A visual nucleic acid detection kit for Pentatomonas hominis LFD-RPA

Abstract

The present invention discloses a visualization nucleic acid detection kit for human five-trichomonas LFD-RPA, designs a primer and probe combination that can quickly and effectively detect human five-trichomonas according to human five-trichomonas SPO11-1 gene sequence, and combines lateral flow chromatography test strip method by establishing RPA amplification technology, for clinical human five-trichomonas specific, sensitive and rapid detection, for the rapid visualization field detection of human five-trichomonas in samples provides effective technical means, especially suitable for grassroots testing laboratories and epidemic outbreak sites where experimental equipment is relatively backward. The primers and probes of the present invention are highly specific, and the detection limit of human five-trichomonas genomic DNA is 5 copies / ul, simple and quick to operate, without special instruments, the reaction temperature is close to the greenhouse, and the results can be observed with the naked eye, which is conducive to realizing the rapid detection and monitoring of human five-trichomonas in the laboratory and on-site, and has a high application value in fecal pollution prevention and control early warning.

Description

Technical Field

[0001] The invention discloses a visualized nucleic acid detection kit for Pentatomonas humanus LFD-RPA and also provides a detection method for the kit, belonging to the technical field of biological detection. Background Art

[0002] Trichomonas humanis Pentatrichomonas hominis ) is a type of zoonotic parasite distributed worldwide, mainly parasitic in the colon and cecum of humans and vertebrates. Infection with Trichomonas humanus causes trichomoniasis with diarrhea as the main symptom. Infection can also lead to lung infection, rheumatoid arthritis and other diseases, and Trichomonas humanus infection is closely related to gastrointestinal cancer. At present, the methods for diagnosing animals infected with Trichomonas humanus mainly include direct smear microscopy, staining microscopy, PCR detection, etc. However, the detection rate of microscopy is not high. The PCR detection method requires the use of some special experimental equipment and the steps are complicated.

[0003] Recombinase polymerase amplification (RPA) is a rapid diagnostic method developed in recent years and has been widely used in the diagnosis of viruses, bacteria, and parasites. RPA uses recombinase to bind tightly to primers to form a recombinase-primer complex, promote the binding of primers to homologous target sequences of DNA double strands, and DNA polymerase synthesizes new strands. The whole process only needs to react at 37-42°C for 10-30 minutes. Compared with the PCR method, the whole process does not require high-temperature denaturation and low-temperature annealing steps, and the operation is simple and the time is short. Recombinase polymerase amplification lateral flow chromatography technology (LFD-RPA) is a field rapid detection system established by RPA technology combined with lateral flow dipsticks (Lateralflow dipsticks LFD), which is particularly suitable for in vitro diagnosis, veterinary medicine, food safety, biosafety, agriculture and other fields. At present, there is no report on the visual nucleic acid detection method of LFD-RPA for human Trichomonas infection in animals. Summary of the invention

[0004] The invention discloses a visualized nucleic acid detection kit for human Pentosteroloma LFD-RPA, which establishes a nucleic acid detection technology for human Pentosteroloma infection in animals by combining the RPA isothermal amplification technology principle with a lateral flow chromatography test strip, does not rely on large-scale instruments, and realizes rapid and easy-to-operate detection.

[0005] The present invention discloses a visual nucleic acid detection kit for Pentatomonas humanus LFD-RPA, characterized in that:

[0006] 1) The kit includes a reaction tube containing RPA freeze-dried particles, reaction buffer A Buffer, amplification reagent B Buffer, two pairs of primers and probes, ddH2O and lateral flow chromatography test strips; among which:

[0007] The components of the RPA freeze-dried particle reaction tube include: recombinase, DNA polymerase, single-stranded DNA binding protein, dNTP and exonuclease;

[0008] The two pairs of primers and probes are as follows:

[0009] Upstream primer: 5′-ATAGTGGTGGACGAGCCCTGGATTGCCTTG-3′;

[0010] Downstream primer: 5′-Biotin-CTTGTGCCAATCTCATAAAAACGCTCTCCT-3;

[0011] Probe: 5'-[6-FAM]-GACGTGTAGTTCCAATACCAGCTTCACCAGATGG[THF]CA TAAAAGCAGTTAGATGTACA-[C3 Spacer]-3';

[0012] The final concentration in the RPA kit is 2 μM;

[0013] 2) The kit should also include: the positive control DNA template is the genomic DNA of human feces infected with Trichomonas; the negative control is the genomic DNA of human feces not infected with Trichomonas, which is used to compare the RPA products and monitor whether there is contamination in the RPA operation process;

[0014] The 25μL reaction system of the kit is as follows: 12.25μL of A Buffer, 0.6μL of 2μM upstream and downstream primers, 0.25μL of 2μM probe, 7.55μL of ddH2O, 2.5μL of human Trichomonas DNA template to be tested and 1.25μL of B Buffer. 1)

