Application of Genes BldD, metK, and genC in Regulating Gentamicin Production

By overexpressing the BldD, metK and genC genes in Minormonas acupuncture, the synthesis process of gentamicin was regulated, and the problem of insufficient research on regulatory factors in the prior art was solved, and the yield of gentamicin was significantly improved.

CN115838776BActive Publication Date: 2025-06-17EAST CHINA UNIV OF SCI & TECH +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211457019.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-21
Publication Date
2025-06-17
Estimated Expiration
2042-11-21

AI Technical Summary

Technical Problem

The prior art lacks effective regulatory factors in the production of gentamicin, especially in Minormonas acne, and no reports have been seen that global regulatory factors are regulated to improve antibiotic production.

Method used

The synthesis process of gentamicin is regulated by overexpressing genes BldD, metK and genC. As a global regulator, BldD is involved in the conversion of methyl groups, and genC is responsible for the conversion of precursor substances, thereby increasing the yield of gentamicin.

Benefits of technology

Through gene overexpression, the yield of gentamicin fermented by Minormonas Acupuncture was significantly improved, BldD overexpression increased by 27.8%, metK overexpression increased sugar consumption, and genC overexpression increased by 69%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115838776B_ABST
    Figure CN115838776B_ABST
Patent Text Reader

Abstract

The present invention relates to the application of genes BldD, metK, and genC in regulating the production of gentamicin, and provides a method for increasing the yield of gentamicin biosynthesis by Micromonospora echinospora. The present invention studies and discovers that overexpressing the genC gene can increase the conversion of precursor substances, with the expectation of increasing the total metabolic flux of gentamicin; overexpressing the metK gene can improve the efficiency of transmethylation reaction, with the expectation of increasing the final yield of gentamicin; overexpressing BldD, and through shake-flask fermentation of this engineered strain, it is further discovered that the BldD gene can positively regulate the production of gentamicin and has an obvious impact on its morphology during the fermentation process. Through the above research on the regulatory factors in the process of gentamicin synthesis, the titer of gentamicin can be increased at the gene regulation level.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to the application of genes BldD, metK and genC in regulating the production of gentamicin. Background Art

[0002] Gentamicin belongs to the aminoglycoside antibiotics, and its parent structure 2-DOS is connected to galactosamine and rutinamine through a glycosidic bond. Because rutinamine has different substituents and substitution sites, it can be divided into four major groups, A, B, X and C. Studies have shown that gentamicin A and X groups have the effect of resisting drug-resistant microorganisms, and their derivatives can also resist HIV and tumors. Micromonospora aculeatus is the main producer of gentamicin. It belongs to the genus Streptomyces, and the percentage of G+C in its genomic DNA is as high as 71.4%-72.8%. The surface of the colony of Micromonospora aculeatus is smooth or protruding, and it mainly reproduces by spores. Its hyphae have a very fine branching structure. The base silk is generally orange-red, and a small part is brown or purple-brown. When cultured on a plate, red colonies grow first and then turn black; after 7-10 days of culture in the incubator, it is often necessary to continue to refrigerate in a 4℃ refrigerator for several days to facilitate the single spores to fall from the plate. Micromonospora aculeatus is sensitive to environments with pH values ​​less than 6.0. It grows best in a neutral to alkaline environment, and its optimal growth temperature is around 34°C.

[0003] When constructing engineered bacteria, it is often necessary to use molecular biological methods to knock out or overexpress genes to achieve the purpose of modifying a specific gene. Ordinary PCR can amplify the target fragment with the help of specific enzymes, but this method is not very efficient for some longer or more fragments. One-step cloning PCR is designed with an overlapping part of 10-15bp in length, which can connect the target DNA fragment to the corresponding vector while amplifying it. This method is not limited by restriction enzyme sites and omits the connection process, which is economical and flexible.

