataacaattcccaattaaaggaggaaggatcaatgtttgcaaaacgattcaaaacctctttactgccgttattcgc

[0120] tggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaatgaaagatatggtc

[0121]

[0122]

[0123] SEQ ID NO. 7 (pMA5 backbone gene sequence 1) is as follows:

[0124] ctcagtattttttaaggatcctctagagtcgagctcaagctagcttggtacgtaccagatctgagatcacgcgttctaga

[0125] ggtcgaaattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttttggagcctttttttttggagattttc

[0126] aacgtgaaaaaattattattcgcaattccaagctaattcacctcgaaagcaagctgataaaccgatacaattaaaggctc

[0127] cttttggagcctttttttttggagattttcaacgtgaaaaaattattattcgcaattccaagctctgcctcgcgcgtttcggtg

[0128] atgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgcagatcacgc

[0129] gccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcccta

[0130] gcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctc

[0131] cctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggcc

[0132] atcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaaca

[0133] acactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatt

[0134] taacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttgatctgcgctcggtcgttcggctgcggcgag

[0135] cggtatcagctcactcaaagcggtaatacggttatcccagaatccggggataacgcaggaaagacaggtggcacttt

[0136] tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccc

[0137] tgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggc

[0138] attttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgg

[0139] gttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcac

[0140] ttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactatt

[0141] ctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgca

[0142] gtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaacc

[0143] gcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaac

[0144] gacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactct

[0145] agcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccgg

[0146] ctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatg

[0147] gtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgct

[0148] gagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttca

[0149] tttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactg

[0150] agcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaa

[0151] aaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcag

[0152] cagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcct

[0153] acatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaa

[0154] gacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcga

[0155] acgacctacaccgaagtactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaag

[0156] gcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct

[0157] ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagc

[0158] ctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgt

[0159] tatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagc

[0160] gcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgatt

[0161] cattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagct

[0162] cactcattaggcaccccaggctttacactttatgcttccggcatattctcaataaaccctttagggaaataggccaggttt

[0163] tcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatg

[0164] aaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcatt

[0165] gccatacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttt

[0166] tctttacggtctttaaaaaggccgtaatatccagctaaacggtctggttataggtacattgagcaactgactgaaatgcct

[0167] caaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcc

[0168] tgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccg

[0169] atcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcga

[0170] agtgatcttccgtcacaggtatttattcgaagacgaaagggcatcgcgcgcggggaattcccgggagagctcgatat

[0171] cgcatgcggtacctctagaagaagcttggagacaaggtaaaggataaaacagcacaattccaagaaaaacacgattt

[0172] agaacctaaaaagaacgaatttgaactaactcataaccgagaggtaaaaaaagaacgaagtcgagatcagggaatg

[0173] agtttataaaataaaaaaagcacctgaaaaggtgtctttttttgatggttttgaacttgttctttcttatcttgatacatataga

[0174] aataacgtcatttttattttagttgctgaaaggtgcgttgaagtgttggtatgtatgtgttttaaagtattgaaaacccttaaa

[0175] attggttgcacagaaaaaccccatctgttaaagttataagtgactaaacaaataactaaatagatgggggtttcttttaat

[0176] attatgtgtcctaatagtagcatttattcagatgaaaaatcaagggttttagtggacaagacaaaaagtggaaaagtgag

[0177] accatggagagaaaagaaaatcgctaatgttgattactttgaacttctgcatattcttgaatttaaaaaggctgaaagagt

[0178] aaaagattgtgctgaaatattagagtataaacaaaatcgtgaaacaggcgaaagaaagttgtatcgagtgtggttttgta

[0179] aatccaggctttgtccaatgtgcaactggaggagagcaatgaaacatggcattcagtcacaaaaggttgttgctgaag

[0180] ttattaaacaaaagccaacagttcgttggttgtttctcacattaacagttaaaaatgtttatgatggcgaagaattaaataa

[0181] gagtttgtcagatatggctcaaggatttcgccgaatgatgcaatataaaaaaattaataaaaatcttgttggttttatgcgt

[0182] gcaacggaagtgacaataaataataaagataattcttataatcagcacatgcatgtattggtatgtgtggaaccaacttat

[0183] tttaagaatacagaaaactacgtgaatcaaaaacaatggattcaattttggaaaaaggcaatgaaattagactatgatcc

[0184] aaatgtaaaagttcaaatgattcgaccgaaaaataaatataaatcggatatacaatcggcaattgacgaaactgcaaaa

[0185] tatcctgtaaaggatacggattttatgaccgatgatgaagaaaagaatttgaaacgtttgtctgatttggaggaaggttta

[0186] caccgtaaaaggttaatctcctatggtggtttgttaaaagaaatacataaaaaattaaaccttgatgacacagaagaag

[0187] gcgatttgattcatacagatgatgacgaaaaagccgatgaagatggattttctattattgcaatgtggaattgggaacgg

