A method and device for generating 2-quinoline carboxylic acid by using a chemo-enzymatic cascade reaction in a microfluidic field

Abstract

The present invention discloses a method for generating 2-quinolinecarboxylic acid by using a chemo-enzymatic cascade reaction in a microfluidic field, which comprises the following steps: S1: Catalyze the aldol condensation reaction of o-nitrobenzaldehyde and sodium pyruvate by using pyruvate-dependent aldolase (NahE) to obtain 4-(2-nitrophenyl)-2-oxobut-3-enoic acid; S2: Reduce the nitro group of the 4-(2-nitrophenyl)-2-oxobut-3-enoic acid intermediate to an amino group by using iron powder, and then spontaneously generate 2-quinolinecarboxylic acid. The present invention uses a microfluidic field to combine chemical and enzymatic catalysis to obtain a quinoline ring drug intermediate from o-nitrobenzaldehyde, and has the advantages of mild reaction conditions, system compatibility, strong sustainability, high product yield, etc.

Description

Technical Field

[0001] The present invention belongs to the technical field of chemical synthesis, and particularly relates to a method and device for generating 2-quinoline carboxylic acid by using a chemo-enzymatic cascade reaction in a microfluidic field. Technical Background

[0002] Quinoline ring systems are widely present in natural products and drugs, most famously quinine and related drugs. As very important drug precursors, they have great application potential in the field of pharmaceutical synthesis. The most representative method for synthesizing quinoline rings is the Skraup synthesis: heating aniline, glycerol, sulfuric acid, and an oxidant (such as nitrobenzene) together, followed by cyclization and dehydrogenation to form quinoline. The Friedlander reaction generally uses o-aminobenzaldehyde as a raw material. At high temperatures, o-aminobenzaldehyde is unstable and prone to spontaneous condensation, resulting in low yields. Subsequently, the developed Pfitzinger reaction overcomes the problem of unstable raw materials but still requires a relatively high temperature (100 °C).

[0003] Currently, the classical methods for synthesizing quinoline rings rely heavily on toxic reagents, expensive catalysts, high pressure, or long reaction times, and the yields are not ideal. These harsh conditions pose challenges to the synthesis of quinoline ring drugs. The synthesis of quinoline ring drugs under mild and green conditions has attracted increasing attention from scientists.

[0004] David R, J. Palmer et al. from the University of Saskatchewan in Canada reported a chemo-enzymatic synthesis method for quinoline ring systems using aldolase. In this methodology, o-aminobenzaldehyde was first prepared by metal-catalyzed reduction of o-nitrobenzaldehyde. The reaction solution was purified to obtain o-aminobenzaldehyde, and then aldolase was used as a catalyst to perform a reduction reaction between pyruvate and o-aminobenzaldehyde with a series of substituents to synthesize the corresponding quinolinic acid in good yields (ACS Catal. 2021, 11, 6939-6943). However, in the method reported in the above literature, the intermediate o-aminobenzaldehyde is unstable and prone to form trimers. In addition, the high-temperature reaction conditions required for reducing nitro groups are incompatible with the reaction environment of aldolase, making it necessary to first perform post-treatment purification of the substrate and then carry out the next reaction in the chemo-enzymatic cascade reaction, which is time-consuming and laborious. Summary of the Invention

[0005] Object of the Invention: Aiming at the deficiencies of the prior art, the present invention provides a method for generating 2-quinoline carboxylic acid by using a chemo-enzymatic cascade reaction in a microfluidic field.

[0006] To solve the above technical problems, the present invention provides a method for generating 2-quinolinecarboxylic acid by using a chemo-enzymatic cascade reaction in a microfluidic field. Using o-nitrobenzaldehyde and sodium pyruvate as raw materials, immobilized aldolase is used as a biocatalyst for catalysis, and then the product is reduced with iron powder to obtain a quinoline ring. It mainly consists of two reaction steps: First, use the natural reaction catalyzed by aldolase - the aldol condensation reaction to obtain 4-(2-nitrophenyl)-2-oxobut-3-enoic acid; under acidic pH conditions, then use iron powder to reduce the nitro group in 4-(2-nitrophenyl)-2-oxobut-3-enoic acid to an amino group; finally, cyclize spontaneously to form a quinoline ring to obtain 2-quinolinecarboxylic acid.

[0007] Specifically, the reaction includes the following steps:

[0008] Dissolve o-nitrobenzaldehyde in an organic solvent to obtain solution A, dissolve sodium pyruvate in a phosphate buffer solution to obtain solution B, and pump solution A and solution B into a first microchannel reactor fixed with pyruvate-dependent aldolase NahE at the same time. In the first microchannel reactor, catalyze o-nitrobenzaldehyde into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid;

[0009] S2: Fix iron powder into a second microchannel reactor. After mixing the reaction solution obtained in step S1 with a hydrochloric acid solution to adjust the pH to 2-4, inject it into the second microchannel reactor, thereby reducing 4-(2-nitrophenyl)-2-oxobut-3-enoic acid to obtain 2-quinolinecarboxylic acid.