[0015] The detection method of a human Trichomonas LFD-RPA visualization nucleic acid detection kit described in the present invention comprises the following steps:

[0016] 1) Extract the total DNA of the sample to be tested;

[0017] 2) RPA amplification:

[0018] The upstream primer was changed to 5′-ATAGTGGTGGACGAGCCCTGGATTGCCTTG-3′;

[0019] Downstream primer 5'-Biotin-CTTGTGCCAATCTCATAAAAACGCTCTCCT-3,

[0020] Probe 5'-[6-FAM]-GACGTGTAGTTCCAATACCAGCTTCACCAGATGG[THF]CATAAAAGCAGTTAGATGTACA-[C3 Spacer]-3',

[0021] RPA reaction buffer, the total DNA template is mixed in the reaction tube of RPA amplification reagent to prepare an amplification reaction system, the RPA reaction system is 25μL, including: 12.25μL A Buffer, 0.6μL of 2μM upstream and downstream primers, 0.25μL of 2μM probe, 7.55μL ddH2O, 2.5μL of human Trichomonas DNA template to be tested and 1.25μL B Buffer; vortex mixing and instant centrifugation, recombinase polymerase amplification is performed under the conditions of reaction temperature of 35-40℃ and reaction time of 15min;

[0022] 3) LFD detection of RPA amplification products:

[0023] The RPA amplification product was detected by lateral flow chromatography test strips. The amplification product was diluted 8 times to 225 μL. 10 μL of the amplification product was added to the sample pad, and then 10 μL of test strip buffer was added to the sample pad. The reaction was carried out at room temperature for 2 minutes, and the results were observed with the naked eye. If the quality control line and the detection line of the test strip were colored and purple bands appeared, it indicated that the RPA amplification product was positive and the sample contained human Trichomonas DNA. If a band appeared on the quality control line and no band appeared on the detection line, it indicated that the RPA amplification product was negative and there was no human Trichomonas DNA in the sample. If the quality control line did not show color, the experimental result was invalid.

[0024] The present invention combines RPA technology and lateral flow chromatography test strip method to establish a visual rapid sensitive detection method for human Trichomonas nucleic acid. By introducing carboxyfluorescein (FAM) labeled probes and biotin labeled primers, during the RPA reaction, the probe binds to the amplification product. When the probe is endonuclease-cut, it is amplified together with the biotin labeled primer to produce a large number of double-stranded DNA products with FAM labeled at one end and biotin labeled at the other end. When the RPA reaction solution is dripped onto the sample pad, the amplification product labeled with FAM and biotin forms a complex with the nanogold-coupled antibody and the biotin ligand on the detection line to aggregate the nanogold and develop color, and a detection line appears. The quality control line on the test strip is coated with FAM secondary antibody, which can be combined with the free FAM probe and the nanogold particles labeled with the FAM antibody to develop color, and a quality control line appears to indicate the validity of the result.

[0025] The positive effects of the present invention are:

[0026] The invention establishes a nucleic acid detection technology for human Trichomonas infection in animals by combining the RPA isothermal amplification technology principle with lateral flow chromatography test strips, and establishes a rapid and sensitive detection method for human Trichomonas nucleic acid by combining the RPA technology and the lateral flow chromatography test strip method. The invention establishes a nucleic acid detection technology for human Trichomonas infection in animals by combining the RPA isothermal amplification technology principle with lateral flow chromatography test strips, which does not rely on large instruments and realizes rapid and easy-to-operate detection. The specific advantages are as follows:

[0027] 1. Save time: The reaction is fast, and the entire experimental process only takes 15 minutes, which is much shorter than the 2 hours of nested PCR;

[0028] 2. Lower the reaction temperature: The reaction temperature range is wide, and the commonly used temperature is close to room temperature. The experiment can be completed at a constant temperature of 35°C, which is much lower than the 60°C-95°C of nested PCR;

[0029] 3. The method is simple and the kit is easy to carry: The LFD-RPA detection method and kit provided by the present invention are simple to operate, do not require special instruments and equipment, and can be observed with the naked eye. The enzymes and other necessary items required for amplification have been freeze-dried and stored, and can be placed at room temperature. During amplification, only the reaction buffer, primers, probes and templates need to be added, and B Buffer is added to start the reaction. The professional requirements for operators are low, and it is suitable for on-site diagnosis of primary veterinary medicine, and can also be used for scientific research on human Trichomonas;

[0030] 4. Strong specificity: The probe is added to the kit of the present invention to increase the specificity of the detection;

[0031] 5. High sensitivity: The RPA primers and probes for Trichomonas humanis designed by the present invention can detect 5 copies / μL template under the conditions of 35-40°C and 15 minutes of amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 , a diagram showing the color development results of the test strips screened by the LFD-RPA probe in the present invention;