[0004] With the gradual clarification of the secondary metabolic pathways of antibiotic-producing bacteria and the antibiotic synthesis pathways, through the research on the precursor synthesis pathways, the regulation of secondary metabolic synthesis genes, and global regulatory factors, the yields of many antibiotics have been increased. In terms of precursor supply, the metabolic process of actinomycetes is divided into primary metabolism in the early stage and secondary metabolism in the later stage. Some substances produced by primary metabolism can provide precursors for the subsequent secondary metabolism. If the subsequent secondary metabolism can be activated by supplementing certain key precursors, the yield of the final target product will also be increased. The precursors in the synthesis process of gentamicin are D-glucose-6-phosphate, D-xylose, and N-acetylglucosamine. By modifying the genes that regulate the conversion of precursors, the conversion efficiency of precursors can be effectively improved, thereby increasing the yield of gentamicin. According to the published gentamicin synthesis pathway, genC is responsible for the conversion of the precursor D-glucose-6-phosphate. In terms of the regulation of synthesis genes, during the secondary metabolism of Streptomyces, various enzymes play different roles, and the enzyme activities at certain key sites affect the final yield of antibiotics. Many transamination and transmethylation reactions are involved in the synthesis process of gentamicin. Among them, most methyltransferases belong to SAM-dependent methyltransferases, especially genK in the branch pathway from gentamicin X2 to G418. In Streptomyces, the gene encoding this enzyme is metK, and the methyltransferase genes of different strains have high homology. In terms of the modification of global regulatory factors, overexpressing appropriate regulatory factors can not only cause morphological changes in antibiotic-producing bacteria but also increase the yield of their antibiotics. However, in Micromonospora echinospora, there are no reports on improving the antibiotic yield by regulating global regulatory factors. Summary of the Invention

[0005] Currently, the vast majority of research on secondary metabolic regulatory factors focuses on relatively mature model strains such as Streptomyces coelicolor. For the production of aminoglycoside antibiotics, there is very little research on regulatory factors, and the research on gentamicin production is almost blank.

[0006] The purpose of the present invention is to overcome the defects of the above-mentioned existing technologies and provide the applications of genes BldD, metK, and genC in regulating the production of gentamicin, and provide a method for increasing the yield of gentamicin biosynthesized by Micromonospora echinospora.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] The present invention first provides the use of one or a combination of several of the genes BldD, metK, and genC in regulating the production of gentamicin. Among them, the sequence of the gene BldD is shown in SEQ ID NO.1, the sequence of the gene metK is shown in SEQ ID NO.2, and the sequence of the gene genC is shown in SEQ ID NO.3.

[0009] In one embodiment of the present invention, the BldD gene is a global regulator, and overexpression of the BldD gene increases the antibiotic production.

[0010] In one embodiment of the present invention, overexpression of the metK gene is used to enhance the transmethylation reaction during the synthesis of gentamicin, increase the synthesis rate of gentamicin, and increase the sugar consumption.

[0011] In one embodiment of the present invention, overexpression of the metK gene, overexpression of the methyltransferase gene metK increases the volumetric productivity and specific productivity of Micromonospora echinospora in fermenting gentamicin.

[0012] In one embodiment of the present invention, overexpression of the genC gene increases the conversion of precursor substances in order to increase the total metabolic flux of gentamicin.

[0013] In one embodiment of the present invention, overexpression of one or several of the genes BldD, metK, and genC of Micromonospora echinospora is used to increase the yield of gentamicin produced by fermentation of Micromonospora echinospora.

[0014] The present invention also provides a method for increasing the yield of biosynthetic gentamicin in Micromonospora echinospora, which is to overexpress one or several of the genes BldD, metK, and genC in Micromonospora echinospora.

[0015] In one embodiment of the present invention, the genes BldD, metK, and genC are overexpressed simultaneously in Micromonospora echinospora.

[0016] In one embodiment of the present invention, the method for increasing the yield of biosynthetic gentamicin in Micromonospora echinospora includes the following steps:

[0017] Construct plasmids overexpressing one or several of the genes BldD, metK, and genC by one-step cloning method, and obtain strains overexpressing one or several of the genes BldD, metK, and genC by conjugation transfer screening; use the strains overexpressing one or several of the genes BldD, metK, and genC to ferment and produce gentamicin.