[0010] In step S1, the pyruvate-dependent aldolase NahE is a trans-o-hydroxybenzylpyruvate hydratase-aldolase derived from Pseudomonas putida, and its amino acid sequence is shown in SEQ ID NO.2: MTTLERPQPKLSMADKAARIDAICEKARILPVITIAREEDILPLADALAAGGIRTLEVTLRSQHGLKAIQVLREQRPELCVGAGTVLDRSMFAAVEAAGAQFVVTPGITQDILEAGVDSEIPLLPGISTPSEIMMGYALGYRRFKLFPAEISGGVAAIKAFGGPFGDIRFCPTGGVNPANVRNYMALPNVMCVGGTWMLDSSWIKNGDWARIEACSAEAIALLDAN*.

[0011] In step S1, the molar ratio of solution A to solution B is 1:1-3.

[0012] In one embodiment, the pyruvate-dependent aldolase NahE is prepared by the following method: constructing the gene of the pyruvate-dependent aldolase NahE with the nucleotide sequence shown in SEQ ID NO.1 onto the pET-28a(+) vector, transferring it into Escherichia coli BL 21(DE 3), culturing and purifying to obtain the corresponding pyruvate-dependent aldolase NahE, wherein the SEQ ID NO.1 sequence is:

[0013] ATGACCACCCTCGAACGCCCACAGCCAAAGCTCTCGATGGCCGACAAGGCCGCCCGGATCGATGCCATCTGCGAAAAGGCGCGCATCCTGCCGGTCATTACCATCGCCCGTGAGGAAGACATCCTGCCGCTGGCAGATGCCCTGGCCGCCGGCGGTATCCGTACCCTGGAAGTGACCCTGCGTTCCCAGCATGGGCTCAAGGCCATCCAGGTGCTGCGTGAGCAGCGCCCGGAGTTGTGCGTTGGCGCAGGCACTGTACTGGATCGCAGCATGTTCGCCGCCGTCGAGGCTGCCGGCGCGC AGTTCGTCGTCACCCCGGGCATTACCCAGGACATTCTCGAAGCGGGCGTGGACAGCGAAATCCCGCTGCTGCCAGGCATCAGTACGCCCTCTGAAATCATGATGGGCTATGCCCTGGGCTACCGCAGGTTCAAGTTGTTCCCGGCGGAAATCAGCGGCGGCGTGGCGGCGATCAAGGCCTTTGGCGGCCCGTTCGGCGATATTCGCTTTTGCCCAACCGGCGGCGTTAACCCGGCCAATGTACGTAACTACATGGCATTGCCCAACGTGATGTGCGTGGGCGGAACCTGGATGCTCGACAGCAGCTGGATCAAGAACGGCGACTGGGCGCGGATCGAAGCGTGCAGCGCGGAGGCGATCGCACTGTTGGACGCCAACTGA。

[0014] In one embodiment, the pyruvate-dependent aldolase NahE is immobilized in the first microchannel by the following method: dispersing the cultured and purified aldolase enzyme in a phosphate buffer solution impregnated with resin, slowly stirring at 20-22 °C, then taking out the resin, removing water in a freeze dryer, and then filling the dried immobilized resin into the microchannel; quickly introducing a suspension of a quantitative amount of iron powder mixed with water into the pipeline, and then winding the pipeline around a magnet to fix the iron powder in the microchannel

[0015] Preferably, the resin is any one of the aqueous adsorption resins ES-1, ES-103B, and ES-108; the dosage ratio of the resin to the pure enzyme of pyruvate-dependent aldolase NahE is 500-1500 mg: 1 mg. Among them, the wet true density of ES-1 is 0.95-1.04 g / mL; the wet true density of ES-103B is 0.7-0.8 g / mL; the wet true density of ES-108 is 1-1.05 g / mL. Preferably, in steps S1 and S2, the resin needs to be activated before use and then adsorb the pure enzyme

[0016] In steps S1 and S2, the aldolase is dispersed in PBS buffer solution after purification, adsorbed and immobilized on the resin in the microchannel to participate in the reaction, and the adsorption rate of the pure enzyme on the resin can be measured by an ultraviolet spectrophotometer. The calculation formula of the adsorption rate is (blank absorbance value - supernatant absorbance value) / blank absorbance value

[0017] Preferably, in step S1, the organic solvent includes but is not limited to n-heptane, methanol, ethanol, isopropanol, acetonitrile, dimethyl sulfoxide, preferably dimethyl sulfoxide

[0018] Among them, the concentration of the hydrochloric acid solution is 50 mM; the phosphate buffer solution is KH2PO4 / K2HPO4 or NaH2PO4 / Na2HPO4, the pH value is 6-8, and the total concentration of phosphate in the buffer solution is 50 mmol·L -1 ~200 mmol·L -1