[0188] aaaaattattttattaaagagtagttcaacaaacgggccagtttgttgaagattagatgctataattgttattaaaaggattg

[0189] aaggatgcttaggaagacgagttattaatagctgaataagaacggtgctctccaaatattcttatttagaaaagcaaatc

[0190] taaaattatctgaaaagggaatgagaatagtgaatggaccaataataatgactagagaagaaagaatgaagattgttc

[0191] atgaaattaaggaacgaatattggataaatatggggatgatgttaaggctattggtgtttatggctctcttggtcgtcaga

[0192] ctgatgggccctattcggatattgagatgatgtgtgtcatgtcaacagaggaagcagagttcagccatgaatggacaa

[0193] ccggtgagtggaaggtggaagtgaattttgatagcgaagagattctactagattatgcatctcaggtggaatcagattg

[0194] gccgcttacacatggtcaatttttctctattttgccgatttatgattcaggtggatacttagagaaagtgtatcaaactgcta

[0195] aatcggtagaagcccaaacgttccacgatgcgatttgtgcccttatcgtagaagagctgtttgaatatgcaggcaaatg

[0196] gcgtaatattcgtgtgcaaggaccgacaacatttctaccatccttgactgtacaggtagcaatggcaggtgccatgttg

[0197] attggtctgcatcatcgcatctgttatacgacgagcgcttcggtcttaactgaagcagttaagcaatcagatcttccttca

[0198] ggttatgaccatctgtgccagttcgtaatgtctggtcaactttccgactctgagaaacttctggaatcgctagagaatttct

[0199] ggaatgggattcaggagtggacagaacgacacggatatatagtggatgtgtcaaaacgcataccattttgaacgatg

[0200] acctctaataattgttaatcatgttggttacgtatttattaacttctcctagtattagtaattatcatggctgtcatggcgcatta

[0201] acggaataaagggtgtgcttaaatcgggccattttgcgtaataagaaaaaggattaattatgagcgaattgaattaataa

[0202] taaggtaatagatttacattagaaaatgaaaggggattttatgcgtgagaatgttacagtctatcccggcattgccagtc

[0203] ggggatattaaaaagagtataggtttttattgcgataaactaggtttcactttggttcaccatgaagatggattcgcagttc

[0204] taatgtgtaatgagggcggcgttctgttt

[0205] SEQ ID NO.8 (pMA5 backbone gene sequence 2) is shown as follows:

[0206] ctcagtattttttaaggatcctctagagtcgagctcaagctagcttggtacgtaccagatctgagatcacgcgttctaga

[0207] ggtcgaaattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttttggagcctttttttttggagattttc

[0208] aacgtgaaaaaattattattcgcaattccaagctaattcacctcgaaagcaagctgataaaccgatacaattaaaggctc

[0209] cttttggagcctttttttttggagattttcaacgtgaaaaaattattattcgcaattccaagctctgcctcgcgcgtttcggtg

[0210] atgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgcagatcacgc

[0211] gccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcccta

[0212] gcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctc

[0213] cctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggcc

[0214] atcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaaca

[0215] acactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatt

[0216] taacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttgatctgcgctcggtcgttcggctgcggcgag

[0217] cggtatcagctcactcaaagcggtaatacggttatcccagaatccggggataacgcaggaaagacaggtggcacttt

[0218] tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccc

[0219] tgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggc

[0220] attttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgg

[0221] gttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcac

[0222] ttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactatt

[0223] ctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgca

[0224] gtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaacc

[0225] gcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaac

[0226] gacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactct

[0227] agcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccgg

[0228] ctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatg

[0229] gtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgct

[0230] gagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttca

[0231] tttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactg

[0232] agcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaa

[0233] aaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcag

[0234] cagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcct

[0235] acatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaa

[0236] gacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcga

[0237] acgacctacaccgaagtactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaag

[0238] gcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct

[0239] ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagc

[0240] ctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgt

[0241] tatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagc

[0242] gcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgatt

[0243] cattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagct

[0244] cactcattaggcaccccaggctttacactttatgcttccggcatattctcaataaaccctttagggaaataggccaggttt

[0245] tcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatg

[0246] aaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcatt

[0247] gccatacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttt

[0248] tctttacggtctttaaaaaggccgtaatatccagctaaacggtctggttataggtacattgagcaactgactgaaatgcct

[0249] caaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcc

[0250] tgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccg

[0251] atcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcga

[0252] agtgatcttccgtcacaggtatttattcgaagacgaaagggcatcgcgcgcggggaattcccgggagagctcgatat

[0253] cgcatgcggtacctctagaagaagcttggagacaaggtaaaggataaaacagcacaattccaagaaaaacacgattt

[0254] agaacctaaaaagaacgaatttgaactaactcataaccgagaggtaaaaaaagaacgaagtcgagatcagggaatg

[0255] agtttataaaataaaaaaagcacctgaaaaggtgtctttttttgatggttttgaacttgttctttcttatcttgatacatataga

