Molecular markers, primers and application thereof for identifying vitamin c content of kiwifruit

By using molecular marker-assisted breeding technology, and utilizing molecular markers in the kiwifruit genetic map that are closely linked to vitamin C content, the problem of difficulty in quickly screening plants with high vitamin C content in traditional breeding methods has been solved. This has enabled early, efficient, and accurate breeding screening, reduced costs, and accelerated the breeding process.

CN115838826BActive Publication Date: 2026-02-03ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211421322.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-14
Publication Date
2026-02-03
Estimated Expiration
2042-11-14

AI Technical Summary

Technical Problem

Traditional breeding methods and conventional hybridization breeding methods make it difficult to quickly and accurately screen for plants with high vitamin C content before kiwifruit fruiting, resulting in long breeding cycles, low efficiency, high costs, and great difficulty in phenotypic selection.

Method used

Molecular marker-assisted breeding technology was employed, combining directed hybridization breeding with molecular marker-assisted breeding. By utilizing molecular markers closely linked to vitamin C content in the kiwifruit genetic map, varieties with specific superior traits were screened out, a genetic linkage map was constructed and QTL mapping was performed, the linkage relationship between markers and phenotypes was established, and molecular marker loci were detected using PCR technology and Sanger sequencing.

Benefits of technology

This method enables rapid and accurate screening of kiwifruit plants with high vitamin C content during their juvenile stage, improving the efficiency and accuracy of selection breeding, reducing breeding costs, and is unaffected by the environment, thus significantly accelerating the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115838826B_ABST
    Figure CN115838826B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker for identifying vitamin C content of kiwi fruit, a primer and application of the molecular marker. The molecular marker is closely linked with a QTL site of vitamin C content of the kiwi fruit, is located at 5287161 of a V3 genome chromosome group24 of the kiwi fruit, and can significantly distinguish the relative high and low of the vitamin C content of the kiwi fruit. The molecular marker detection method is convenient, fast, good in specificity, high in accuracy, not influenced by climate and environment, and can quickly screen out single plants with relatively high vitamin C content at a kiwi seedling stage, significantly accelerates a breeding process, provides powerful technical support for variety breeding of the kiwi fruit with high vitamin C content, and has great economic value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of artificial cultivation of kiwifruit and molecular marker technology, and particularly relates to a molecular marker for identifying the content of vitamin C in kiwifruit, a primer and an application and kit thereof, the molecular marker and the primer can be used for identifying the content of vitamin C in kiwifruit and cultivating a variety. BACKGROUND

[0002] Kiwifruit (Actinidia) is a perennial dioecious vine plant of the genus Actinidia Lindl. in the Actinidiaceae family, and there are 54 species and 21 varieties. Kiwifruit contains rich nutrients such as protein and sugar, and minerals such as calcium, phosphorus and iron. In addition, it is most notable for its high content of vitamin C, which ranks first in fruits, several times or even dozens of times higher than that of citrus and apple, and is therefore known as the "King of Vitamin C". Similarly, as the most representative trait of kiwifruit fruit quality, kiwifruit varieties with high vitamin C content have always been the focus of breeders.

[0003] As we all know, varieties are the "chips" of the development of fruit and vegetable industry, and excellent varieties will not only be favored by consumers, but also have higher economic value for cultivators and sellers. Since increasing the content of vitamin C is crucial to improving the quality of kiwifruit fruit, for a long time, breeding kiwifruit varieties with high vitamin C content has become one of the important goals of kiwifruit variety breeding.

[0004] Traditional breeding methods have the defects of long work cycle, low efficiency, and inability to quickly screen target trait lines, and have been gradually replaced by hybrid breeding. Hybrid breeding helps to achieve the breeding goal of excellent multi-gene aggregation. However, in the process of hybrid breeding, how to select excellent recombinant genotypes from hybridized offspring is the key to success or failure. The previous breeding method relying on phenotypic selection is time-consuming and laborious and difficult, and it takes 10-15 years to cultivate a new variety. Moreover, most of the phenotypic traits are quantitative traits that are easily affected by the environment and are unstable, thereby reducing the accuracy of phenotypic selection.