[0018] Specifically, the sequence of the gene BldD (shown in SEQ ID NO.1) is:

[0019] atgccctctgaatacgccaagtcgctgggcgcccgcctgcgctccatccgccagcagcagggcctgtccctgcagggcgtggaggagaagtccaacggccggtggaaggccgtcgtggtcgggtcgtacgagcgcggcgaccgggccgtcaccgtttcccgcctggcggagctggccgacttctaccgcgtacccgtctccgagctgctgcccgacggcagtggcgtacggcacgagccgaccagcaagatcgtgctggatctggagcggctctacgacgaggcgtcggaggagctggcctacgtggcccggtacgcccgcgccatccagcagcagcgcggtgactacaacggccgggtgctctcgatccgcgccgacgacctgcgggccctggccatcgtgtacgacgcctcgccctccgggctgatcgagcggctcaacgagcacggtgtgctggtcgccgacccccgggcgttcttcgcgtcctga。

[0020] The sequence of gene metK (as shown in SEQ ID NO.2) is as follows:

[0021]

[0022] The sequence of gene genC (as shown in SEQ ID NO.3) is as follows:

[0023]

[0024] The present invention explores the role of the secondary metabolic regulator BldD in gentamicin synthesis, and finds that the BldD gene can positively regulate the production of gentamicin and has an obvious impact on its morphology during the fermentation process. It also explores the role of the methyltransferase metK in gentamicin production. By overexpressing this gene, the transmethylation reaction during gentamicin synthesis is enhanced, and it is found that the metK gene can significantly increase the synthesis rate of gentamicin and increase the sugar consumption. In addition, for genC during the precursor conversion process, through the overexpression of the gene, it is found that genC has a great positive regulatory effect on gentamicin synthesis.

[0025] The present invention compares multiple regulatory factors and finds the BldD gene in Micromonospora echinospora by comparing the homology of each gene through NCBI. The present invention can effectively improve the antibiotic production by overexpressing the global regulatory factor BldD.

[0026] The present invention finds three genes, genC, metK, and BldD, that regulate gentamicin synthesis in Micromonospora echinospora 49-92S, which have an impact on the titer of gentamicin at different levels. Among them, genC is responsible for the conversion of precursor substances and positively regulates the synthesis of gentamicin; metK is responsible for the transmethylation reaction during gentamicin synthesis and can increase the synthesis rate of gentamicin; BldD is a global regulatory factor, which has a great impact on the morphological changes during the fermentation process of Micromonospora echinospora and can positively regulate the synthesis of gentamicin.

[0027] The methods adopted in the present invention are mainly as follows: Gene overexpression plasmids pIB139-genC, pIB139-metK, and pIB139-BldD are constructed by one-step cloning method, and gene overexpression strains are obtained by screening through conjugation transfer. The three constructed engineering bacteria are respectively subjected to shake-flask fermentation. It is found that the fermentation titer of the genC overexpression strain is increased by 69% compared with the initial strain; the sugar consumption rate and the antibiotic production rate of the metK overexpression strain are accelerated. The production rate of gentamicin reaches 1.4 times that of the initial strain within 48 h of fermentation. The volumetric production rate of the GM::metK strain reaches 10.05 mg / L / h at 96 h of fermentation, which is about 1.1 times that of the initial strain; some apparent morphological changes occur in the BldD overexpression strain during the fermentation process. Obvious dark purple small dots appear on the wall of the fermentation shake flask, and the titer is also increased by about 27.8%.

[0028] The related genes that can regulate gentamicin synthesis were first found in Micromonospora echinospora. Although there were previous reports on the overexpression of the key genes kanM1 and genM2 in the conversion process of two precursor substances, UDP-N-acetyl-D-glucosamine and UDP-xylose, there was no report on the related research of the conversion efficiency of the key precursor D-glucose-6-phosphate from primary metabolism to secondary metabolism. The gentamicin synthesis process involves numerous transmethylation reactions. The methyltransferase gene metK has been proven to positively regulate antibiotic production in other Streptomyces species. For the first time, the intermediate conversion catalytic gene was overexpressed in Micromonospora echinospora, and this gene had a certain impact on the growth state of the bacteria and the rate of antibiotic production. The role of global regulatory factors in Micromonospora echinospora was explored for the first time. The BldD gene not only caused changes in the fermentation morphology of Micromonospora echinospora but also had a certain promoting effect on the final gentamicin titer.