[0256] aataacgtcatttttattttagttgctgaaaggtgcgttgaagtgttggtatgtatgtgttttaaagtattgaaaacccttaaa

[0257] attggttgcacagaaaaaccccatctgttaaagttataagtgactaaacaaataactaaatagatgggggtttcttttaat

[0258] attatgtgtcctaatagtagcatttattcagatgaaaaatcaagggttttagtggacaagacaaaaagtggaaaagtgag

[0259] accatggagagaaaagaaaatcgctaatgttgattactttgaacttctgcatattcttgaatttaaaaaggctgaaagagt

[0260] aaaagattgtgctgaaatattagagtataaacaaaatcgtgaaacaggcgaaagaaagttgtatcgagtgtggttttgta

[0261] aatccaggctttgtccaatgtgcaactggaggagagcaatgaaacatggcattcagtcacaaaaggttgttgctgaag

[0262] ttattaaacaaaagccaacagttcgttggttgtttctcacattaacagttaaaaatgtttatgatggcgaagaattaaataa

[0263] gagtttgtcagatatggctcaaggatttcgccgaatgatgcaatataaaaaaattaataaaaatcttgttggttttatgcgt

[0264] gcaacggaagtgacaataaataataaagataattcttataatcagcacatgcatgtattggtatgtgtggaaccaacttat

[0265] tttaagaatacagaaaactacgtgaatcaaaaacaatggattcaattttggaaaaaggcaatgaaattagactatgatcc

[0266] aaatgtaaaagttcaaatgattcgaccgaaaaataaatataaatcggatatacaatcggcaattgacgaaactgcaaaa

[0267] tatcctgtaaaggatacggattttatgaccgatgatgaagaaaagaatttgaaacgtttgtctgatttggaggaaggttta

[0268] caccgtaaaaggttaatctcctatggtggtttgttaaaagaaatacataaaaaattaaaccttgatgacacagaagaag

[0269] gcgatttgattcatacagatgatgacgaaaaagccgatgaagatggattttctattattgcaatgtggaattgggaacgg

[0270] aaaaattattttattaaagagtagttcaacaaacgggccagtttgttgaagattagatgctataattgttattaaaaggattg

[0271] aaggatgcttaggaagacgagttattaatagctgaataagaacggtgctctccaaatattcttatttagaaaagcaaatc

[0272] taaaattatctgaaaagggaatgagaatagtgaatggaccaataataatgactagagaagaaagaatgaagattgttc

[0273] atgaaattaaggaacgaatattggataaatatggggatgatgttaaggctattggtgtttatggctctcttggtcgtcaga

[0274] ctgatgggccctattcggatattgagatgatgtgtgtcatgtcaacagaggaagcagagttcagccatgaatggacaa

[0275] ccggtgagtggaaggtggaagtgaattttgatagcgaagagattctactagattatgcatctcaggtggaatcagattg

[0276] gccgcttacacatggtcaatttttctctattttgccgatttatgattcaggtggatacttagagaaagtgtatcaaactgcta

[0277] aatcggtagaagcccaaacgttccacgatgcgatttgtgcccttatcgtagaagagctgtttgaatatgcaggcaaatg

[0278] gcgtaatattcgtgtgcaaggaccgacaacatttctaccatccttgactgtacaggtagcaatggcaggtgccatgttg

[0279] attggtctgcatcatcgcatctgttatacgacgagcgcttcggtcttaactgaagcagttaagcaatcagatcttccttca

[0280] ggttatgaccatctgtgccagttcgtaatgtctggtcaactttccgactctgagaaacttctggaatcgctagagaatttct

[0281] ggaatgggattcaggagtggacagaacgacacggatatatagtggatgtgtcaaaacgcataccattttgaacgatg

[0282] acctctaataattgttaatcatgttggttacgtatttattaacttctcctagtattagtaattatcatggctgtcatggcgcatta

[0283] acggaataaagggtgtgcttaaatcgggccattttgcgtaataagaaaaaggattaattatgagcgaattgaattaataa

[0284] taaggtaatagatttacattagaaaatgaaaggggattttatgcgtgagaatgttacagtctatcccggcattgccagtc

[0285] ggggatattaaaaagagtataggtttttattgcgataaactaggtttcactttggttcaccatgaagatggattcgcagttc

[0286] taatgtgtaatgaggttcggattcatcta

[0287] SEQ ID NO.9 (pMA5 backbone gene sequence 3) is shown as follows:

[0288] ctcagtattttttaaggatcctctagagtcgagctcaagctagcttggtacgtaccagatctgagatcacgcgttctaga

[0289] ggtcgaaattcacctcgaaagcaagctgataaaccgatacaattaaaggctccttttggagcctttttttttggagattttc

[0290] aacgtgaaaaaattattattcgcaattccaagctaattcacctcgaaagcaagctgataaaccgatacaattaaaggctc

[0291] cttttggagcctttttttttggagattttcaacgtgaaaaaattattattcgcaattccaagctctgcctcgcgcgtttcggtg