[0005] In summary, due to the inherent limitations of traditional breeding methods and conventional hybrid breeding methods, it is difficult to quickly and accurately screen kiwifruit plants with high vitamin C content before fruiting, thereby causing difficulties in breeding kiwifruit varieties with high vitamin C content. SUMMARY

[0006] To address the challenge of using traditional breeding methods and conventional hybridization breeding techniques to quickly and accurately screen for kiwifruit plants with high vitamin C content before fruiting, this invention provides a novel and effective molecular marker and related primers for identifying vitamin C content in kiwifruit, along with a molecular marker detection kit for identifying vitamin C content in kiwifruit.

[0007] Molecular marker-assisted breeding (MAS) is a novel breeding method that emerged with the development of PCR and modern sequencing technologies. This method selects desired traits based on genotype rather than phenotype. In our breeding work, we combine directed hybridization breeding with MAS, performing association analysis between molecular markers and traits to rapidly screen varieties with specific superior traits. The key to implementing MAS lies in identifying and determining molecular markers linked to specific phenotypes. Based on this, we construct genetic linkage maps and locate quantitative trait loci (QTLs), thereby establishing the linkage relationship between markers and phenotypes.

[0008] In this invention, the inventors used molecular marker technology as a basis to perform linkage analysis between molecular markers at known loci in the kiwifruit genetic map and vitamin C content, thereby locating one or more QTLs near molecular markers at known loci on the same chromosome, thus determining the location of the QTL in the genome.

[0009] Specifically, based on extensive previous genetic breeding research on kiwifruit, the inventors further conducted QTL research on vitamin C content in kiwifruit and accurately located the QTL intervals controlling vitamin C content in kiwifruit. Then, combined with the obtained QTL location interval information, molecular markers (SNP sites) were screened to identify molecular markers closely linked to the vitamin C content trait in kiwifruit. These molecular markers can be used to predict the vitamin C content of kiwifruit fruits. Using these molecular markers, plants with high vitamin C content can be quickly and accurately screened during the juvenile stage of kiwifruit, greatly improving the efficiency and accuracy of selection breeding.

[0010] In a first aspect, the present invention provides a molecular marker for identifying the vitamin C content of kiwifruit. The molecular marker is closely linked to the QTL site for vitamin C content in kiwifruit fruit. The molecular marker is located at position 5287161 on chromosome group 24 of the kiwifruit V3 genome, and its sequence is shown in SEQ ID NO:1 or SEQ ID NO:2. The molecular marker can be used to identify the relative level of vitamin C content in kiwifruit fruit.

[0011] Furthermore, the upstream primer sequence of the above molecular marker is VC-1F: 5'-ATGGTAATCGGGTTTGTTCTC-3' (SEQ ID NO:3), and the downstream primer sequence is VC-1R: 5'-ACGGGTAGGTCATAAGATAGCA-3' (SEQ ID NO:4).

[0012] In addition, the present invention also relates to the application of the above-mentioned molecular marker detection reagents in the breeding of kiwifruit varieties with high vitamin C content.

[0013] Secondly, the present invention provides a molecular marker detection kit for identifying the vitamin C content of kiwifruit, the kit containing the aforementioned molecular marker detection reagent.

[0014] Furthermore, the above-mentioned test kit contains the following primer pairs:

[0015] Upstream primer VC-1F: 5'-ATGGTAATCGGGTTTGTTCTC-3',

[0016] Downstream primer VC-1R: 5'-ACGGGTAGGTCATAAGATAGCA-3'.

[0017] Thirdly, the present invention provides a molecular marker detection method for identifying the vitamin C content of kiwifruit, comprising the following steps:

[0018] (1) DNA extraction

[0019] Fresh kiwifruit leaves were flash-frozen in liquid nitrogen and then genomic DNA was extracted using the SDS method.