[0029] Compared with the prior art, the present invention studied the related functions of several possible regulatory factors, genC, metK, and BldD, in the gentamicin synthesis process in Micromonospora echinospora, filling the blank in the research of secondary metabolic regulatory factors in Micromonospora echinospora. By constructing overexpression strains of the genC, metK, and BldD genes respectively, the effects of these three regulatory factors on gentamicin production were explored. Overexpression of the genC gene can increase the conversion of precursor substances in order to improve the total metabolic flux of gentamicin; overexpression of the metK gene can improve the transmethylation reaction efficiency in order to increase the final yield of gentamicin; overexpression of BldD, through shake-flask fermentation of this engineered strain, it was found that the BldD gene can positively regulate the production of gentamicin and had an obvious impact on its morphology during the fermentation process. Through the above research on the regulatory factors in the gentamicin synthesis process, the titer of gentamicin can be increased at the gene regulation level. Description of the Drawings

[0030] Figure 1 Fermentation process parameters of the GM::genC strain in shake flasks;

[0031] Figure 2 Fermentation verification process parameters of the GM::metK strain in shake flasks;

[0032] Figure 3 Fermentation shake flask situation and microscopic examination situation of the GM::BldD strain at 120 h of fermentation;

[0033] Figure 4 Fermentation verification process parameters of the GM::BldD strain in shake flasks. Detailed Embodiments

[0034] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] In the following examples, the strains and plasmids are as follows:

[0036]

[0037] Among them, E. coli DH5α, E. coli ET12567, Micromonospora echinospora var. purpurea plasmid, pKC1139, and pIB139 are all common biological materials in the art.

[0038] In the following examples, the primers are as follows:

[0039]

[0040]

[0041] The above primers can be prepared by conventional biological methods in the art.

[0042] In the following examples, the media used are as follows:

[0043] (1) Slant medium (g / L): soluble starch 10, calcium carbonate 1, potassium nitrate 1, magnesium sulfate heptahydrate 0.5, sodium chloride 0.5, dipotassium hydrogen phosphate trihydrate 0.3, asparagine 0.02, wheat bran 18, agar 17, mainly used for spore culture.

[0044] (2) Seed medium (g / L): corn flour 20, soluble starch 15, glucose 1, low-temperature soybean powder 15, calcium carbonate 4, feather meal 3, potassium nitrate 0.5, mainly used for seed culture during fermentation.

[0045] (3) Fermentation medium (g / L): corn flour 25, soluble starch 30, glucose 5, low-temperature soybean powder 26, calcium carbonate 7, feather meal 10, potassium nitrate 0.5, ammonium sulfate 1, CoCl2 0.03, adjust the pH to 8.0 - 8.1, mainly used for shake flask fermentation of strains.

[0046] (4) LB medium: mainly used for the culture of Escherichia coli.

[0047] (5) TSB medium: mainly used for the preparation of mycelium for genomic extraction, etc.

[0048] (6) ISP4 medium: used for the conjugation transfer operation of Escherichia coli and Streptomyces.

[0049] For basic molecular operations such as plasmid extraction and restriction digestion verification in the embodiments of the present invention, refer to the molecular operation manual. The construction of the recombinant plasmid is carried out by the one-step cloning method, and the Streptomyces conjugation transfer operation refers to the Streptomyces operation manual. The mycelium obtained after culturing Micromonospora echinospora in TSB for 7 days can be used for genomic extraction, and the specific operation can refer to the operation instructions provided by the reagent supplier.

[0050] Example 1

[0051] Construction of mutant strains

[0052] First, use the NCBI database to search for the genC gene in Micromonospora echinospora, and compare the genC of the searched Micromonospora echinospora with the genC in neomycin. The homology between the two is about 53%; search for the gene encoding SAM-dependent methyltransferase in Streptomyces, and find the metK gene. By comparing the homology of the gene sequences with the known genome, the metK gene with a similar sequence in Micromonospora echinospora was determined, and the homology between the two is about 79.9%; according to the BldD gene sequence in neomycin, use the NCBI database for alignment, and a BldD gene with a homology of 69.62% was also found in Micromonospora echinospora.