[0033] Figure 2 , a color development result diagram of the test strip with optimized reaction temperature for detecting human Trichomonas feces genomic DNA by LFD-RPA in the present invention;

[0034] Figure 3 , a color development result diagram of the test strip with optimized reaction time for detecting human Trichomonas feces genomic DNA by LFD-RPA in the present invention;

[0035] Figure 4 , a test strip color development result diagram of the specific evaluation of LFD-RPA detection of human Trichomonas feces genomic DNA in the present invention;

[0036] Figure 5 , the test strip color development results of the sensitivity evaluation of LFD-RPA detection of human Trichomonas feces genomic DNA in the present invention;

[0037] Figure 6 , LFD-RPA detection of Trichomonas humanis in 68 dog fecal samples;

[0038] Figure 7 , an example of LFD-RPA detecting Pentatomonas hominis in 18 rat feces samples. DETAILED DESCRIPTION

[0039] The following examples are intended to further illustrate, rather than limit the present invention. It will be appreciated by those skilled in the art that any parallel changes and modifications to the present invention will fall within the scope of the pending claims of the present invention without departing from the spirit and principles of the present invention.

[0040] Example 1

[0041] 1. Design and preparation of primers and probe sequences;

[0042] Primers were designed for the human Pentatomonas SPO11-1 gene (GenBank: JF298016), and probe screening was performed. The screening results are as follows Figure 1 As shown; determine the primers and probes as shown in Table 1:

[0043] Table 1. Human Pentatomonas RPA Primer and Probe Sequences: 549-691

[0044]

[0045] 2. Establishment and optimization of LFD-RPA method for detecting human Trichomonas feces genomic DNA:

[0046] 1) Extraction of human Pentatomonas feces genome;

[0047] The human Trichomonas strain used in the present invention was preserved in this laboratory. The DNA of human Trichomonas was extracted using a stool genome extraction kit of TIANGEN Company, and finally eluted with 50 μL of deionized water. The extracted DNA was stored at -20°C for future use.

[0048] 2) Optimization of the reaction system and conditions of LFD-RPA;

[0049] Refer to the test strip type RPA-nfo nucleic acid amplification reagent (Zhongce) to prepare a 25μL LFD-RPA reaction system; in the 25μL reaction system of the amplification reaction, add 12.25μL of A Buffer, 0.6μL of 2μM upstream primer (F: ATAGTGGTGGACGAGCCCTGGATTGCCTTG), 0.6μL of 2μM downstream primer (R: Biotin-CTTGTGCCAATCTCATAAAAACGCTCTCCT), 0.25μL of 2μM probe, 7.55μL of ddH2O, 2.5μL of human Pentatrichomonas fecal genomic DNA template and 1.25μL of B Buffer in the reaction tube containing RPA freeze-dried particles; after thorough mixing, react in a water bath, and use the fecal genome of uninfected human Pentatrichomonas as a negative control. The reaction temperature was set to 6 gradients: 25, 30, 35, 40, 45 and 50°C, and the reaction time was set to 30 min to determine the optimal reaction temperature; the reaction amplification time was set to 7 gradients: 0, 2, 5, 10, 15, 20 and 25 min, and the reaction temperature was set to 39°C. Other conditions were the same to determine the optimal RPA reaction time.

[0050] The RPA amplification product was detected using a lateral flow chromatography test strip (public test). The amplification product was diluted 8 times to 225 μl, 10 μl was added to the sample pad of the test strip, and then 10 μL of the test strip buffer was added to the sample pad, reacted at room temperature for 2 minutes, and the results were observed with the naked eye.

[0051] When red strips appear on both the test line and the quality control line of the test strip, it indicates that the RPA amplification product is positive. If only the quality control line is colored, it indicates that there is no target amplification product of RPA; if the quality control line is not colored, it indicates that the experimental results are invalid. Figure 2 As shown: reaction bands can appear at 30℃ and become obvious at 35℃; the reaction time optimization results are as follows Figure 3 As shown: The bands become obvious after 10 minutes of reaction.

[0052] Example 2

[0053] Specificity of LFD-RPA in detecting human fecal genomic DNA of Trichomonas

[0054] According to the above system, reactants were added for RPA detection. In this experiment, Pentatomonas aureus, Trichomonas muris, Giardia lamblia, Escherichia coli, Isospora canis, Toxocara canis, Cryptosporidium parvum, Cryptosporidium tyzeri, and Tritrichomonas fetus were selected to determine whether the LFD-RPA detection method established in this experiment is specific. The amplification reaction was carried out in a 39°C water bath for 15 minutes; the results are shown in Figure 4As shown, only the human Pentatrichomonas genome could be amplified well, and the others did not produce amplified bands, indicating that this method has a strong specificity for detecting human Pentatrichomonas.