[0020] (2) PCR amplification

[0021] a. The reaction system includes:

[0022] 100 ng / μl of kiwifruit leaf genomic DNA, 3 μl,

[0023] Upstream primer VC-1F: 5'-ATGGTAATCGGGTTTGTTCTC-3', 2 μl,

[0024] Downstream primer VC-1R: 5'-ACGGGTAGGTCATAAGATAGCA-3', 2 μl,

[0025] PCR mix 25μl,

[0026] Add ddH2O to a final volume of 50 μl;

[0027] b. The reaction procedure is as follows:

[0028] Pre-denaturation at 98℃ for 3 minutes,

[0029] The process involved 35 cycles: denaturation at 98°C for 10 seconds, annealing at 54°C for 20 seconds, and extension at 72°C for 30 seconds.

[0030] Final extension at 72℃ for 5 minutes;

[0031] After the PCR amplification program is completed, store it at 4°C.

[0032] (3) Electrophoretic pattern analysis

[0033] The gel electrophoresis was run at 120V and 120A for 15 minutes. The amplified target band was cut off on a gel imaging instrument and recovered from the gel. Then, Sanger sequencing was used to detect the molecular marker sites. The relative vitamin C content of the kiwi fruit samples was identified based on the base type at the molecular marker sites.

[0034] Furthermore, in the method described above for identifying the vitamin C content of kiwifruit, the molecular marker at position 5287161 of chromosome group24 of the kiwifruit sample is divided into two genotypes. Individuals with genotype G / G have relatively higher vitamin C content, while individuals with genotype G / A have relatively lower vitamin C content.

[0035] In addition, the present invention also provides a molecular marker detection method for identifying the vitamin C content of kiwifruit, which includes the step of detecting the aforementioned molecular marker.

[0036] In summary, the core of this invention lies in disclosing the application of the 5287161st base of chromosome group 24 of the kiwifruit V3 genome, or primers designed based on the 5287161st base of chromosome group 24 of the kiwifruit, or molecular markers containing this base (sequences shown in SEQ ID NO.1 or SEQ ID NO.2) in the screening and breeding of vitamin C content in kiwifruit.

[0037] The aforementioned molecular markers can be used for detection using existing technologies such as PCR and Sanger sequencing. For the 5287161st base of chromosome group24 in the kiwifruit V3 genome, individuals with relatively high vitamin C content have the genotype G / G at this locus, while individuals with relatively low vitamin C content have the genotype G / A at this locus. This allows for early screening of kiwifruit based on vitamin C content for breeding purposes.

[0038] In summary, this invention has for the first time located QTL loci associated with vitamin C content in kiwifruit, and screened molecular markers based on the located QTL intervals that can significantly distinguish the relative levels of vitamin C content in kiwifruit. Using the molecular markers and methods of this invention, the relative levels of vitamin C content in kiwifruit plants can be accurately determined during the juvenile stage through conventional molecular experiments. Individual plants with relatively high vitamin C content can be quickly screened during the seedling stage. In contrast, in traditional breeding methods, the vitamin C content of kiwifruit cannot be determined before the results are obtained. Due to the long breeding cycle and low screening efficiency, the breeding cost of kiwifruit is high. However, by using the method of this invention to detect molecular markers linked to vitamin C content loci, detection can be performed in various tissues, organs, and developmental stages of the plant, which not only saves production costs but also greatly improves selection efficiency. Furthermore, the QTL sites for vitamin C content in kiwifruit in this invention are clearly located, and the detection method for molecular marker sites is convenient, fast, specific, and accurate, and is not affected by climate or environment. By detecting molecular markers related to vitamin C content in kiwifruit, the vitamin C content of kiwifruit can be predicted, thereby accurately and quickly screening out superior single plants with high vitamin C content, significantly accelerating the breeding process, providing strong technical support for the breeding of kiwifruit varieties with high vitamin C content, and having significant economic value. Attached Figure Description

[0039] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0040] Figure 1 A graph showing the results of a comparative analysis of the average vitamin C content of individuals with different genotypes. Detailed Implementation

[0041] To make the objectives and technical solutions of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. Those skilled in the art can easily understand other advantages of this invention from the content disclosed in this specification. This invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of this invention.