[0292] atgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgcagatcacgc

[0293] gccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcccta

[0294] gcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctc

[0295] cctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggcc

[0296] atcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaaca

[0297] acactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatt

[0298] taacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttgatctgcgctcggtcgttcggctgcggcgag

[0299] cggtatcagctcactcaaagcggtaatacggttatcccagaatccggggataacgcaggaaagacaggtggcacttt

[0300] tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccc

[0301] tgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggc

[0302] attttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgg

[0303] gttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcac

[0304] ttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactatt

[0305] ctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgca

[0306] gtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaacc

[0307] gcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaac

[0308] gacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactct

[0309] agcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccgg

[0310] ctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatg

[0311] gtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgct

[0312] gagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttca

[0313] tttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactg

[0314] agcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaa

[0315] aaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcag

[0316] cagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcct

[0317] acatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaa

[0318] gacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcga

[0319] acgacctacaccgaagtactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaag

[0320] gcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct

[0321] ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagc

[0322] ctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgt

[0323] tatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagc

[0324] gcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgatt

[0325] cattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagct

[0326] cactcattaggcaccccaggctttacactttatgcttccggcatattctcaataaaccctttagggaaataggccaggttt

[0327] tcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatg

[0328] aaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcatt

[0329] gccatacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttt

[0330] tctttacggtctttaaaaaggccgtaatatccagctaaacggtctggttataggtacattgagcaactgactgaaatgcct

[0331] caaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcc

[0332] tgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccg

[0333] atcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcga

[0334] agtgatcttccgtcacaggtatttattcgaagacgaaagggcatcgcgcgcggggaattcccgggagagctcgatat

[0335] cgcatgcggtacctctagaagaagcttggagacaaggtaaaggataaaacagcacaattccaagaaaaacacgattt

[0336] agaacctaaaaagaacgaatttgaactaactcataaccgagaggtaaaaaaagaacgaagtcgagatcagggaatg

[0337] agtttataaaataaaaaaagcacctgaaaaggtgtctttttttgatggttttgaacttgttctttcttatcttgatacatataga

[0338] aataacgtcatttttattttagttgctgaaaggtgcgttgaagtgttggtatgtatgtgttttaaagtattgaaaacccttaaa

[0339] attggttgcacagaaaaaccccatctgttaaagttataagtgactaaacaaataactaaatagatgggggtttcttttaat

[0340] attatgtgtcctaatagtagcatttattcagatgaaaaatcaagggttttagtggacaagacaaaaagtggaaaagtgag

[0341] accatggagagaaaagaaaatcgctaatgttgattactttgaacttctgcatattcttgaatttaaaaaggctgaaagagt

[0342] aaaagattgtgctgaaatattagagtataaacaaaatcgtgaaacaggcgaaagaaagttgtatcgagtgtggttttgta

[0343] aatccaggctttgtccaatgtgcaactggaggagagcaatgaaacatggcattcagtcacaaaaggttgttgctgaag

[0344] ttattaaacaaaagccaacagttcgttggttgtttctcacattaacagttaaaaatgtttatgatggcgaagaattaaataa

[0345] gagtttgtcagatatggctcaaggatttcgccgaatgatgcaatataaaaaaattaataaaaatcttgttggttttatgcgt

[0346] gcaacggaagtgacaataaataataaagataattcttataatcagcacatgcatgtattggtatgtgtggaaccaacttat

[0347] tttaagaatacagaaaactacgtgaatcaaaaacaatggattcaattttggaaaaaggcaatgaaattagactatgatcc

[0348] aaatgtaaaagttcaaatgattcgaccgaaaaataaatataaatcggatatacaatcggcaattgacgaaactgcaaaa

[0349] tatcctgtaaaggatacggattttatgaccgatgatgaagaaaagaatttgaaacgtttgtctgatttggaggaaggttta

[0350] caccgtaaaaggttaatctcctatggtggtttgttaaaagaaatacataaaaaattaaaccttgatgacacagaagaag

[0351] gcgatttgattcatacagatgatgacgaaaaagccgatgaagatggattttctattattgcaatgtggaattgggaacgg

[0352] aaaaattattttattaaagagtagttcaacaaacgggccagtttgttgaagattagatgctataattgttattaaaaggattg

[0353] aaggatgcttaggaagacgagttattaatagctgaataagaacggtgctctccaaatattcttatttagaaaagcaaatc

[0354] taaaattatctgaaaagggaatgagaatagtgaatggaccaataataatgactagagaagaaagaatgaagattgttc

[0355] atgaaattaaggaacgaatattggataaatatggggatgatgttaaggctattggtgtttatggctctcttggtcgtcaga

[0356] ctgatgggccctattcggatattgagatgatgtgtgtcatgtcaacagaggaagcagagttcagccatgaatggacaa

[0357] ccggtgagtggaaggtggaagtgaattttgatagcgaagagattctactagattatgcatctcaggtggaatcagattg

[0358] gccgcttacacatggtcaatttttctctattttgccgatttatgattcaggtggatacttagagaaagtgtatcaaactgcta