[0019] Preferably, in step S1, the reaction temperature is 25-35 °C, the reaction residence time is 15-60 min, the pipeline in the reactor is a polytetrafluoroethylene tube, the inner diameter is 2-3 mm, and the pipeline volume is 2-4 ml; in step S2, the reaction temperature is 85-100 °C, the reaction residence time is 30-60 min, the pipeline in the reactor is a polytetrafluoroethylene tube, the inner diameter is 2-3 mm, and the pipeline volume is 2-4 ml

[0020] The dosage ratio of o-nitrobenzaldehyde, NahE, and iron powder in steps S1 and S2 is 50-150 mM: 1 mg: 500 mg

[0021] ​The present invention further provides a device for generating 2 - quinolinecarboxylic acid by using a chemo - enzymatic cascade reaction in a microfluidic field. The device includes a first feed pump, a second feed pump, a third feed pump, a first microchannel reactor, and a second microchannel reactor. Among them, the first feed pump and the second feed pump are connected to the first microchannel reactor in parallel through pipelines. The first microchannel reactor is connected in series with the second microchannel reactor, and the third feed pump is connected to the second microchannel reactor. Pyruvate - dependent aldolase NahE is immobilized in the first microchannel reactor, and iron powder is immobilized in the second microchannel reactor.

[0022] Advantages: Compared with the prior art, the present invention has the following advantages:

[0023] (1) In the microfluidic field, the present invention fixes aldolase and iron powder in segments, and uses the natural reaction of aldolase - aldol condensation reaction and iron powder reduction reaction to integrate chemical synthesis and enzymatic catalysis to obtain 2 - quinolinecarboxylic acid. This method avoids reaction media with serious pollution and expensive catalysts, has simple operation, mild reaction conditions, strong sustainability, high safety, high yield, and fast reaction speed, and is more in line with the requirements of green chemistry.

[0024] (2) The present invention adopts the method of immobilizing pure enzyme and iron powder. The pure enzyme is adsorbed in the aqueous resin and finally filled and fixed in the microchannel reactor, which can be stored at low temperature and is convenient for repeated use. The iron powder is fixed in the microchannel reactor by a magnet, which is convenient for disassembly and filling, and the sustainability and safety are improved.

[0025] (3) The present invention uses microchannel reaction technology to achieve a 1 - 3 order of magnitude improvement in the mass transfer and heat transfer speed and the reaction rate. The process is easy to control, and its continuous flow and low back - mixing characteristics can effectively improve the selectivity of the reaction. Description of the Drawings

[0026] Figure 1 is a reaction route diagram;

[0027] Figure 2 is a schematic diagram of the reaction device process;

[0028] Figure 3 is a 1H NMR spectrum of 4 - (2 - nitrophenyl)-2 - oxobut - 3 - enoic acid;

[0029] Figure 4 is a 1H NMR spectrum of 2 - quinolinecarboxylic acid. Detailed Embodiments

[0030] The following further describes the present invention in detail in conjunction with the drawings and specific embodiments, and the above - mentioned and / or other advantages of the present invention will become clearer.

[0031] In the following examples, the experimental methods are conventional methods unless otherwise specified; the reagents and materials can be obtained from commercial sources unless otherwise specified.

[0032] As Figure 1 shown, this example is mainly divided into two reaction steps: First, use the natural reaction catalyzed by aldolase - the aldol condensation reaction to obtain 4-(2-nitrophenyl)-2-oxobut-3-enoic acid; under acidic pH conditions, then use iron powder to reduce the nitro group in 4-(2-nitrophenyl)-2-oxobut-3-enoic acid to an amino group; finally, cyclize it into a quinoline ring to obtain 2-quinolinecarboxylic acid.

[0033] This example is implemented through the reaction device as Figure 2 shown.

[0034] Specifically, the reaction device includes a first feed pump (syringe A), a second feed pump (syringe B), a third feed pump (syringe C), a first microchannel reactor (microchannel reactor A), and a second microchannel reactor (microchannel reactor B); among them, syringe A and syringe B are connected to microchannel reactor A in parallel through pipelines, microchannel reactor A is in series with microchannel reactor B, and syringe C is connected to microchannel reactor B; pyruvate-dependent aldolase NahE is fixed in microchannel reactor A; iron powder is fixed in microchannel reactor B. A pipeline is used to connect between microchannel reactor A and microchannel reactor B in series, and a polytetrafluoroethylene tube can be selected.

[0035] Among them, pyruvate-dependent aldolase NahE is fixed by the following method: Disperse the cultured and purified aldolase enzyme in a phosphate buffer solution impregnated with resin, slowly stir at 20 - 22 °C, then take out the resin, remove water in a freeze dryer, and then fill the dried immobilized resin into the microchannel;

[0036] Iron powder is fixed by the following method: Rapidly introduce a suspension of a quantitative amount of iron powder mixed with water into the pipeline, and then wind the pipeline around a magnet to fix the iron powder in the microchannel.