[0053] Design primers genC-F / genC-R, metK-F / metK-R, BldD-F / BldD-R with homologous arms, and amplify the genC, metK, and BldD gene fragments by PCR respectively to verify the specificity of the designed primers. Double-digest the pIB139 vector with ermE* promoter and Apr resistance gene with NdeI and XbalI, and purify and recover after digestion. Prepare a one-step cloning reaction system, and connect the PCR fragments of genC, metK, and BldD genes with homologous arms to the vector fragments respectively. Subsequently, transform the ligation products into E. coli DH5α, verify the transformants by PCR, extract the recombinant plasmids from the correct single colonies for further sequencing verification, and name the correctly verified recombinant plasmids as pIB139-genC, pIB139-metK, and pIB139-BldD respectively.

[0054] The recombinant plasmid was transformed into E. coli ET12567. Apramycin (Apr), kanamycin (Kana), and chloramphenicol (Cl) with a final concentration of 25 μg / mL were added to the LB solid plates for transformation in advance to facilitate screening. The correct transformants were selected for conjugation transfer. The conjugants were screened using apramycin resistance. During verification, primers were redesigned on the recombinant plasmid: verification permE-F / verification genC-R, verification permE-F / verification metK-R, verification permE-F / verification BldD-R for amplification. The amplified verification fragments included the promoter permE and the target gene fragments. Strains successfully constructed could amplify two fragments, while the initial strains could not amplify bands due to the absence of the permE promoter. Finally, gene overexpression strains GM::genC, GM::metK, and GM::BldD were obtained.

[0055] Example 2

[0056] Fermentation of mutant strains

[0057] The strains GM::genC, GM::metK, and GM::BldD obtained in Example 1 above were respectively cultured on slant media, and incubated in an inverted position for about 7 days under the conditions of a temperature of 34 °C and a humidity of 40%-60%. After the surface of the plate became shiny, wrinkled, and black, it was placed in a 4 °C refrigerator and refrigerated for 2-3 days for later use. During inoculation, 2 cm of the slant medium covered with colonies was dug out with a sterile bamboo stick 2 and transferred to a seed shake flask, and cultured on a shaker under the conditions of a temperature of 34 °C, a humidity of 40%-60%, and a rotation speed of 245 rpm for 48-60 h. The color change of the seed flask and the microscopic examination results were used as the transfer inoculation indicators. Subsequently, with an inoculation amount of 10%, the seed liquid was transferred to a fermentation shake flask and cultured for 6 days, and the culture conditions were the same as those of the seed flask. Samples were taken according to experimental requirements, and three shake flasks were set in parallel for each condition, and samples were taken every 24 h for measuring various parameters.

[0058] The measurement methods of the fermentation process parameters are as follows:

[0059] The cell concentration in the fermentation broth was measured by the centrifugation compression volume (PMV) method. 10 mL of the fermentation broth (V1) was added to a 15 mL centrifuge tube and centrifuged at 4000 rpm for 20 min in a tabletop centrifuge. Immediately after centrifugation, it was taken out, the supernatant was poured into a 10 mL graduated cylinder, and the scale (V2) was read. The cell concentration was calculated by the formula: PMV (%) = (V1 - V2) / V1 × 100%.

[0060] The total sugar and reducing sugar were measured by the DNS method. 100 μL of the fermentation broth supernatant was taken into a 10 mL centrifuge tube, 2.4 mL of deionized water (diluted 25 times) was added, and after mixing evenly, the measurement was carried out.

[0061] The titer was determined by high performance liquid chromatography (pre-column derivatization with OPA). The mobile phase ratio was methanol: formic acid: water = 74:5:21, and a 5 g / L sodium heptanesulfonate solution was prepared. It was filtered by an organic filter membrane and degassed by ultrasound for 30 - 60 min for standby. The fermentation broth needed to be acidified with 3M H2SO4 first to adjust the pH to about 1.8, and the acidified fermentation broth was stirred magnetically for 30 min. Subsequently, the pH was adjusted to 6.4 - 6.8 with 3M NaOH, centrifuged at 4000 rpm for 20 min, and the supernatant was derivatized and filtered for titer determination. High performance liquid chromatography conditions: injection volume was 20 μL, flow rate was 1 mL / min, detection wavelength was 330 nm, column temperature was 28 °C, detection cycle was 35 min, and isocratic elution was used. Use a 5 μm C18(2)100A chromatographic column, LC Column 250×4.6 mm.