[0042] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0043] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by those skilled in the art. In this invention, unless otherwise specified, all instruments, reagents, and raw materials are commercially available or commonly used in the art. The methods in the following embodiments, unless otherwise specified, are conventional methods in the art.

[0044] Example 1: Obtaining molecular markers tightly linked to QTL sites related to vitamin C content in kiwifruit

[0045] (1) In this embodiment, male plants of diploid Chinese kiwifruit 'Hongyang' and 'Boshan Biyu' were used to construct F1 hybrid populations, and 173 F1 progeny plants were selected as research objects.

[0046] (2) Fresh tender leaves of 173 offspring plants and hybrid parents from the hybrid population were taken, and genomic DNA was extracted by SDS method after being quick-frozen in liquid nitrogen, and the DNA quality was tested.

[0047] (3) The qualified genomic DNA was randomly fragmented with enzymes, then the ends were repaired, A-tails were added, and Illumina sequencing adapters were added. The DNA fragments were amplified and enriched by PCR and the products were purified. Sequencing libraries of diploid Chinese kiwifruit 'Hongyang' and 'Boshan Biyu' male plants and 173 progeny single plants were constructed. The sequencing libraries were tested and quantified by real-time PCR. Finally, sequencing was performed on a Novaseq 6000 sequencer using the PE 150 sequencing strategy.

[0048] (4) The raw data from the Illumina platform was filtered using FASTP (version 0.18.0) with the following filtering criteria: ① Reads containing ≥10% unknown nucleotides (N) were removed; ② Reads containing ≥50% of bases with a Phred quality score ≤20 were removed; ③ Reads containing sequencing adapters were deleted. The filtered reads were aligned to the reference genome using the MEM algorithm with the alignment parameter -k32-M using the alignment software BWA (version 0.7.12). After alignment, the results were labeled using the software picard (version 1.129). The reads of each sample in the population were aligned using the alignment software Tophat, and population SNPs were detected using the variant detection software GATK.

[0049] (5) Based on the SNP information obtained from the above analysis, the treebest software and the neighbor-joining method were used to construct the phylogenetic tree, the plink and GCAT64 software were used to perform principal component analysis, and the admixture software was used to analyze the population structure to complete the population analysis of the constructed population.

[0050] (6) After preliminary quality filtering and variant detection, a VCF file containing variant information was obtained. Further filtering was performed according to the following criteria: ① Using bcftools software, all SNP markers with QUAL>20 and DP>5 were retained; ② Using Plink software, markers with a genotype deletion rate greater than 0.02, samples with a sample deletion rate greater than 0.03, and markers with a minor allele frequency less than 0.05 were removed; ③ Using R program, markers with parental genotypes of “0 / 0×0 / 1”, “0 / 1×0 / 0”, “0 / 1×0 / 1”, “0 / 1×1 / 1”, and “1 / 1×0 / 1” were retained, and markers that did not produce segregation in the offspring were removed; ④ A chi-square test was performed to remove markers with severe segregation bias.

[0051] (7) Using the ParentCall2 module of the Lep-MAP3 software, the VCF file containing the filtered markers was converted into a Pedigree+genotype likelihoods data type. The SeparateChromosomes2 module was used to divide the markers into linkage groups, with the following main parameters: lodLimit=17, lod3Mode=3, sizeLimit=300, informativeMask=123, theta=0.01. After grouping, the OrderMarkers2 module was used for plotting, with the following main parameters: minError=0.001, identicalLimit=0.01, informativeMask=123, useKosambi=1, selfingPhase=0, and other parameters using default values. Each linkage group was repeated 5 times, and the result with the highest likelihood value was selected as the final result. Genetic positions between markers and LOD value matrices from markers to each genetic position were obtained, constructing a high-density genetic linkage map of the diploid Chinese kiwifruit hybrid population.