[0037] The steps for constructing the aldolase in the following examples are as follows:

[0038] (1) Construct the trans-o-hydroxybenzylidene pyruvate hydratase-aldolase gene (nucleotide sequence as shown in SEQ ID NO.1) derived from Pseudomonas putida onto the pET-28a(+) vector (the restriction enzyme sites are Ndel and HindIII), and transfer it into Escherichia coli BL 21(DE 3);

[0039] (2) Inoculate 50 μL of the NahE glycerol strain constructed in step (1) into 5 mL of LB medium, add kanamycin with a final concentration of 100 μg / mL, and culture it with shaking at 37 °C and 200 rpm for 12 h to obtain a pre-cultured bacterial solution; transfer 5 mL of the pre-cultured bacterial solution to 500 mL of TB (containing 100 mL of PBS) medium, add kanamycin with a final concentration of 100 μg / mL, and culture it with shaking at 37 °C and 200 rpm for about 3 h until the OD600 reaches 0.6 - 0.7. When the medium temperature is cooled to 4 °C, add IPTG to a final concentration of 0.3 mM for induction expression, and continue to culture with shaking at 16 °C for 18 h. Centrifuge and concentrate the culture solution, collect the bacterial cells, and resuspend the bacterial cells in the buffer with a mixer using PBS buffer to prepare a whole cell solution with a concentration of 0.2 g / mL;

[0040] (3) Under the condition of a power of 200 W (working for 2 s and intermittent for 2 s), perform ultrasonic disruption in an ice-water bath for 30 min to obtain a whole cell lysate;

[0041] (4) Centrifuge the cell lysate thoroughly through a 0.45 μm filter membrane, and pump it into a pre-equilibrated Ni-NTA resin column with a peristaltic pump. After the supernatant is loaded, perform gradient elution of the resin with 60 mL each of lysis buffers with imidazole concentrations of 10 mM, 20 mM, 30 mM, and 40 mM. After analyzing and eluting the miscellaneous proteins by ultraviolet detection, rinse the Ni-NTA with a lysis buffer containing 500 mM imidazole, and collect the pure enzyme. The collected pure enzyme contains a high concentration of imidazole. Use an ultrafiltration tube to perform ultrafiltration centrifugation to elute the imidazole until the imidazole concentration is lower than 10 mM, and then collect the pure enzyme (1.5 mg / mL).

[0042] Determination of the activity of aldolase in the free state

[0043] First, prepare a 1 M solution of o-nitrobenzaldehyde in dimethyl sulfoxide as solution one, and prepare a 1 M solution of sodium pyruvate in a 50 mM KH2PO4 - K2HPO4 buffer solution with a pH of 7.4 as solution two. Take 1 mL of the enzyme solution (1.5 mg / mL) into a reaction tube, and dilute it to 1.8 mL with a 50 mM KH2PO4 - K2HPO4 buffer solution with a pH of 7.4. Add 600 μL of solution two, and gradually add 200 μL of solution one under shaking conditions. Take 100 μL of the reaction solution at 0.5 h, 1 h, and 2 h to add 200 μL of methanol to quench the reaction, and detect the conversion rate with a high performance liquid chromatograph through a 0.45 μm filter head.

[0044] The measured activity of the free enzyme is that the specific activity of the free enzyme is 53.8 U mg-1. U is defined as the amount of enzyme that catalyzes the consumption of 1 μmol of substrate per minute under the reference conditions.

[0045] Example 1

[0046] 500 mg of aqueous resin ES-1 was added to 1 mL of diluted pure NahE enzyme solution (1 mg / mL, PBS buffer, 50 mM, pH 7.4). After slow stirring at 20 °C and 700 rpm for 24 h, centrifugation was performed to obtain the immobilized enzyme and the supernatant. The absorbance value of the supernatant was measured at a wavelength of 340 nm using a UV spectrophotometer to be 0.060, and the absorbance value of the corresponding blank control was 0.083. It can be calculated that under this condition, the adsorption rate of aqueous resin ES-1 to pure NahE enzyme was 27.7%. The absorption rate calculation formula is: Absorption rate = (Blank absorbance - Detection absorbance) / Blank absorbance. The same operation was performed on ES-103B and ES-108, and the adsorption rate of ES-103B to pure NahE enzyme was 20.6%, and the adsorption rate of ES-108 to pure NahE enzyme was 12.7%.

[0047] Example 2

[0048] 500 mg of aqueous resin ES-108 was added to 1 mL of diluted pure NahE enzyme solution (1 mg / mL). After slow stirring at 20 °C and 700 rpm for 24 h, the resin was taken out, and the water in the resin was removed in a freeze dryer. 500 mg of the dried immobilized resin was filled into a microchannel reactor A with an inner diameter of 2 mm (the retention volume was 2 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of a 50 mM o-nitrobenzaldehyde solution was placed in syringe A, and 10 mL of a 150 mM sodium pyruvate solution was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 60 min. The effluent from microchannel reactor A was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 4-(2-nitrophenyl)-2-oxobut-3-enoic acid. The substrate o-nitrobenzaldehyde and sodium pyruvate were converted into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid, and the conversion rate of o-nitrobenzaldehyde was greater than or equal to 99%. The NMR spectrum is as Figure 3 。