[0062] Experimental results

[0063] (1) genC of 2-DOI synthase during the overexpression precursor conversion process

[0064] An overexpressing strain of genC was constructed using the one-step cloning method, and then the engineered bacteria were fermented for verification. The seed flask was cultured for about 59 h, and the seed liquid of the GM::genC strain turned red. At this time, it was transferred to a fermentation shake flask with an inoculation amount of 10%. During the fermentation process, samples were taken every 24 h to measure the changes in various parameters, and the measurement results are shown in Figure 1 .

[0065] The growth rate of the modified GM::genC strain was accelerated, and the carbon source was utilized later, but the overall sugar consumption level was not significantly different from that of the initial strain. In the first 48 h of fermentation, the GM::genC strain hardly consumed sugar, but the cell growth was large from 24 h to 48 h, probably because the cells were consuming other nutrients such as nitrogen sources for growth at this time; after 48 h, the residual sugar content in the fermentation broth decreased, and the carbon source was decomposed into organic acids at this time, resulting in a decrease in pH ( Figure 1 a). In terms of the growth rate, the strain overexpressing genC grew faster than the initial strain, reached the exponential growth phase at 48 h of fermentation, and the cell concentration tended to be stable after 72 h ( Figure 1 b). In terms of sugar consumption, the genC overexpressing strain utilized sugar later, and the sugar consumption rate was faster than that of the initial strain in the later stage of fermentation ( Figure 1 c). After 144 h of shake flask fermentation, the fermentation titer of the GM::genC strain increased by about 69% compared with the initial strain GM613 ( Figure 1 d).

[0066] (2) Overexpression of SAM-dependent methyltransferase metK

[0067] An overexpressing strain of metK was constructed using the one-step cloning method, and then the engineered bacteria were fermented and verified. The seed flask was cultured for about 60 h, and the GM::metK strain showed slight color change. At this time, it was transferred to the fermentation shake flask with an inoculation amount of 10%. During the shake flask fermentation, samples were taken every 24 h to measure the total sugar and pH. After the fermentation shake flask changed color, Micromonospora echinospora entered the gentamicin synthesis stage. At this time, samples were taken every 24 h to measure the titer. The measurement results are shown in Figure 2 .

[0068] For the strain overexpressing metK, the overall sugar consumption level was greatly improved, and the synthesis rate of antibiotics was accelerated. According to Figure 2 a, after overexpressing the methyltransferase gene, the sugar consumption ability in the first 48 h was not much different from that of the initial bacteria; after 48 h, the GM::metK strain consumed sugar faster, and on the sixth day of fermentation, the residual total sugar content was less. It can be seen that after overexpressing the metK gene, the overall sugar consumption ability of the strain was greatly improved. Figure 2 b shows the change of pH during the whole fermentation process. On the first day of fermentation, the pH of the fermentation broth of the GM::metK strain began to decrease, indicating that the modified strain had begun to consume sugar and grow, while the pH of the initial strain decreased significantly on the second day, which further indicated that the GM::metK strain grew faster than the initial strain ( Figure 2 c). For the change of titer during the fermentation process ( Figure 2 d), the production rate of gentamicin by the GM::metK strain was accelerated. During the fermentation from 24 to 48 h, the yield of gentamicin by the GM::metK strain was about 1.4 times that of the initial bacteria. At 96 h of fermentation, the volumetric productivity of the GM::metK strain reached 10.05 mg / L / h, about 1.1 times that of the initial strain.

[0069] (3) Overexpression of the global regulatory factor BldD

[0070] An overexpressing strain of BldD was constructed using the one-step cloning method, and then the engineered bacteria were fermented and verified. The seed flask was cultured to 60 h, and the fermentation broth of the GM::BldD strain turned red-black. At this time, it was transferred to the fermentation shake flask with an inoculation amount of 10%. Samples were taken every 24 h for microscopic examination during the whole process to measure parameters such as pH, sugar, phosphorus, cell concentration, and titer.