[0052] (8) During the fruit ripening period, the vitamin C content of the fruits of the mother plant and the fruiting progeny were measured and evaluated. Twenty fruits were randomly collected from each sample, and the vitamin C content in the fruits was determined using an enzyme-linked immunosorbent assay kit. The phenotypic traits were statistically analyzed.

[0053] (9) QTL localization was performed using R / qtl, using the scanone() function for interval mapping and the cim() function for composite interval mapping. The scan step size was 1 cm, and the LOD threshold was set to 3. Finally, multiple QTL sites related to the vitamin C content of the fruit were detected.

[0054] (10) Sequences of approximately 200 bp upstream and downstream of chromosome group 24 (5287161) of the kiwifruit V3 genome were extracted to develop SNP polymorphic molecular markers. Forward primer (upstream primer) VC-1F: ATGGTAATCGGGTTTGTTCTC, reverse primer (downstream primer) VC-1R: ACGGGTAGGTCATAAGATAGCA, PCR amplification fragment size was 277 bp.

[0055] (11) Conclusion:

[0056] The sequence amplified in the sample with a relatively high vitamin C content is shown in SEQ ID NO.1.

[0057] The sequence amplified in the sample with relatively low vitamin C content is shown in SEQ ID NO.2.

[0058] The molecular marker at locus 5287161 on chromosome group 24 of the V3 genome was divided into two genotypes in the hybrid offspring. In individuals with higher vitamin C content, the genotype was G / G, with an average vitamin C content of 352.176 μg / L. In individuals with lower vitamin C content, the genotype was G / A, with an average vitamin C content of 320.803 μg / L.

[0059] A significance test was performed on the vitamin C content of the hybrid offspring. The results showed that the difference in mean vitamin C content between the two genotypes was 31.373 μg / L, which was extremely significant (P<0.005). See the results below. Figure 1 .

[0060] Example 2: Application of a molecular marker tightly linked to a QTL site for vitamin C content in kiwifruit in kiwifruit breeding

[0061] Materials: The diploid Chinese kiwifruit variety 'Hongyang', known for its superior fruit flavor, was used as the female parent, and 'Boshan Biyu' as the male parent to obtain the F1 generation. Individual plants from this F1 generation were selected as test subjects. At fruit maturity, the vitamin C content of the fruits from each individual plant was measured and evaluated. Twenty fruits were randomly collected from each sample, and the vitamin C content was determined using an enzyme-linked immunosorbent assay (ELISA) kit. Phenotypic traits were then statistically analyzed.

[0062] (1) DNA extraction

[0063] Fresh tender leaves were taken from individual fruiting plants of the kiwifruit hybrid population, and genomic DNA was extracted using the SDS method after being flash-frozen in liquid nitrogen.

[0064] (2) PCR amplification

[0065] a. According to 2×Hieff The Plus PCR Master Mix (With Dye) kit instructions specify a 50 μl reaction mixture, which includes:

[0066] Genomic DNA from individual leaves of a 100 ng / μl kiwifruit hybrid population, 3 μl.

[0067] Upstream primer VC-1F: 5'-ATGGTAATCGGGTTTGTTCTC-3', 2 μl,

[0068] Downstream primer VC-1R: 5'-ACGGGTAGGTCATAAGATAGCA-3', 2 μl,

[0069] 2×Hieff Plus PCR Master Mix (With Dye), 25μl,

[0070] Add ddH2O to a final volume of 50 μl.

[0071] b. The reaction procedure is as follows:

[0072] PCR amplification reaction procedure

[0073]

[0074] After the PCR amplification program is completed, store it at 4°C.