[0049] Example 3

[0050] 500 mg of aqueous resin ES-108 was added to 1 mL of diluted NahE pure enzyme solution (0.75 mg / mL). After slowly stirring at 20 °C and 700 rpm for 24 h, the resin was taken out, dehydrated in a freeze dryer, and 500 mg of the dried immobilized resin was filled into a microchannel reactor A with an inner diameter of 3 mm (the retention volume was 2.2 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of a 100 mM o-nitrobenzaldehyde solution was placed in syringe A, and 10 mL of a 300 mM sodium pyruvate solution was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 30 °C, and the retention time was 30 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 4-(2-nitrophenyl)-2-oxobut-3-enoic acid. The substrates o-nitrobenzaldehyde and sodium pyruvate were converted into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid, and the conversion rate of o-nitrobenzaldehyde was greater than or equal to 99%.

[0051] Example 4

[0052] 1000 mg of aqueous resin ES-103B was added to 2 mL of diluted NahE pure enzyme solution (500 μg / mL). After slowly stirring at 20 °C and 700 rpm for 24 h, the resin was taken out, dehydrated in a freeze dryer, and 1000 mg of the dried immobilized resin was filled into a microchannel reactor A with an inner diameter of 3 mm (the retention volume was 2.5 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of a 100 mM o-nitrobenzaldehyde solution was placed in syringe A, and 10 mL of a 200 mM sodium pyruvate solution was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 35 °C, and the retention time was 15 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 4-(2-nitrophenyl)-2-oxobut-3-enoic acid. The substrates o-nitrobenzaldehyde and sodium pyruvate were converted into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid, and the conversion rate of o-nitrobenzaldehyde was greater than or equal to 99%.

[0053] Example 5

[0054] 1500 mg of aqueous resin ES-1 was added to 4 mL of diluted NahE pure enzyme solution (250 μg / mL). After slowly stirring at 20 °C and 700 rpm for 24 h, the resin was taken out and dehydrated in a freeze dryer. 1500 mg of the dried immobilized resin was filled into microchannel reactor A with an inner diameter of 3 mm (the retention volume was 3.3 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of o-nitrobenzaldehyde solution with a concentration of 150 mM was placed in syringe A, and 10 mL of sodium pyruvate solution with a concentration of 150 mM was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 35 °C, and the retention time was 45 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 4-(2-nitrophenyl)-2-oxobut-3-enoic acid. The substrates o-nitrobenzaldehyde and sodium pyruvate were converted into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid, and the conversion rate of o-nitrobenzaldehyde was greater than or equal to 99%.

[0055] Example 6

[0056] 1500 mg of aqueous resin ES-1 was added to 4 mL of diluted NahE pure enzyme solution (250 μg / mL). After slowly stirring at 20 °C and 700 rpm for 24 h, the resin was taken out and dehydrated in a freeze dryer. 1500 mg of the dried immobilized resin was filled into microchannel reactor A with an inner diameter of 2 mm (the retention volume was 3.5 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of o-nitrobenzaldehyde solution with a concentration of 150 mM was placed in syringe A, and 10 mL of sodium pyruvate solution with a concentration of 150 mM was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 15 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 4-(2-nitrophenyl)-2-oxobut-3-enoic acid. The substrates o-nitrobenzaldehyde and sodium pyruvate were converted into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid, and the conversion rate of o-nitrobenzaldehyde was greater than or equal to 99%.

[0057] Example 7

[0058] Add 1500 mg of aqueous resin ES-1 to 4 mL of diluted NahE pure enzyme solution (250 μg / mL), stir slowly at 20 °C and 700 rpm for 24 h, then take out the resin. Remove the water from the resin in a freeze dryer. Fill 1500 mg of the dried immobilized resin into a microchannel reactor A with an inner diameter of 2 mm (3.5 mL). Take 500 mg of iron powder and fill it into a microchannel reactor B with an inner diameter of 2 mm (the retention volume is 4 mL). Dissolve o-nitrobenzaldehyde in dimethyl sulfoxide. Take 10 mL of a 150 mM o-nitrobenzaldehyde solution and place it in syringe A. Place 10 mL of a 150 mM sodium pyruvate solution in syringe B. Pump the two into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature is 25 °C and the retention time is 15 min. Then mix it with the hydrochloric acid solution in syringe C, and pump the two into microchannel reactor B at a flow volume ratio of 20:1. The reaction temperature is 95 °C and the retention time is 30 min. Collect the effluent from the microchannel reactor. Monitor the formation of 2-quinolinecarboxylic acid by High Performance Liquid Chromatography (HPLC). The substrates o-nitrobenzaldehyde and sodium pyruvate are converted to 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid is 99%. The NMR spectrum is as Figure 4 。