[0071] During the shake flask fermentation process, the color change of the fermentation broth and the change of mycelial morphology were monitored. The microscopic examination results are shown in Figure 3。When flask fermentation reached 24 h, mycelia of the original strain GM613 adhered to the wall, while obvious wall adhesion of the GM::BldD strain occurred at 48 h. Moreover, throughout the fermentation cycle, the gentamicin fermentation broth of the original strain was always more viscous than that of the GM::BldD strain. After about 120 h of fermentation, the GM::BldD strain began to turn purple, and many dark purple small dots appeared on the inner wall of the flask, probably caused by mycelial aggregation. Microscopic examination results showed that at 120 h of fermentation, the GM::BldD strain still had an aggregation phenomenon and the mycelia were relatively developed, while the GM613 strain was more dispersed, showing thin and short mycelia.

[0072] After overexpressing the BldD gene, the cell concentration of the strain increased slowly, but the sugar consumption rate accelerated in the later stage of fermentation, and the final titer was also increased to a certain extent. The growth of the GM::BldD strain showed a slow upward trend, while the original strain grew rapidly at 24 - 48 h and then tended to be stable ( Figure 4 b); after 72 h of fermentation, the growth of the BldD overexpressing strain accelerated, and the sugar consumption rate was faster than that of the original strain ( Figure 4 c); after 96 h of fermentation of the GM::BldD strain, the pH began to decrease again ( Figure 4 a), the cell concentration also increased slightly, and the total sugar content decreased sharply, indicating that the GM::BldD strain might have a new round of growth. Figure 4 d shows the comparison of titers at the end of fermentation. Compared with the starting strain, the final fermentation titer of the GM::BldD strain increased by about 27.8%.

[0073] The above description of the embodiments is to enable those of ordinary skill in the art to understand and use the invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative efforts. Therefore, the present invention is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. Use of gene BldD, metK or genC in increasing the yield of gentamicin, wherein, The sequence of gene BldD is shown in SEQ ID NO.1, the sequence of gene metK is shown in SEQ ID NO.2, and the sequence of gene genC is shown in SEQ ID NO.3; By overexpressing the Micromonospora echinospora genes BldD, metK or genC, the yield of gentamicin produced by Micromonospora echinospora fermentation is increased.

2. The use according to claim 1, characterized in that, The gene BldD is a global regulator, and overexpressing the gene BldD increases the yield of gentamicin.

3. The use according to claim 1, characterized in that, By overexpressing the gene metK, it is used to enhance the transmethylation reaction during gentamicin synthesis, increase the synthesis rate of gentamicin, and increase the sugar consumption.

4. The use according to claim 3, characterized in that, By overexpressing the gene metK, the volumetric productivity and specific productivity of gentamicin fermentation by Micromonospora echinospora are increased.

5. The use according to claim 1, characterized in that, By overexpressing the gene genC, the conversion of precursor substances is increased, with the expectation of increasing the total metabolic flux of gentamicin.

6. A method for increasing the yield of biosynthetic gentamicin by Micromonospora echinospora, characterized in that, In Micromonospora echinospora, the genes BldD, metK or genC are overexpressed, wherein the sequence of gene BldD is shown in SEQ ID NO.1, the sequence of gene metK is shown in SEQ ID NO.2, and the sequence of gene genC is shown in SEQ ID NO.

3.

7. The method according to claim 6, characterized in that, A method for increasing the yield of gentamicin biosynthesized by Micromonospora echinospora includes the following steps: Construct plasmids overexpressing genes BldD, metK or genC by one-step cloning, and screen strains overexpressing genes BldD, metK or genC by conjugation transfer; Use the strains overexpressing genes BldD, metK or genC to ferment and produce gentamicin.

Citation Information

Patent Citations

  • Engineering bacteria for generating gentamicin C1a and constructing method of engineering bacteria

    CN102586146A

  • Method for high-yield bacterial strains by high-flux screening of gentamycin based on ARTP composite mutagenesis technique

    CN110499308A