[0359] aatcggtagaagcccaaacgttccacgatgcgatttgtgcccttatcgtagaagagctgtttgaatatgcaggcaaatg

[0360] gcgtaatattcgtgtgcaaggaccgacaacatttctaccatccttgactgtacaggtagcaatggcaggtgccatgttg

[0361] attggtctgcatcatcgcatctgttatacgacgagcgcttcggtcttaactgaagcagttaagcaatcagatcttccttca

[0362] ggttatgaccatctgtgccagttcgtaatgtctggtcaactttccgactctgagaaacttctggaatcgctagagaatttct

[0363] ggaatgggattcaggagtggacagaacgacacggatatatagtggatgtgtcaaaacgcataccattttgaacgatg

[0364] acctctaataattgttaatcatgttggttacgtatttattaacttctcctagtattagtaattatcatggctgtcatggcgcatta

[0365] acggaataaagggtgtgcttaaatcgggccattttgcgtaataagaaaaaggattaattatgagcgaattgaattaataa

[0366] taaggtaatagatttacattagaaaatgaaaggggattttatgcgtgagaatgttacagtctatcccggcattgccagtc

[0367] ggggatattaaaaagagtataggtttttattgcgataaactaggtttcactttggttcaccatgaagatggattcgcagttc

[0368] taatgtgtaatgagtgataggtggtatgt

[0369]

[0370]

[0371] Example 2 Construction of Plasmid-type Recombinant Glutaminase B.amyloliquefaciens Engineering Bacteria

[0372] The six groups of recombinant plasmids pMA-glu1, pMA-glu2, pMA-glu3, pMA-glu4, pMA-glu5, and pMA-glu6 obtained in Example 1 were transformed into competent cells of Bacillus amyloliquefaciens ESP827 by electroporation. The specific method is as follows:

[0373] (1) The recombinant plasmids were treated by demethylation and methylation modification means. First, the recombinant vector was demethylated, and then methylated by BamHⅠ methyltransferase. First, the above recombinant plasmids pMA-glu1, pMA-glu2, pMA-glu3, pMA-glu4, pMA-glu5, and pMA-glu6 were transformed into Escherichia coli DH10b by the CaCl 2 method for demethylation treatment, and recombinant transformants were screened on ampicillin plates. The recombinant strains of DH10b were cultured, and the demethylated recombinant plasmids pMA-glu1, pMA-glu2, pMA-glu3, pMA-glu4, pMA-glu5, and pMA-glu6 were extracted. Then, the recombinant plasmids pMA-glu1, pMA-glu2, pMA-glu3, pMA-glu4, pMA-glu5, and pMA-glu6 were methylated in vitro using BamHⅠ methyltransferase from NEB. After the modification reaction, the specifically modified recombinant plasmids pMA-glu1, pMA-glu2, pMA-glu3, pMA-glu4, pMA-glu5, and pMA-glu6 were recovered again using a DNA purification kit.

[0374] (2) The solutions required for the electroporation experiment are as follows:

[0375] LBS medium: LB + 0.5M sorbitol

[0376] Electroporation medium: 0.5M sorbitol, 0.5M mannitol, 10% glycerol

[0377] RM medium: LB + 0.5M sorbitol + 0.38M mannitol

[0378] (3) A single colony of B.amyloliquefaciens ESP827 was inoculated into 3 mL of LB medium and cultured overnight at 37°C and 170 rpm.

[0379] (4) Inoculate 1 mL of the overnight culture into 15 mL of LBS medium and culture at 37 °C and 170 rpm until OD600 = 0.82.

[0380] (5) Immerse the bacterial solution in an ice-water bath for 10 min, transfer it to a 2 mL centrifuge tube, with 1.5 mL of the bacterial solution in each tube, and then centrifuge at 4000 rpm and 4 °C for 5 min to collect the bacterial cells.

[0381] (6) Resuspend the bacterial cells with pre-cooled electroporation medium. Combine the bacterial cells in every two tubes into one tube, centrifuge at 4000 rpm and 4 °C for 5 min to remove the supernatant, and rinse 4 times in this way.

[0382] (7) Resuspend the washed bacterial cells in 60 μL of electroporation medium, mix well, and make a slight supplement to make the volume of the bacterial solution in each EP tube about 95 μL, thus obtaining the competent cells of Bacillus amyloliquefaciens.

[0383] (8) Add 5 μL of the transformed recombinant plasmid to 95 μL of the competent cells, incubate on ice for 5 min, add it to a pre-cooled electroporation cuvette (2 mm), and perform one electrotransformation. The parameters of the electroporator are set as: 2.5 kV, time constant = 4.5 - 5.0 ms.

[0384] (9) After the electrotransformation is completed, take out the electroporation cuvette and immediately add 1 mL of RM medium. Resuscitate at 37 °C and 100 rpm for 1.0 h, then adjust to 170 rpm and resuscitate for 2.0 h. Centrifuge to remove 700 μL of the supernatant, spread it on a resistant plate containing 100 μg / mL kanamycin, and culture overnight at 37 °C. Obtain the recombinant strains BAG1, BAG2, BAG3, BAG4, BAG5, and BAG6.