[0059] Example 8

[0060] Add 500 mg of aqueous resin ES-1 to 1 mL of diluted NahE pure enzyme solution (1 mg / mL), stir slowly at 20 °C and 700 rpm for 24 h, then take out the resin. Remove the water from the resin in a freeze dryer. Fill 500 mg of the dried immobilized resin into a microchannel reactor A with an inner diameter of 2 mm (the retention volume is 1.9 mL). Take 500 mg of iron powder and fill it into a microchannel reactor B with an inner diameter of 3 mm (the retention volume is 4 mL). Place 10 mL of a 50 mM o-nitrobenzaldehyde solution in syringe A. Dissolve o-nitrobenzaldehyde in dimethyl sulfoxide. Take 10 mL of a 50 mM sodium pyruvate solution and place it in syringe B. Pump the two into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature is 25 °C and the retention time is 15 min. Then mix it with the hydrochloric acid solution in syringe C, and pump the two into microchannel reactor B at a flow volume ratio of 20:1. The reaction temperature is 85 °C and the retention time is 45 min. Collect the effluent from the microchannel reactor. Monitor the formation of 2-quinolinecarboxylic acid by High Performance Liquid Chromatography (HPLC). The substrates o-nitrobenzaldehyde and sodium pyruvate are converted to 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid is 74%.

[0061] Example 9

[0062] 500 mg of aqueous resin ES-103B was added to 1 mL of diluted NahE pure enzyme solution (1 mg / mL). After slowly stirring at 20 °C and 700 rpm for 24 h, the resin was taken out and dehydrated in a freeze dryer. 500 mg of the dried immobilized resin was filled into a microchannel reactor A with an inner diameter of 2 mm (retained volume of 2.2 mL), and 500 mg of iron powder was filled into a microchannel reactor B with an inner diameter of 3 mm (retained volume of 3.5 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of a 50 mM o-nitrobenzaldehyde solution was placed in syringe A, and 10 mL of a 50 mM sodium pyruvate solution was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 15 min. Then it was mixed with the hydrochloric acid solution in syringe C, and the two were pumped into microchannel reactor B at a flow volume ratio of 20:1. The reaction temperature was 90 °C, and the retention time was 60 min. The effluent of the microchannel reactor was collected, and 2-quinolinecarboxylic acid was monitored by High Performance Liquid Chromatography (HPLC). The substrate o-nitrobenzaldehyde and sodium pyruvate were converted into 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid was 99%.

[0063] Example 10

[0064] 500 mg of aqueous resin ES-108 was added to 1 mL of the diluted pure NahE enzyme solution (1 mg / mL). After slow stirring at 20 °C and 700 rpm for 24 h, the resin was taken out, and the water in the resin was removed in a freeze dryer. 500 mg of the dried immobilized resin was filled into the microchannel reactor A with an inner diameter of 2 mm (the retention volume was 2 mL). 500 mg of iron powder was filled into the microchannel reactor B with an inner diameter of 3 mm (the retention volume was 2.4 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of a 50 mM o-nitrobenzaldehyde solution was placed in syringe A, and 10 mL of a 50 mM sodium pyruvate solution was placed in syringe B. The two were pumped into the microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 15 min. Then it was mixed with the hydrochloric acid solution in syringe C, and the two were pumped into the microchannel reactor B at a flow volume ratio of 20:1. The reaction temperature was 95 °C, and the retention time was 45 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 2-quinolinecarboxylic acid. The substrates o-nitrobenzaldehyde and sodium pyruvate were converted into 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid was 99%.

[0065] Example 11

[0066] 1000 mg of aqueous resin ES-1 was added to 2 mL of the diluted pure NahE enzyme solution (500 μg / mL). After slow stirring at 20 °C and 700 rpm for 24 h, the resin was taken out, and the water in the resin was removed in a freeze dryer. 1000 mg of the dried immobilized resin was filled into the microchannel reactor A with an inner diameter of 2 mm (the retention volume was 3 mL). 500 mg of iron powder was filled into the microchannel reactor B with an inner diameter of 2 mm (the retention volume was 2 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of a 100 mM o-nitrobenzaldehyde solution was placed in syringe A, and 10 mL of a 100 mM sodium pyruvate solution was placed in syringe B. The two were pumped into the microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 15 min. Then it was mixed with the hydrochloric acid solution in syringe C, and the two were pumped into the microchannel reactor B at a flow volume ratio of 20:1. The reaction temperature was 95 °C, and the retention time was 45 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 2-quinolinecarboxylic acid. The substrates o-nitrobenzaldehyde and sodium pyruvate were converted into 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid was 99%.