[0075] (3) Electrophoretic pattern analysis

[0076] The gel electrophoresis apparatus was used to run the gel for 15 minutes at 120V and 120A. The amplified target band was then cut off and recovered from the gel using a gel imaging system. Sanger sequencing was then used to detect molecular marker sites. The relative vitamin C content of the kiwifruit samples was determined based on the base type at the molecular markers (the molecular marker at 5287161 on chromosome group 24 of the kiwifruit samples was divided into two genotypes, with individuals of genotype G / G having relatively higher vitamin C content and individuals of genotype G / A having relatively lower vitamin C content), thereby achieving the goal of efficient breeding.

[0077] The preferred embodiments and examples of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments and examples. Within the scope of knowledge possessed by those skilled in the art, various modifications can be made without departing from the concept of the present invention.

Claims

1. The application of a primer for identifying the vitamin C content of kiwifruit in the breeding of kiwifruit varieties with high vitamin C content, characterized in that: The molecular marker is closely linked to the QTL site for vitamin C content in kiwifruit. The molecular marker is located at 5287161 on chromosome group 24 of the kiwifruit V3 genome, and its amplified sequence is shown in SEQ ID NO:1 or SEQ ID NO:

2. The molecular marker can be used to identify the relative level of vitamin C content in Chinese kiwifruit. The upstream primer sequence of the molecular marker is VC-1F: 5'-ATGGTAATCGGGTTTGTTCTC-3', and the downstream primer sequence is VC-1R: 5'-ACGGGTAGGTCATAAGATAGCA-3'; The molecular markers are divided into two genotypes: individuals with the G / G genotype have relatively high vitamin C content, while individuals with the G / A genotype have relatively low vitamin C content. The kiwifruit mentioned is an F1 generation hybrid population constructed using Chinese kiwifruit 'Hongyang', Chinese kiwifruit 'Boshan Biyu', and diploid Chinese kiwifruit 'Hongyang' as the female parent and 'Boshan Biyu' as the male parent.

2. A method for identifying the vitamin C content of kiwifruit, characterized in that: The kiwifruit mentioned is an F1 generation hybrid population constructed using Chinese kiwifruit 'Hongyang', Chinese kiwifruit 'Boshan Biyu', and diploid Chinese kiwifruit 'Hongyang' as the female parent and 'Boshan Biyu' as the male parent; The method includes the following steps: (1) DNA extraction Fresh kiwifruit leaves were flash-frozen in liquid nitrogen and then genomic DNA was extracted using the SDS method. (2) PCR amplification a. The reaction system includes: 100 ng / μl of kiwifruit leaf genomic DNA, 3 μl, Upstream primer VC-1F: 5'-ATGGTAATCGGGTTTGTTCTC-3', 2 μl, Downstream primer VC-1R: 5'-ACGGGTAGGTCATAAGATAGCA-3', 2 μl, PCR mix 25μl, Add ddH2O to a final volume of 50 μl; b. The reaction procedure is as follows: Pre-denaturation at 98℃ for 3 minutes. The temperature was changed by denaturation at 98℃ for 10 seconds, annealing at 54℃ for 20 seconds, and extension at 72℃ for 30 seconds, for a total of 35 cycles. Final extension at 72℃ for 5 minutes; After the PCR amplification program is completed, store it at 4°C. (3) Electrophoretic pattern analysis The gel electrophoresis was run at 120V and 120A for 15 minutes. The amplified target band was cut off on the gel imaging instrument and recovered from the gel. Then, Sanger sequencing was used to detect the molecular marker sites. The relative vitamin C content of the kiwi fruit samples was identified based on the base type at the molecular marker sites. The molecular marker is closely linked to the QTL site for vitamin C content in kiwifruit. The molecular marker is located at 5287161 on chromosome group 24 of the kiwifruit V3 genome, and its amplified sequence is shown in SEQ ID NO:1 or SEQ ID NO:

2. The molecular marker can be used to identify the relative levels of vitamin C content in Chinese kiwifruit. The molecular marker is divided into two genotypes, where individuals with genotype G / G have relatively higher vitamin C content, and individuals with genotype G / A have relatively lower vitamin C content.