[0385] Name the recombinant strain BAG6 as Bacillus amyloliquefaciens BAG6, and deposit it in the China Center for Type Culture Collection (CCTCC) on June 9, 2022. The deposit number is CCTCC NO: M 2022850.

[0386] Example 3 High-level expression and enzyme activity determination of glutaminase in recombinant engineering bacteria BAG1 - BAG6

[0387] (1) Seed culture: Pick single colonies of the constructed recombinant strains BAG1, BAG2, BAG3, BAG4, BAG5, and BAG6 and inoculate them into a 250 mL shake flask (25 mL of LB, the final concentration of kanamycin is 100 μg / mL), and culture overnight at 37 °C and 180 rpm.

[0388] (2) Shake flask fermentation: Transfer 500 μL of the seed culture medium into a 250 mL shake flask (25 mL TB, final kanamycin concentration is 100 μg / mL), and ferment in a shaker at 37 °C and 180 rpm. Take the fermentation broth at different time points, centrifuge at 4 °C and 7000 rpm for 5 min to remove the cells, and collect the supernatant for the determination of enzyme activity.

[0389] (3) Enzyme activity definition: Under the condition of 37 °C, the amount of glutaminase required to catalyze the formation of 1 μmol of glutamic acid from glutamine per minute is defined as 1 enzyme activity unit.

[0390] (4) Method for determining glutaminase activity: Biosensor method. Pipette 1.0 mL of the enzyme solution into a test tube and incubate in a 37 °C water bath for 5 min; then add 1.0 mL of the substrate solution and immediately start timing the reaction in a 37 °C water bath; after exactly 10 min of reaction, add 1.0 mL of 0.75 mol / L perchloric acid solution, mix well, and ice-bath for 1 min; then add 1.0 mL of 0.75 mol / L sodium hydroxide solution, mix well to obtain a mixed solution; prepare the buffer solution required for the biosensor and calibrate it before detecting glutamic acid; respectively inject 25 μL of the enzyme-catalyzed reaction mixed solution and the blank control mixed solution obtained in step 3 for detection.

[0391] After detection, the above 6 recombinant strains all achieved the secretion and expression of glutaminase, and the enzyme activities in the supernatant obtained by fermentation under the above conditions in a 250 mL shake flask were as follows: the enzyme activity in the fermentation broth of recombinant strain BAG1 was 0.7 U / mL, the enzyme activity in the fermentation broth of recombinant strain BAG2 was 1.2 U / mL, the enzyme activity in the fermentation broth of recombinant strain BAG3 was 1.5 U / mL, the enzyme activity in the fermentation broth of recombinant strain BAG4 was 0.5 U / mL, the enzyme activity in the fermentation broth of recombinant strain BAG5 was 1.3 U / mL, and the enzyme activity in the fermentation broth of recombinant strain BAG6 was 2.5 U / mL. Among the six genetically engineered recombinant bacteria, the glutaminase expressed by recombinant strain BAG6 had the highest enzyme activity. Example 4 Construction of B. amyloliquefaciens engineering bacteria with genome-integrated recombinant expression of glutaminase

[0392] The srfA gene responsible for bubble production in Bacillus was retrieved from the NCBI website. The sgRNA sequence (SEQ ID NO.11) of the srfA gene related to B. amyloliquefaciens was predicted using the online website http: / / chopchop.cbu.uib.no / . Primers P23 / P24 were designed based on the sgRNA sequence, and the backbone gene sequence of the CRISPR system was obtained by PCR reaction using the pHY-Cas9 plasmid as a template. The recombinant plasmid pHY-Cas9-1 was obtained by ligation. Primers P25 / p26 were designed to amplify the plasmid backbone of the CRISPR system by PCR using the recombinant plasmid pHY-Cas9-1 as a template. Primers P27 / P28 and P29 / P30 were designed to amplify the upstream and downstream homologous arm gene sequences (SEQ ID NO.12-13) of srfA by PCR using the B. amyloliquefaciens genome as a template. Primers P31 / P32 were designed to perform a PCR reaction using the recombinant plasmid pMA-glu6 as a template to obtain (SEQ ID NO.14). Using Gibson assembly, the backbone gene sequence of the CRISPR system was assembled and ligated with the genes (SEQ ID NO.12-13) and the gene (SEQ ID NO.14) respectively. The ligation product was chemically transformed into Escherichia coli TOP10 competent cells. The transformation solution was spread on an LB plate containing ampicillin (100 mg / L) and cultured overnight. Transformants were picked for colony PCR, and plasmids were extracted from the positive transformants. The sequencing work was completed by Sangon Biotech (Shanghai) Co., Ltd., and the recombinant plasmid pHY-Cas9-Glu6 was obtained. The plasmid map is as shown in Figure 7 shown.