[0067] Example 12

[0068] Add 1500 mg of aqueous resin ES-108 to 4 mL of diluted pure NahE enzyme solution (250 μg / mL), slowly stir at 20 °C and 700 rpm for 24 h, then take out the resin. Remove the water from the resin in a freeze dryer. Fill 1500 mg of the dried immobilized resin into a microchannel reactor A with an inner diameter of 2 mm (the retention volume is 3.6 mL), and fill 500 mg of iron powder into a microchannel reactor B with an inner diameter of 3 mm. Dissolve o-nitrobenzaldehyde in dimethyl sulfoxide. Take 10 mL of a 150 mM o-nitrobenzaldehyde solution and place it in syringe A, and place 10 mL of a 150 mM sodium pyruvate solution in syringe B. Pump the two into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature is 25 °C and the retention time is 15 min. Then mix with the hydrochloric acid solution in syringe C, and pump the two into microchannel reactor B at a flow volume ratio of 20:1. The reaction temperature is 95 °C and the retention time is 45 min. Collect the effluent from the microchannel reactor. Monitor the formation of 2-quinolinecarboxylic acid by High Performance Liquid Chromatography (HPLC). The substrate o-nitrobenzaldehyde and sodium pyruvate are converted into 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid is 99%.

[0069] Example 13

[0070] Add 500 mg of aqueous resin ES-108 to 1 mL of diluted pure NahE enzyme solution (1 mg / mL), slowly stir at 20 °C and 700 rpm for 24 h, then take out the resin. Remove the water from the resin in a freeze dryer. Fill 500 mg of the dried immobilized resin into a microchannel reactor A with an inner diameter of 2 mm (the retention volume is 2 mL), and fill 500 mg of iron powder into a microchannel reactor B. Dissolve o-nitrobenzaldehyde in dimethyl sulfoxide. Take 10 mL of a 50 mM o-nitrobenzaldehyde solution and place it in syringe A, and place 10 mL of a 50 mM sodium pyruvate solution in syringe B. Pump the two into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature is 25 °C and the retention time is 15 min. Then mix with the hydrochloric acid solution in syringe C, and pump the two into microchannel reactor B at a flow volume ratio of 20:1. The reaction temperature is 85 °C and the retention time is 30 min. Collect the effluent from the microchannel reactor. Monitor the formation of 2-quinolinecarboxylic acid by High Performance Liquid Chromatography (HPLC). The substrate o-nitrobenzaldehyde and sodium pyruvate are converted into 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid is 63%.

[0071] Comparative Example 1

[0072] 500 mg of aqueous resin ES-108 was added to 1 mL of diluted NahE pure enzyme solution (1 mg / mL), and the mixture was slowly stirred at 20 °C and 700 rpm for 24 h. Then the resin was taken out, dehydrated in a freeze dryer, and 500 mg of the dried immobilized resin was filled into a microchannel reactor A with an inner diameter of 2 mm (the retention volume was 2 mL). o-Nitrobenzaldehyde was dissolved in isooctane. 10 mL of an o-nitrobenzaldehyde solution with a concentration of 50 mM was placed in syringe A, and 10 mL of a sodium pyruvate solution with a concentration of 150 mM was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 30 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 4-(2-nitrophenyl)-2-oxobut-3-enoic acid. The substrate o-nitrobenzaldehyde and sodium pyruvate were converted into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid, and the conversion rate of o-nitrobenzaldehyde was 83%.

[0073] Comparative Example 2

[0074] 1500 mg of aqueous resin ES-1 was added to 4 mL of diluted NahE pure enzyme solution (250 μg / mL), and the mixture was slowly stirred at 20 °C and 700 rpm for 24 h. Then the resin was taken out, dehydrated in a freeze dryer, and 1500 mg of the dried immobilized resin was filled into a microchannel reactor A with an inner diameter of 5 mm (the retention volume was 3.4 mL). o-Nitrobenzaldehyde was dissolved in isooctane. 10 mL of an o-nitrobenzaldehyde solution with a concentration of 150 mM was placed in syringe A, and 10 mL of a sodium pyruvate solution with a concentration of 150 mM was placed in syringe B. The two were pumped into microchannel reactor A at a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 15 min. The effluent of the microchannel reactor was collected and monitored by High Performance Liquid Chromatography (HPLC) to generate 2-quinolinecarboxylic acid. The substrate o-nitrobenzaldehyde and sodium pyruvate were converted into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid, and the conversion rate of o-nitrobenzaldehyde was 37%.

[0075] Comparative Example 3

[0076] 1500 mg of aqueous resin ES-1 was added to 4 mL of diluted NahE pure enzyme solution (250 μg / mL). After slowly stirring at 20 °C and 700 rpm for 24 h, the resin was taken out and dehydrated in a freeze dryer. 1500 mg of the dried immobilized resin was filled into a microchannel reactor A with an inner diameter of 2 mm (retained volume: 3.5 mL). o-Nitrobenzaldehyde was dissolved in dimethyl sulfoxide. 10 mL of an o-nitrobenzaldehyde solution with a concentration of 150 mM was placed in syringe A, and 10 mL of a sodium pyruvate solution with a concentration of 150 mM was placed in syringe B. The two were pumped into microchannel reactor A according to a flow volume ratio of 1:1. The reaction temperature was 25 °C, and the retention time was 15 min. The microchannel reaction solution was collected in a reaction flask. After adjusting the pH to 2, 500 mg of iron powder was added, and the mixture was heated and stirred at 95 °C for 60 min. After standing, the supernatant was taken and monitored by High Performance Liquid Chromatography (HPLC) to generate 2-quinolinecarboxylic acid. The substrate o-nitrobenzaldehyde and sodium pyruvate were converted into 2-quinolinecarboxylic acid, and the conversion rate of 4-(2-nitrophenyl)-2-oxobut-3-enoic acid was 69%. The results showed that when the reduction with iron powder was switched to a batch reactor, the conversion rate was lower and the reaction time was longer than that in the microreactor.