[0055] Example 3

[0056] Sensitivity test of LFD-RPA method for detecting human Pentatomonas fecal genomic DNA;

[0057] Human Trichomonas solani was divided into 6 Copy number / μL, 10 5 Copy number / μL-10 1 copies / μL, 5 copies / μL, 10 0 The number of copies / μL was diluted in a gradient and used as a template for the RPA reaction. The amplification reaction was performed in a water bath at 39°C for 15 minutes. The results were as follows Figure 5 As shown in the figure, as the template concentration increases, the color of the detection line gradually increases. When the concentration is 5 copies / μL, an amplification curve appears. When the concentration is 10 1 There is an obvious amplification curve when the copy number is greater than 5 / μL, indicating that samples with a copy number greater than 5 / μL can be detected.

[0058] Example 4

[0059] Testing of clinical samples;

[0060] Currently, nested PCR is recognized as a relatively sensitive and accurate method for detecting human Trichomonas. The results of nested PCR were used as a control to illustrate the accuracy of LFD-RPA for detection. 68 samples of dog feces were tested simultaneously using LFD-RPA and nested PCR. The results are as follows: Figure 6 ; 18 samples of rat feces were tested, and the results were as follows Figure 7 As shown; the sample results showed that 4 dog feces samples and 2 rat feces samples were positive in the LFD-RPA and nested PCR tests, and the results of the two methods were consistent. The results are shown in Table 2:

[0061] Table 2. Comparison of the results of LFD-RPA and nested PCR in detecting dog and rat feces samples

[0062]

[0063] Conclusion: The present invention selects specific conservative regions based on the reference to the human Pentatrichomonas SPO11-1 gene sequence in GenBank, designs a large number of RPA primers and probes, and screens out a set of primers and probe combinations that can quickly and effectively detect human Pentatrichomonas, and establishes RPA amplification technology combined with lateral flow chromatography test strips for specific, sensitive and rapid detection of human Pentatrichomonas in clinical practice, which provides effective technical means for rapid visualization of human Pentatrichomonas in samples, and is particularly suitable for grassroots testing laboratories and outbreak sites with relatively backward experimental equipment. The primers and probes of the present invention have strong specificity, a detection limit of 5 copies / ul for human Pentatrichomonas genomic DNA, simple and fast operation, no special instruments are required, the reaction temperature is close to the greenhouse, and bands can appear at about 35°C for 15min, and the results can be observed with the naked eye, which is conducive to the rapid detection and monitoring of human Pentatrichomonas in laboratories and on-site, and has a high application value in fecal pollution prevention and control early warning.

Claims

1. A primer and a probe related to the human Trichomonas SPO11-1 gene are used in the preparation of a visual nucleic acid detection kit for detecting human Trichomonas infection, characterized in that: 1) Extract human Pentatomonas genomic DNA, and amplify the human Pentatomonas SPO11-1 gene using the following primers, with the 5' end of the downstream primer modified by biotin; Upstream primer: 5′-ATAGTGGTGGACGAGCCCTGGATTGCCTTG-3′; Downstream primer: 5′-Biotin-CTTGTGCCAATCTCATAAAAACGCTCTCCT-3; 2) The 5' end of the probe sequence is modified with carboxyfluorescein FAM, the relevant G base is replaced by a [THF] residue, and the 3' end is modified with C3-Spacer; Probe: 5'-[6-FAM]-GACGTGTAGTTCCAATACCAGCTTCACCAGATGG[THF]CA TAAAAGCAGTTAGATGTACA-[C3 Spacer]-3'.

2. A visual nucleic acid detection kit for human Trichomonas humanis LFD-RPA, characterized in that: 1) The kit comprises a reaction tube containing RPA freeze-dried particles, a reaction buffer A Buffer, an amplification reagent B Buffer, the primers and probes according to claim 1, ddH2O and a lateral flow chromatography test strip; wherein: The components of the RPA freeze-dried particle reaction tube include: recombinase, DNA polymerase, single-stranded DNA binding protein, dNTP and exonuclease; The final concentration of the upstream primer, downstream primer and probe described in claim 1 in the RPA kit is 2 μM; The kit should also include: the positive control DNA template is the genomic DNA of human feces infected with Trichomonas; the negative control is the genomic DNA of human feces not infected with Trichomonas, which is used to compare the RPA products and monitor whether the RPA operation process is contaminated; The 25 μL reaction system of the kit is as follows: 12.25 μL A Buffer, 0.6 μL each of 2 μM upstream and downstream primers, 0.25 μL of 2 μM probe, ddH2 O7.55μL, human Trichomonas DNA template to be tested 2.5μL and 1.25μL B Buffer.

Images