[0393] Among them, the SEQ ID NO.11 (sgRNA sequence) is as follows:

[0394] atacccaggtgtgaaagatg

[0395] The sequence of SEQ ID NO.12 (homologous arm gene sequence upstream of sfrA) is shown as follows: cgctttgcccaagctttgaaggggcttcgctgtatattattcggcggagagcgcgcgtcagtgcctcatgtcagaaaagcgctgcggatcatggggccgggcaagctgattaactgctacgggccgactgagggaacagtgtttgcgacagctcacgtcgtgcatgatctgccggattccatctcctcattgccgatcggaaagccgatcagcaatgccagtgtttatattctgaatgagcaaagccagctccagccattcggggcggtcggtgaactgtgcatcagcggaatgggcgtgtcaaaagggtatgtaaatcgtgctgacctcacgaaggaaaagtttatcgagaacccgttcaagccgggagaaacgctttaccgtacaggggatttagcgcgctggctgccggatggaacgattgaatacgccggccgtattgacgaccaggtcaaaatacgcggacaccggattgagcttgaagaaatcgaaaagcagctgcaggagttcggattcatctat

[0396] The sequence of SEQ ID NO.13 (homologous arm gene sequence downstream of sfrA) is shown as follows: aagcggatgcagatccggtcgttgtggcggaccgccatgagtctggcgatgcatcaatcaatgcctaccttgtgaaccgaacgcagctttcagctgaagacgtgaaggcgcacctgaaaaaacagcttcctgcttacatggtgccgcaaacctttaccttcttggatgagcttcctttaacgacgaacgggaaagtcaataaacggctgctcccaaaacctgatcaggatcagctggcggaagaatggattggaccgcggaacgagatggaagaaacaatcgcacaaatatggtctgaggttctcggcagaaagcaaattggcattcatgacgatttctttgcgctcggagggcattccttgaaggccatgaccgccgcgtcccgcatcaagaaagagctcgggattgatcttccagtgaagcttttgtttgaagcgccgacgatcgccggcatttcagcgtatttgaaaaacgggggctctgatggcttgcaggatgtaacctagactggctgaaaacat

[0397]

[0398] The obtained recombinant plasmid pHY-Cas9-Glu6 was transformed into competent cells of B. amyloliquefaciens ESP827 by electroporation. The specific method was referred to the method for constructing the plasmid-type recombinant expression glutaminase B. amyloliquefaciens engineering bacteria in Example 2. The picked positive recombinant strains were subcultured in antibiotic-free medium to screen the strains with plasmid loss of the CRISPR system. After multiple rounds of PCR verification, the genome-integrated recombinant expression glutaminase B. amyloliquefaciens genetic engineering bacteria BAG6-1 were finally obtained.

[0399] The genetic engineering bacteria BAG6-1 were named Bacillus amyloliquefaciens BAG6-1, and were deposited in the China Center for Type Culture Collection (CCTCC) on June 9, 2022, with the deposit number of CCTCC NO: M 2022849.

[0400] The obtained genetic engineering bacteria BAG6-1 were fermented to produce glutaminase in a 50 L fermenter. The specific method was as follows: the inoculum size was 6%, the fermentation temperature was 30 °C, the pH was maintained at 6.0 - 7.0 by adding alkali during the fermentation process, the rotation speed was 550 rpm, the ventilation ratio was 1:1, and the OD600, residual sugar and glutaminase activity were detected at fixed time points during the fermentation process.

[0401] The 50 L tank fermentation of the genetic engineering recombinant strain BAG6-1 was verified, and the enzyme activity was detected by sampling at fixed points. The results showed that the highest enzyme activity of glutaminase in the fermentation broth was 17 U / mL.

[0402] Example 5 Analysis of genetic stability of recombinant bacteria

[0403] The recombinant strain BAG6 and the recombinant strain BAG6-1 were inoculated into antibiotic-free LB liquid medium and cultured at 37 °C for 24 h, then inoculated into antibiotic-free fermentation medium at an inoculum size of 2% and cultured at 37 °C. After 24 h, samples were taken to measure the glutaminase activity, and then transferred to fresh fermentation medium at an inoculum size of 2% and so on. The measurement was carried out for 7 days. The results showed that the enzyme activity of the recombinant strain BAG6-1 remained basically unchanged during the 7-day measurement, while no enzyme activity could be detected after 5 days of subculture of the recombinant strain BAG-6, and the presence of plasmid could not be detected by colony PCR. This indicated that the stability of the genome-integrated recombinant bacteria BAG6-1 was much better than that of the plasmid-type recombinant bacteria BAG6, which provided a guarantee for the stable production of glutaminase.