[0077] In summary, the present invention provides a method for generating 2-quinolinecarboxylic acid by a chemo-enzymatic cascade reaction in a microfluidic field. The immobilized aldolase is used as a biocatalyst in the first microchannel. The 4-(2-nitrophenyl)-2-oxobut-3-enoic acid generated by catalyzing o-nitrobenzaldehyde and pyruvic acid is very stable in an aqueous environment. The combination of microfluidic field technology and immobilized enzyme can be recycled and synthesized, greatly improving the utilization rate of the enzyme. In addition, the microfluidic field technology has natural excellent mass transfer and heat transfer advantages in two-phase reactions, which can greatly improve the conversion efficiency of reducing nitro to amino by metal in the second microchannel and significantly shorten the reaction time. Finally, compared with the post-treatment and purification required by a batch reactor, the microfluidic field technology can integrate reactions in different chemical environments together without separation steps, has good industrial prospects, and is more environmentally friendly.

Claims

1. A method for generating 2-quinolinecarboxylic acid by using a chemo-enzymatic cascade reaction in a microfluidic field, characterized in that, Comprising the following steps: S1: Dissolve o-nitrobenzaldehyde in an organic solvent to obtain solution A, dissolve sodium pyruvate in a phosphate buffer solution to obtain solution B, and simultaneously pump solution A and solution B into a first microchannel reactor immobilized with pyruvate-dependent aldolase NahE, and catalyze o-nitrobenzaldehyde into 4-(2-nitrophenyl)-2-oxobut-3-enoic acid in the first microchannel reactor; wherein, the pyruvate-dependent aldolase NahE is a trans-o-hydroxybenzylidene pyruvate hydratase-aldolase derived from Pseudomonas putida with the amino acid sequence shown in SEQ ID NO.2; the molar ratio of solution A to solution B is 1:1 to 3; in step S1, the reaction temperature is 25 to 35 °C, the reaction residence time is 15 to 60 min, the pipeline in the reactor is a polytetrafluoroethylene tube with an inner diameter of 2 to 3 mm and a pipeline volume of 2 to 4 ml; S2: Fix iron powder in the second microchannel reactor. After mixing the reaction solution obtained in step S1 with hydrochloric acid solution to adjust the pH to 2 - 4, inject it into the second microchannel reactor, thereby reducing 4-(2-nitrophenyl)-2-oxobut-3-enoic acid to obtain 2-quinolinecarboxylic acid; in step S2, the reaction temperature is 85 - 100 °C, the reaction residence time is 30 - 60 min, the pipeline in the reactor is a polytetrafluoroethylene tube with an inner diameter of 2 - 3 mm, and the pipeline volume is 2 - 4 ml; In steps S1 and S2, the dosage ratio of the o-nitrobenzaldehyde, NahE, and iron powder is 50 - 150 mM: 1 mg: 500 mg.

2. The method according to claim 1, wherein In step S1, the pyruvate-dependent aldolase NahE is prepared by the following method: The gene of the pyruvate-dependent aldolase NahE with the nucleotide sequence shown in SEQ ID NO.1 is constructed onto the pET-28a(+) vector and transferred into Escherichia coli BL 21(DE 3), and cultured and purified to obtain the corresponding pyruvate-dependent aldolase NahE.

3. The method according to claim 1, wherein In step S1, the pyruvate-dependent aldolase NahE is immobilized in the first microchannel by the following method: Disperse the cultured and purified aldolase enzyme in a phosphate buffer solution impregnated with resin, slowly stir at 20 - 22 °C, then take out the resin, remove water in a freeze dryer, and then fill the dried immobilized resin into the microchannel; quickly introduce a suspension of a quantitative amount of iron powder and water into the pipeline, and then wind the pipeline around a magnet to fix the iron powder in the microchannel.

4. The method according to claim 3, characterized in that, The resin is any one of the aqueous adsorption resins ES-1, ES-103B, and ES-108; the dosage ratio of the resin and the pure enzyme of the pyruvate-dependent aldolase NahE is 500 - 1500 mg: 1 mg.

5. The method according to claim 1, characterized in that, In step S1, the organic solvent is any one or more of n-heptane, methanol, ethanol, isopropanol, acetonitrile, and dimethyl sulfoxide; the concentration of the hydrochloric acid solution is 50 mM; the phosphate buffer solution is KH2PO4 / K2HPO4 or NaH2PO4 / Na2HPO4, with a pH value of 6-8, and the total concentration of phosphate in the buffer solution is 50 mmol·L -1 -200 mmol·L -1 .

Images