[0404] Example 6 Analysis of extraction and preparation of glutaminase

[0405] The extraction and preparation results of the fermentation broth of the BAG6 secreted expression type glutaminase were compared with those of the original intracellular expression type glutaminase fermentation broth, mainly including homogenization, flocculation, filtration, concentration, fine filtration and drying. The result analysis showed that the original intracellular expression type glutaminase had great losses in both the filtration and concentration stages. The yield loss in only the concentration step was 72.5%, and the final total yield was only 9.23%, making it completely impossible to achieve industrial production. However, the yield of each step of the newly constructed BAG6 secreted expression type glutaminase was about 90%, and the final total yield was above 90%. That is to say, the secreted expression type glutaminase strain constructed in the present invention can be applied to the fermentation production of enzymes, which can greatly improve the extraction and preparation yield of the enzyme, reduce costs, and meet the requirements of industrial production.

[0406] The above is the preferred implementation mode of the present invention. Of course, the scope of the rights of the present invention cannot be limited by this. It should be pointed out that for those of ordinary skill in the art of this technology, without departing from the principle of the present invention, several improvements and changes can be made, and these improvements and changes are also regarded as the protection scope of the present invention.

Claims

1. A genetically engineered strain that secretes and expresses glutaminase, characterized in that, the strain has the following characteristics: (a) One of the following constructs is integrated into the genome: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, and PHpaII-PamyQ-SamyQ; Or, (b) the cell contains an expression vector containing one of the following constructs: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, and PHpaII-PamyQ-SamyQ; The gene sequences of the PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, and PHpaII-PamyQ-SamyQ are shown in SEQ ID NO.1 - SEQ ID NO.6 respectively; The genetically engineered strain uses the Bacillus amyloliquefaciens strain ESP827 with the preservation number of CCTCC No: M 2018828 as the host.

2. The genetically engineered strain according to claim 1, characterized in that, any one of the gene loci of the host integrates the construct.

3. The genetically engineered strain according to claim 2, characterized in that, the srfA locus of the host is integrated with the construct.

4. The genetically engineered strain according to claim 1, characterized in that, the expression vector is a pUC plasmid.

5. The genetically engineered strain according to claim 2, characterized in that, the expression vector is a pUC plasmid.

6. The genetically engineered strain according to claim 3, characterized in that, the expression vector is a pUC plasmid.

7. The genetically engineered strain according to any one of claims 1 - 6, characterized in that, the genetically engineered strain is Bacillus amyloliquefaciens BAG6-1, which is preserved in the China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: M2022849; Or, the genetically engineered strain is Bacillus amyloliquefaciens BAG6, which is preserved in the China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCCNO: M 2022850.

8. The construction method of the genetically engineered strain according to any one of claims 1 - 7, characterized in that, the construction method includes the following steps: Integrate the said construct into the chromosomal genome of the host cell or transform the expression vector containing the construct into the host cell.

9. According to the construction method of claim 8, It is characterized in that the construction method includes: using gene editing technology and / or homologous recombination to directionally transform a host cell, so that any one of the gene loci in the host cell contains the construct of the gene editing technology and / or homologous recombination.

10. The construction method according to claim 9, It is characterized in that the construction method makes the srfA locus of the host cell contain the construct of the gene editing technology and / or homologous recombination.

11. The construction method according to claim 9, It is characterized in that the gene editing technology is selected from one or a combination of two or more of ZFN editing, TALEN editing or CRISPR / Cas9 editing.

12. The construction method according to claim 10, It is characterized in that the gene editing technology is selected from one or a combination of two or more of ZFN editing, TALEN editing or CRISPR / Cas9 editing.

13. The construction method according to any one of claims 9-12, It is characterized in that the homologous recombination is selected from λ-red homologous recombination or homologous recombination mediated by the sacB gene screening or homologous recombination mediated by an integration plasmid.

14. Application of the genetic engineering strain according to any one of claims 1-7 or the genetic engineering strain obtained by the construction method according to any one of claims 8-13 in fermenting to produce glutaminase.

15. Application of the genetic engineering strain according to any one of claims 1-7 or the genetic engineering strain obtained by the construction method according to any one of claims 8-13 in food additives or health products.

16. The application according to claim 15, It is characterized in that the food additive is soy sauce or yeast extract.

17. A method for fermenting to produce glutaminase, It is characterized in that the method includes culturing the genetic engineering strain according to any one of claims 1-7 or the genetic engineering strain obtained by the construction method according to any one of claims 8-13.

18. The method according to claim 17, It is characterized in that the inoculation amount of the strain is 4%-8%.

19. The method according to claim 17 or 18, It is characterized in that the fermentation temperature of the strain is 24°C-37°C; and / or, the pH is maintained at 6-7.0 by adding alkali during the fermentation process; and / or, the fermentation rotation speed is 500-600 rpm; and / or, the fermentation ventilation ratio is 1:

1.

20. A recombinant expression vector, It is characterized in that the expression vector contains one of the following constructs: PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ, and PHpaII-PamyQ-SamyQ; The gene sequences of PamyQ-SamyQ, PHpaII-SamyQ, P43-SamyQ, Pgrac-SamyQ, PamyQ-PHpaII-SamyQ and PHpaII-PamyQ-SamyQ are shown in SEQ ID NO.1-SEQ ID NO.6 respectively.

Images